Informatie

11: Restrictietoewijzing - Biologie


Restrictie-endonucleasen (RE's) herkennen en splitsen specifieke plaatsen in DNA-moleculen. In dit lab ga je RE's gebruiken om te onderscheiden welke plasmiden bevatten: S. cerevisiae of S. pombé ORF's of de bacteriële lacZ gen.


Doelen

Aan het einde van dit lab kunnen studenten:

  • beschrijf de biologische oorsprong en functies van RE's.
  • gebruik online tools om herkenningsplaatsen voor RE's in een DNA-molecuul te identificeren.
  • een strategie bedenken om DNA-moleculen te onderscheiden door RE's te selecteren voor gebruik in DNA-digesten.
  • interpreteer de patronen van restrictiefragmenten gescheiden op agarosegels.

In het laatste experiment isoleerde uw groep drie verschillende plasmiden uit getransformeerde bacteriën. Een van de drie plasmiden draagt ​​de S. cerevisiae MET gen dat is geïnactiveerd in uw giststam. Dit LEERDE KENNEN gen werd gekloond in het pBG1805-plasmide (Gelperin et al., 2005). Een tweede plasmide draagt ​​de S. pombé homoloog voor de LEERDE KENNEN gen, gekloneerd in het pYES2.1-plasmide. Het derde plasmide is een negatieve controle die de bacteriële lacZ+ gen gekloneerd in pYES2.1. In dit lab zal uw team een ​​strategie ontwerpen en uitvoeren om onderscheid te maken tussen de plasmiden met behulp van restrictie-endonucleasen. In het volgende lab ga je de producten van de restrictiedigesten, of restrictiefragmenten, scheiden door middel van agarosegelelektroforese, waardoor een restrictiekaart wordt gegenereerd.


Technieken van de biologie voor het in kaart brengen van beperkingen

Een beschrijving van restrictie-endonuclease-splitsingsplaatsen in een stuk DNA wordt een limiteringskaart genoemd. Een dergelijke kaart wordt normaal gesproken gegenereerd als de eerste maatstaf bij het kwalificeren van een onbekend desoxyribonucleïnezuur, en een vereiste om het voor andere doeleinden te gebruiken. Restrictie-enzymen die niet vaak DNA splitsen (bijv. die met 6 bp bevestigingsplaatsen) zijn relatief goedkoop en worden gebruikt om op een kaart te brengen (Chakraborty, Pandey, et.al., 2006). Restrictieplaatsen zijn specifieke bevestigingsplaatsen waar enzymen die bekend staan ​​als endonucleasen het deoxyribonucleïnezuur splitsen.

bijv. EcoRI-verlagingen bij GAATTC (Gale, 2003). Toen ze werden ontdekt in archaea en bacteriën, maakten deze enzymen deel uit van het afweermechanisme van dergelijke wezens, waardoor de vreemde DNA's werden beperkt om op de cel te bewegen. Deze enzymen zullen cellen ondersteunen door het bezettende DNA te verteren in kleine, niet-functionele stukjes. Dit is dus waar de naam 'limitation enzyme' komt van de kaart van het enzym, d.w.z. het vermogen van het enzym om de toegang tot de cel te beperken (Carroll, Griffiths, et.

al. , 2008 ). Restrictiekaarten tonen de vergelijkende locatie van een keuze aan restrictieplaatsen langs additief of rond desoxyribonucleïnezuur.

Het in kaart brengen van restricties omvat een reeks restrictie-enzymen die het deoxyribonucleïnezuur verteren en zo de eindpuntfragmenten verdelen door middel van agarosegelkataforese. De vormen van fragmenten die worden geproduceerd door restrictie-enzymdigestie vinden de afstand tussen limitatie-enzymplaatsen en zo kan informatie worden verkregen over de constructie van een onbekend stukje DNA (Champness '038 A Snyder, 2007).


Beperkingstoewijzing

In het laatste experiment isoleerde uw groep drie verschillende plasmiden uit getransformeerde bacteriën. Een van de drie plasmiden draagt ​​de S. cerevisiae MET gen dat is geïnactiveerd in uw giststam. Dit MET-gen werd gekloneerd in het pBG1805-plasmide (Gelperin et al., 2005). Een tweede plasmide draagt ​​de N. crassa homoloog voor de LEERDE KENNEN gen, gekloneerd in het pYES2.1-plasmide. Het derde plasmide is een negatieve controle die het bacteriële lacZ+-gen bevat dat is gekloneerd in pYES2.1. In dit lab zal uw team een ​​strategie ontwerpen en uitvoeren om onderscheid te maken tussen de plasmiden met behulp van restrictie-endonucleasen. In het volgende lab ga je de producten van de restrictiedigesten, of restrictiefragmenten, scheiden door middel van agarosegelelektroforese, waardoor een restrictiekaart wordt gegenereerd.

Beperking endonucleasen
Bacteriële restrictie-/modificatiesystemen beschermen tegen indringers

De ontdekking van restrictie-enzymen, of restrictie-endonucleasen (RE's), was cruciaal voor de ontwikkeling van moleculaire klonering. RE's komen van nature voor in bacteriën, waar ze specifiek korte stukken nucleotiden in DNA herkennen en dubbelstrengs breuken katalyseren op of nabij de herkenningsplaats (ook bekend als een restrictieplaats). Tot op heden zijn duizenden RE's met verschillende specificiteiten beschreven. Je vraagt ​​je misschien af ​​waarom bacteriën deze potentieel destructieve enzymen herbergen. RE's maken deel uit van een bacterieel afweersysteem tegen vreemd DNA, zoals een infectieuze bacteriofaag. De RE-plaatsen in het eigen DNA van de bacterie zijn beschermd tegen splitsing omdat ze zijn gemodificeerd door een methyltransferase dat specifiek de RE-plaatsen wijzigt. De gecombineerde activiteiten van het endonuclease en methyltransferase worden een restrictie-/modificatiesysteem genoemd. Tegenwoordig worden de meeste in de handel verkrijgbare RE's niet gezuiverd uit hun natuurlijke bronnen. In plaats daarvan worden RE's meestal geïsoleerd uit bacteriën die grote hoeveelheden RE's uit plasmiden tot overexpressie brengen. Deze recombinante RE's zijn vaak ontwikkeld door moleculair biologen om aminozuurveranderingen op te nemen die de katalytische activiteit of stabiliteit van de RE verhogen.

Om te begrijpen hoe RE's werken, gebruiken we EcoRI, een van de best bestudeerde RE's, als voorbeeld. Hoewel de namen van individuele RE's misschien een beetje lijken op babypraat, is de nomenclatuur eigenlijk heel systematisch en gebaseerd op de biologische bron. EcoRI wordt van nature aangetroffen in de RY13-stam van Escherichia coli. De naam begint met het geslacht en de soort (Eco for E coli), gevolgd door een stam-ID (R voor RY13), en eindigt met een Romeins cijfer dat de verschillende RE's in de stam onderscheidt. Stam RY13 van E coli bevat meerdere RE's, maar alleen EcoRI en EcoRV worden veel gebruikt in de moleculaire biologie.

Restrictie-enzymen splitsen specifieke plaatsen in DNA

Restrictie-enzymen zoals EcoRI worden vaak 6-cutters genoemd, omdat ze een sequentie van 6 nucleotiden herkennen. Uitgaande van een willekeurige verdeling van A, C, G en Ts in DNA, voorspelt de waarschijnlijkheid dat een herkenningsplaats voor een 6-cutter ongeveer één keer zou moeten voorkomen voor elke 4096 bp (46) in DNA. Natuurlijk is de verdeling van nucleotiden in DNA niet willekeurig, dus de werkelijke grootte van DNA-fragmenten die door EcoRI worden geproduceerd, variëren van honderden tot vele duizenden basenparen, maar de gemiddelde grootte ligt dicht bij 4000 bp. DNA-fragmenten van deze lengte zijn bruikbaar in het laboratorium, omdat ze lang genoeg zijn om de coderende sequentie voor eiwitten te bevatten en goed worden opgelost op agarosegels.

EcoRI herkent de sequentie G A A T T C in dubbelstrengs DNA. Deze herkenningsreeks is een palindroom met een tweevoudige symmetrieas, omdat het lezen van 5' naar 3' op beide strengen van de helix dezelfde reeks geeft. Het palindroom karakter van de restrictieplaats wordt duidelijker in de onderstaande figuur. De stip in het midden van de restrictieplaats geeft de symmetrie-as aan. EcoRI katalyseert de hydrolyse van de fosfodiesterbindingen tussen G en A op beide DNA-strengen. De restrictiefragmenten die in de reactie worden gegenereerd, hebben korte enkelstrengs staarten aan de 5'-uiteinden. Deze uiteinden worden vaak "kleverige uiteinden" genoemd vanwege hun vermogen om waterstofbruggen te vormen met complementaire DNA-sequenties.

EcoRI katalyseert de splitsing van een palindroomherkenningsplaats. De herkenningsplaats voor EcoRI heeft een tweevoudige symmetrieas. Splitsing genereert twee fragmenten met 5'-kleverige uiteinden.

RE's worden soms moleculaire scharen genoemd vanwege hun vermogen om restrictiefragmenten te genereren die eindigen met gedefinieerde sequenties. Deze 'plakkerige uiteinden' zijn belangrijk voor recombinant-DNA-technologie, omdat ze onderzoekers in staat stellen designer-DNA-moleculen te construeren. Elke twee DNA-moleculen met compatibele kleverige uiteinden kunnen met elkaar worden verbonden door DNA-ligasen die als de "pasta" dienen door gebroken fosfodiesterbindingen opnieuw af te dichten. We zullen in deze klas geen recombinante moleculen genereren, maar het is belangrijk om hun belang voor de moderne biologie te begrijpen. Overweeg de pBG1805- en pYES2.1-plasmiden. Op de plasmidekaarten kun je zien dat deze complexe plasmiden werden geconstrueerd door DNA-sequenties uit evolutionair verschillende bronnen aan elkaar te naaien.

DNA-moleculen hebben unieke restrictiekaarten

De sequentie van een DNA-molecuul bepaalt de verdeling van herkenningsplaatsen voor RE's. Er zijn honderden RE's met unieke specificaties beschreven, zodat onderzoekers de verdeling van deze herkenningsplaatsen in een DNA-molecuul kunnen gebruiken om een ​​'kaart' van de sequentie te construeren. In deze experimenten worden DNA-monsters verteerd met verschillende RE's om een ​​restrictiekaart te produceren, een verzameling kleinere restrictiefragmenten die aan beide uiteinden door de RE zijn gesplitst. De moleculen in het digest worden vervolgens gescheiden door agarosegelelektroforese. Aan de hand van de grootte van de restrictiefragmenten die op de gel zijn opgelost, kunnen onderzoekers het originele DNA-molecuul identificeren dat in de restrictiedigestie is gebruikt.

Zorgvuldige planning is vereist voor zinvolle restrictiekaarten. De eerste stap in een mapping-experiment is het identificeren van de grootte van restrictiefragmenten die zullen worden gegenereerd uit een doel-DNA-molecuul met verschillende RE's. Een verscheidenheid aan softwareprogramma's genereert deze restrictiekaarten en levert tabelgegevens met details over de lengtes en posities van de restrictiefragmenten in de DNA-sequentie. De lijst met enzymen die een bepaalde sequentie knippen is altijd indrukwekkend, maar meestal blijken slechts een paar enzymen praktisch te zijn voor het doel van het experiment. Bij het kiezen van RE's voor een restrictiekaart zijn er veel dingen waarmee u rekening moet houden:

  • Hoeveel restrictiefragmenten worden er gegenereerd?
  • Wat zijn de voorspelde groottes van de restrictiefragmenten?
  • Zullen alle restrictiefragmenten duidelijk worden opgelost op 1% agarosegels?
  • Zal de RE een onderscheidende set fragmenten genereren uit elk DNA-monster?
  • Hoe duur is de RE?

In dit lab ga je het NEB Cutter-programma gebruiken om REs-sites in plasmidesequenties te identificeren. (NEB Cutter wordt geleverd door New England Biolabs, een commerciële leverancier van RE's.) U zult zich herinneren dat plasmiden supercoiled cirkels zijn. Spijsvertering met een RE opent een plasmide en ontspant de structuur. (Zonder RE-digestie zijn de schijnbare afmetingen van plasmiden op agarosegels onbetrouwbaar.) De plasmiden die we gebruiken voor onze experimenten zijn complexe plasmiden op basis van pYES2.1 (5886 bp) of pBG1805 (6573 bp). Zoek in de resultaten naar RE's die duidelijk te onderscheiden restrictiefragmenten van uw plasmiden zullen genereren. Het wordt sterk aanbevolen om voor alle drie de samenvattingen dezelfde RE te selecteren! Aangezien twee plasmiden zijn gebaseerd op pYES2.1, zou het niet verrassend zijn om enkele algemene restrictiefragmenten in die digesten waar te nemen, wat een nuttige diagnose zou kunnen zijn.

Omgaan met restrictie-endonucleasen in het laboratorium

De RE's die we in het lab gebruiken, zijn sterk gezuiverde (en dure!) eiwitten die zijn gezuiverd uit recombinante bacteriën. Zoals alle enzymen functioneert elke RE optimaal onder
een gedefinieerde reeks reactieomstandigheden, waaronder temperatuur, pH en de concentraties van metaalionen en zouten. De fabrikant van onze RE's heeft buffers ontwikkeld die hoge activiteitsniveaus ondersteunen voor meer dan 200 RE's. Elke buffer bevat 0,1 mg/ml runderserumalbumine (BSA), een overvloedig eiwit uit koeienserum, dat helpt bij het stabiliseren van denaturatiegevoelige RE's en om niet-specifieke absorptie van RE's in reageerbuisjes en tips te voorkomen.

Zoals alle enzymen zijn RE's onderhevig aan spontane denaturatie, dus met RE's moet voorzichtig worden omgegaan. (Ter vergelijking: DNA is een uitzonderlijk stabiel molecuul.) De snelheid van eiwitdenaturatie neemt toe met de temperatuur en op het grensvlak tussen lucht en water. Enkele eenvoudige voorzorgsmaatregelen zullen denaturatie minimaliseren. Volg deze eenvoudige regels wanneer u de restrictiesamenvattingen voorbereidt:


Beperking in kaart brengen!

Hey jongens, zou graag wat duidelijkheid over dit onderwerp waarderen aub

Ik begrijp hoe gelelektroforese werkt en ik begrijp hoe je de DNA-fragmenten van twee verschillende mensen kunt matchen om te zien of ze op elkaar lijken (vader van het kind of plaats delict enz.)

Ik zag een examenvraag op het voorbeeldpapier die enkele vragen stelt met betrekking tot restrictiemapping (met behulp van restrictie-enzymen zoals EcoRI en HindIII) Kan iemand mij uitleggen wat het nut van restrictiemapping is en hoe je erachter komt wat ze in godsnaam willen jij om te sporten?

Niet wat u zoekt? Probeer & hellip

Restrictiemapping is het proces waarbij structurele informatie over een stuk DNA wordt verkregen door het gebruik van restrictie-enzymen

website lijkt goed om te kijken op http://faculty.plattsburgh.edu/donal. h/Restmap.html
het praat een beetje over het restrictie-enzym Eco RI

ik kan me niet herinneren dat ik dat op A-niveau heb gedaan

(Originele post door AbzS)
Hey jongens, zou echt wat duidelijkheid over dit onderwerp waarderen aub

Ik begrijp hoe gelelektroforese werkt en ik begrijp hoe je de DNA-fragmenten van twee verschillende mensen kunt matchen om te zien of ze op elkaar lijken (vader van het kind of plaats delict enz.)

Ik zag een examenvraag op het voorbeeldpapier die enkele vragen stelt met betrekking tot restrictiemapping (met behulp van restrictie-enzymen zoals EcoRI en HindIII) Kan iemand mij uitleggen wat het nut van restrictiemapping is en hoe je erachter komt wat ze in godsnaam willen jij om te sporten?

Het basisidee van restrictiemapping is dat, aangezien er natuurlijke genetische verschillen (puntmutaties) zijn tussen organismen in dezelfde soort, sommige individuen restrictieplaatsen zullen hebben die anderen niet hebben en vice versa.
bijv.
Persoon 1: AAATTTACAtGGACACGGACACGG
Persoon 2: AAATTTACACGGACACGGACACGG

Als de restrictieplaats ACACGG was, zou knippen met een restrictie-enzym 4 fragmenten opleveren voor Persoon 2, maar vanwege een enkele mutatie in Persoon 1 zou het slechts 3 fragmenten opleveren. Als u in dit voorbeeld gelelektroforese op beide mensen zou uitvoeren, zou u twee verschillende patronen krijgen die overeenkomen met elke persoon - en dus kunt u ze onderscheiden/identificeren.

In mijn voorbeeld gaf ik 24 basen, als je bedenkt dat het menselijk genoom meer dan 3.000.000.000 basen heeft, dan kun je zien dat een restrictiekaart bijna uniek zou moeten zijn voor elk individu.

Wat betreft wat ze willen dat je uitwerkt. misschien als je ons een van de vragen vertelt?

(Originele post door atheïst met geloof)
Het basisidee van restrictiemapping is dat, aangezien er natuurlijke genetische verschillen (puntmutaties) zijn tussen organismen in dezelfde soort, sommige individuen restrictieplaatsen zullen hebben die anderen niet hebben en vice versa.
bijv.
Persoon 1: AAATTTACAtGGACACGGACACGG
Persoon 2: AAATTTACACGGACACGGACACGG

Als de restrictieplaats ACACGG was, zou knippen met een restrictie-enzym 4 fragmenten opleveren voor Persoon 2, maar vanwege een enkele mutatie in Persoon 1 zou het slechts 3 fragmenten opleveren. Als u in dit voorbeeld gelelektroforese op beide mensen zou uitvoeren, zou u twee verschillende patronen krijgen die overeenkomen met elke persoon - en dus kunt u ze onderscheiden/identificeren.

In mijn voorbeeld gaf ik 24 basen, als je bedenkt dat het menselijk genoom meer dan 3.000.000.000 basen heeft, dan kun je zien dat een restrictiekaart bijna uniek zou moeten zijn voor elk individu.

Wat betreft wat ze willen dat je uitwerkt. misschien als je ons een van de vragen vertelt?

Dat was geweldig, oké, dus ik begrijp het punt nu. Wat betreft de vraag: http://store.aqa.org.uk/qual/gce/pdf. 5-W-SQP-07.PDF

BTW Bedankt, ik waardeer het echt

(Originele post door AbzS)
Dat was geweldig, oké, dus ik begrijp het punt nu. Wat betreft de vraag: http://store.aqa.org.uk/qual/gce/pdf. 5-W-SQP-07.PDF

BTW Bedankt, ik waardeer het echt

Voor dit soort vragen zou mijn tip zijn om het stukje DNA te tekenen en op papier te werken, in plaats van te proberen het in je hoofd uit te werken.

Dus 9b(i)
De volledige samenvatting (waar alle restrictieplaatsen zijn geknipt) toont vier fragmenten. Als je nu een lijn hebt getrokken die je DNA vertegenwoordigt, kun je lijnen plakken die je restrictieplaatsen vertegenwoordigen en je zou moeten zien dat als je 3 restrictieplaatsen hebt, je vier fragmenten krijgt.
Antwoord = 3 EcoRI-herkenningsplaatsen.

9b(ii)
Waarom zijn er meer lijnen? Nou, omdat bij een gedeeltelijke vertering niet alle restrictieplaatsen op alle stukjes DNA zijn afgesneden, heb je dus wat langere fragmenten die ergens in hun lengte een restrictieplaats bevatten. Langer fragment = meer wrijving = minder beweging in de gel, dus de banden bevinden zich in de buurt van de bovenkant van de gel.

9b(iii)
Dit is een lastige vraag, want figuur 8 is vreselijk gelabeld. Hoe dan ook, bij eerste lezing lijkt het alsof fragment 3kb + 4kb van volledige vertering een radioactief fragment geeft, maar ze zijn eigenlijk van een gedeeltelijke vertering. Gekke AQA.

Hoe dan ook, hoe weten we de posities van een fragment van 1 kb + 3 kb?
Nou, op slechts 1 fragment van de volledige samenvatting staat de radioactieve marker. Nu zal ik proberen mijn werk te beschrijven, maar het is moeilijk zonder te kunnen tekenen en laten zien.

Er is een 3kb + 4kb fragment van de gedeeltelijk digest die radioactief is en twee die groter zijn dan 4kb. Als slechts 1 fragment uit de vol digest bevat de radioactiviteit die we nodig hebben om te zien welke combinaties fragmenten van die grootte kunnen maken.

Nu zijn het fragment van 1 kb en 2 kb niet radioactief, dus we kunnen uitsluiten dat ze het radioactieve label bevatten.
Als een fragment van 3 kb het label bevat
3kb + 1kb = 4kb -mee eens met resultaten
3kb alleen - eens met de resultaten

Als een fragment van 4 kb het label bevat
--we kunnen onmogelijk een fragment van 3 kb maken dat radioactief is!--

Als we naar onze combinatie hierboven kijken, kunnen we zien dat het fragment van 4 kb MOET worden gevormd uit een fragment van 3 kb en 1 kb in die volgorde en dat het fragment van 3 kb radioactief is.

Als je echt slim bent, kun je ook de posities van de 2kb + 4kb-fragmenten bepalen -- maar dat laat ik aan jou over om uit te werken.


Beperkingskaart

EEN beperkingskaart is een kaart van bekende restrictieplaatsen binnen een sequentie van DNA. Restrictie mapping vereist het gebruik van restrictie-enzymen. In de moleculaire biologie worden restrictiekaarten gebruikt als referentie om plasmiden of andere relatief korte stukjes DNA te engineeren, en soms voor langer genomisch DNA. Er zijn andere manieren om kenmerken op DNA in kaart te brengen voor DNA-moleculen met een langere lengte, zoals in kaart brengen door middel van transductie. [1]

Een benadering bij het construeren van een restrictiekaart van een DNA-molecuul is om het hele molecuul te sequensen en de sequentie door een computerprogramma te laten lopen dat de herkenningsplaatsen zal vinden die aanwezig zijn voor elk bekend restrictie-enzym.

Voordat het sequencen geautomatiseerd was, zou het onbetaalbaar zijn geweest om een ​​hele DNA-streng te sequencen. Om de relatieve posities van restrictieplaatsen op een plasmide te vinden, wordt een techniek gebruikt waarbij enkelvoudige en dubbele restrictiedigesten worden gebruikt. Op basis van de grootte van de resulterende DNA-fragmenten kunnen de posities van de plaatsen worden afgeleid. Restrictietoewijzing is een zeer bruikbare techniek wanneer deze wordt gebruikt voor het bepalen van de oriëntatie van een insert in een kloneringsvector, door de positie van een excentrische restrictieplaats in de insert in kaart te brengen. [2]

De experimentele procedure vereist eerst een hoeveelheid gezuiverd plasmide-DNA (zie appendix) voor elke uit te voeren digest. De spijsvertering wordt vervolgens uitgevoerd met elk gekozen enzym(en). De resulterende monsters worden vervolgens gelopen op een elektroforesegel, typisch op agarosegel.

De eerste stap na de voltooiing van elektroforese is het optellen van de grootte van de fragmenten in elke baan. De som van de individuele fragmenten moet gelijk zijn aan de grootte van het originele fragment, en de fragmenten van elke digest moeten ook samen dezelfde grootte hebben. Als de fragmentgroottes niet goed optellen, zijn er twee waarschijnlijke problemen. In één geval kunnen enkele van de kleinere fragmenten van het uiteinde van de gel zijn gelopen. Dit komt vaak voor als de gel te lang wordt gebruikt. Een tweede mogelijke foutbron is dat de gel niet dicht genoeg was en daarom niet in staat was om fragmenten van bijna dezelfde grootte op te lossen. Dit leidt tot een gebrek aan scheiding van fragmenten die ongeveer even groot waren. Als alle digesten fragmenten produceren die optellen, kan men de positie van de REN-plaatsen (restrictie-endonuclease) afleiden door ze op plekken op het oorspronkelijke DNA-fragment te plaatsen die voldoen aan de fragmentgroottes die door alle drie de digesten worden geproduceerd.

Zie ook restrictie-enzymen voor meer details over de enzymen die bij deze techniek worden gebruikt.

Snelle denaturatie en renaturatie van een ruw DNA-preparaat door alkalische lysis van de cellen en daaropvolgende neutralisatie

Bij deze techniek worden de cellen onder alkalische omstandigheden gelyseerd. Het DNA in het mengsel wordt gedenatureerd (strengen gescheiden) door de waterstofbruggen tussen de twee strengen te verbreken. Het grote genomische DNA is onderhevig aan verwarring en blijft gedenatureerd wanneer de pH tijdens de neutralisatie wordt verlaagd. Met andere woorden, de strengen komen weer bij elkaar op een ongeordende manier, willekeurig basenparen. De strengen van de circulaire supercoiled plasmiden blijven relatief nauw uitgelijnd en zullen correct renatureren. Daarom zal het genomische DNA een onoplosbaar aggregaat vormen en zullen de supercoiled plasmiden in oplossing blijven. Dit kan worden gevolgd door fenolextractie om eiwitten en andere moleculen te verwijderen. Vervolgens kan het DNA worden onderworpen aan ethanolprecipitatie om het monster te concentreren.


Methodologische innovaties

Rouillard et al. gebruikte voltooide en onvoltooide menselijke genoomsequenties van GenBank voor analyse, met onvoltooide sequentie opgesplitst in fragmenten om onjuist samengevoegde sequenties te voorkomen. Op basis van deze volgorde-informatie zijn de maten van de NietL-Nietik of ik NietL-EcoRV-genoomfragmenten werden berekend. Fragmenten gegenereerd in de in silico NietI-digesten werden verder geanalyseerd om de grootte van de fragmenten te berekenen die werden gegenereerd door de daaropvolgende Hinfoik of ik DpnII verteert. Overlappende klonen werden vervolgens verwijderd, wat resulteerde in 4.840 fragmenten voor HinfoI en 5.210 fragmenten voor DpnII. Deze fragmenten vormen de basis van de VGS-database.


1 antwoord 1

Dit is niet zo moeilijk, als het eerst lijkt. Laten we eerst eens kijken naar de enkelvoudige enzymdigesten: De digest met enzym A en B leidt alleen tot producten die 5 kB (5000 bp) van elkaar verwijderd zijn. Omdat ze dezelfde grootte hebben, verschijnen beide restrictiefragmenten van gelijke grootte als één band. Dus elk enzym snijdt het plasmide precies doormidden.

De dubbele digest is een beetje lastiger, maar niet veel. Je krijgt er twee producten van, met 2kb en 3kB. Dit betekent dat enzym B tussen de restrictieplaatsen voor enzym A knipt, wat resulteert in deze twee fragmenten. Kijk eens naar de schets die ik hieronder heb gemaakt (slechts een snelle en niet op schaal):

A1 en A2 zijn de snijplaatsen voor enzym A, B1 en B2 en de plaatsen voor enzym B. De getallen aan de buitenkant zijn de posities op de DNA-sequentie. Je kunt zien dat een enkele digest leidt tot twee fragmenten van 5 kB (maakt niet uit welke) en dat zowel A- als beide B-sites zich op 5 kB van elkaar bevinden.

A1 staat op positie 100, A2 moet op positie 5100, B1 zit 2kB achter A1 (en dus op positie 2100), en B2 2kB achter positie A2 (en dus op positie 7100). Om hetzelfde restrictiepatroon te krijgen is het ook mogelijk dat B1 en B2 3kB achter hun respectievelijke enzym A positie liggen (dus op 3100 en 8100) en je nog steeds hetzelfde patroon van 2kB en 3kB op de gel krijgt.


JUISTE ANTWOORDEN

Het belangrijkste feit waarmee rekening moet worden gehouden om deze test op te lossen, is de reactie die wordt gekatalyseerd door polynucleotidekinase: dit enzym brengt het terminale fosfaat van ATP over naar het 5'-uiteinde van polynucleotideketens (MCQ 1: een). Deze activiteit houdt in dat polynucleotidekinase circulaire DNA-moleculen niet fosforyleert. Het DNA-molecuul van 1000 bp is dus lineair en dubbelstrengs (anders zou het niet worden gesplitst door restrictie-enzymen) en - aangezien DNA-strengen antiparallel zijn - wordt het aan beide uiteinden gelabeld na de polynucleotidekinasereactie.

EcoRI heeft een enkele splitsingsplaats in het DNA-fragment van 1000 bp (het genereert twee gelabelde fragmenten van 900 bp en 100 bp grootte MCQ 2: een). Het fragment van 100 bp heeft een 3'-uiteinde G en een 5'-uiteinde A gegenereerd door de EcoRI-splitsing (MCQ 3: een), maar de nucleotiden aan het andere uiteinde van het fragment zijn niet bekend (MCQ 4: C). Evenzo hebben we geen informatie of dit fragment een HindIII-site heeft of niet (MCQ 5: C).

De mappingstrategie in deze techniek is gebaseerd op het gebruik van een DNA-molecuul (het 900-bp-fragment) dat slechts aan één uiteinde is gelabeld (MCQ 10: een). Gedeeltelijke HindIII-digestie (monster 4 in Fig. 1) genereerde DNA-fragmenten waarvan de grootte de afstand van HindIII-plaatsen vanaf het gelabelde uiteinde van het fragment bepaalt (MCQ 12: C). Na 120 minuten incubatie verdwijnen de banden boven het fragment van 200 bp, wat aangeeft dat de splitsingsreactie is voltooid (MCQ 7: B). Het maakt niet uit hoeveel knipplaatsen een restrictie-endonuclease heeft in een DNA-fragment dat aan beide uiteinden is gelabeld, het zal slechts twee gelabelde fragmenten genereren bij volledige digestie (MCQ 6: een). Het fragment van 400 bp heeft aan het ene uiteinde een gelabeld fosfaat en aan het andere uiteinde een HindIII-overhang van vier nucleotiden (MCQ 11: B). Exonuclease-activiteit in het HindIII-enzymmonster zou hebben geleid tot uitgesmeerde banden (MCQ 8: een en MCQ 9: B).


EXPERIMENTELE PROCEDURES

Chemicaliën, enzymen en andere reagentia

Standaard laboratoriumchemicaliën werden verkregen van Fisher Scientific. Plasmide-DNA (pBR322) en restrictie-enzymen met BSA en 10x-buffers werden gekocht bij New England Biolabs (Beverly, MA), agarose werd gekocht bij Seakem LE en DNA-groottemerker (HI-LO) bij Minnesota Molecular. Het recept voor de beladingskleurstof is 0,25 g broomfenolblauw, 0,25 g xyleencyaan, 40 g sucrose gebracht tot 100 ml met gedestilleerd water. Ethidiumbromidekleuring was 5 g/ml. Gelloopbuffer was 1x TBE1 [11]. Plasmide-DNA-voorbereiding door studenten zou deze laboratoriumoefening kunnen voorafgaan als de tijd het toelaat, maar sommige preparaten zullen ongetwijfeld te verontreinigd zijn om zuivere restrictiedigestresultaten te geven.

Alle reagentia worden aan studenten verstrekt als één set per vriesdoos (tabel I). Restrictie-enzymen kunnen worden verdund tot de aangegeven concentraties in de door de fabrikant aanbevolen buffers om de kosten te verlagen. Studenten worden geïnstrueerd om oordeelkundig te zijn in het gebruik van reagentia, maar indien nodig worden aanvullende reagentia verstrekt. Door studenten in het begin kleinere volumes te geven, wordt het onvermijdelijke morsen of kruisbesmetting van dure reagentia geminimaliseerd.

Reagens Concentratie Oorspronkelijk verstrekt volume
Plasmide 300 g/ml 30 μL, de meeste hebben aan het einde 60 μL nodig
Beperking Enyzme Buffers 10× (zoals verstrekt door N.E.B.) 50 L
BSA 10× 20 L
Marker, HiLo 117 g/ml 170 μL
Enyzmen (als set van 4)
EcoRI 13.333 eenheden/ml 20 L
Rsa I, Hinc II 6.666 eenheden/ml 20 L
Ava I, Bam HI 20 L
Sph 1, BsrB I 10.000 eenheden/ml 20 L
NaCl 1 M 1 ml
Tris-HCl 1 M 1 ml

Hardware en veiligheid

Horizontale gelelektroforesekamers, UV-transilluminator en fotodocumentatiesysteem waren van Fotodyne. Voedingen (EC105) waren van EC Apparatus Corporation.

Het belangrijkste veiligheidsprobleem bij deze oefening is het gebruik van ethidiumbromide (EtBr), een mutageen dat moet worden behandeld met handschoenen aan. Materialen verontreinigd met EtBr, bijv. handschoenen, gels, pipettips, worden afgevoerd als gevaarlijk afval. Om blootstelling aan EtBr tot een minimum te beperken, is alleen de verdunde kleuroplossing beschikbaar voor studenten, is er een speciaal gedeelte van het laboratorium voor gelkleuring en krijgen studenten de instructie om alle met EtBr besmette materialen alleen in dit gebied achter te laten. Latex en non-latex handschoenen van alle maten zijn aanwezig. EtBr wordt tijdens de bereiding niet rechtstreeks aan agarosegels toegevoegd, waardoor contaminatie van de magnetron, gelboxen en loopbuffer wordt geëlimineerd.

Het roosteren

Het is belangrijk op te merken dat deze oefening het beste aan het begin van de cursus kan worden toegewezen. Pedagogisch gezien zijn de vaardigheden die hier worden ontwikkeld basaal en latere laboratoria kunnen voortbouwen op de vaardigheden van studenten om reacties op de juiste manier op te zetten en om agarosegels efficiënt te laten werken. Bovendien krijgen studenten een goed 'labgevoel' door meteen zelfstandig te werken. Een tweede, meer praktische reden is dat studenten meer tijd hebben om het project bij te wonen voordat de tussentijdse toetsen en werkstukken in andere klassen worden toegewezen. Aanvraag van het schriftelijk laboverslag in de derde week van de cursus verdeelt de cursusopdrachten netjes. De voorgestelde tijdlijn hieronder is gebaseerd op laboratoriumgroottes van 12-16 studenten. De tijden die nodig zijn voor de hele labsectie om een ​​stap te voltooien, worden gegeven. Sommige leerlingen zijn sneller klaar met opdrachten.

Eerste Lab (3 uur totaal)

45 min: Inleidende opmerkingen over plasmiden, restrictie-enzymen, reactieomstandigheden, gebruik van micropipetters en het belang van buislabeling.

5 min: Oefen met micropipetters met gekleurd water of laadkleurstof.

30 min: Studenten bereiden en incuberen (1 uur) 4 enkele restrictiedigesten.

30 min, terwijl de digesten incuberen: Opmerkingen over het gebruik van agarosegelelektroforese, demonstratie met behulp van zeven en instructies over gelvoorbereiding en laden.

20 min: Studenten bereiden een 1,0% agarosegel voor en laden monsters op de gel.

20 min, terwijl de gels lopen: Opmerkingen over het gebruik van moleculaire groottestandaarden om een ​​standaardcurve-instructies te construeren voor het kleuren en fotograferen van gels.

20 min: Kleuring en fotografie van gels. Analyse om te zien dat alle reacties succesvol waren. Studenten bewaren hun monsters bij –20°C voor later gebruik.

Tweede Lab (3 uur)

30 min: Inleidende opmerkingen over het concept van restrictiemapping en zijn toepassingen (RFLP's). Instructies voor het opzetten van dubbele restrictiedigesten, suggesties voor het bereiden van grotere hoeveelheden restrictiedigesten die lage zoutbuffers gebruiken en suggesties om de resultaten van vorige week te gebruiken als basis voor de eerste ronde van dubbele digesties.

30–45 min: Studenten plannen hun aanpak, stellen restrictiedigesten op en gieten een gel.

45 min: Student-geleide bespreking van een gerelateerd stuk primaire literatuur.

45-60 min: Studenten laden, rennen en kleuren een agarosegel.

Zelfstandig werk (1 extra week in eigen tijd – 3-10 uur)

Er is een spreiding in de hoeveelheid tijd die studenten besteden aan het voltooien van dit project, afhankelijk van hoe goed ze vooruit denken, hoe goed ze hun gels plannen (hebben ze eraan gedacht om enkelvoudige digesten op dezelfde gel te hebben als dubbele digesties voor directe vergelijking?), en hoe goed ze buizen labelen voor later gebruik. De instructeur zal een aantal studenten moeten ontmoeten om hen te helpen begrijpen hoe de buffercondities voor dubbele verteringen kunnen worden gewijzigd en later om sommige studenten te helpen bij het interpreteren van gels. Dit is alle tijd goed besteed.

Week 3

De instructeur heeft waarschijnlijk 10 minuten nodig tijdens een lezing een paar dagen voordat het schriftelijke rapport moet worden beoordeeld hoe de gegevens over de grootte van DNA-fragmenten kunnen worden gebruikt om een ​​restrictiekaart te maken. Hoewel dit in het pre-labcollege in week 2 aan de orde kwam, moeten studenten het nu opnieuw horen nu ze gegevens hebben - de uitleg zal de eerste keer voor veel studenten te abstract zijn geweest.

Schriftelijke instructies aan studenten

Restriction mapping van plasmide-DNA – U heeft 10 μg plasmide-DNA gekregen. Breng met behulp van de onderstaande informatie de restrictieplaatsen van vier verschillende enzymen in kaart: W, X, Y en Z. Het plasmide-DNA is circulair en bevat ongeveer 4.350 basenparen. De enkele EcoRI/BamHI-plaats kan op basenpaar nul worden geplaatst. Alle andere restrictieplaatsen moeten in kaart worden gebracht ten opzichte van de EcoRI/BamHI-plaats.

Het in kaart brengen zal worden bewerkstelligd door enkele en dubbele restrictiedigesten van het plasmide uit te voeren, gevolgd door scheiding van de DNA-fragmenten met behulp van agarosegelelektroforese. Be sure to run appropriate controls on each gel, including single digests to compare with double digests or doubles to be compared with each other. The more digests you have on each gel, the more information you will obtain by comparing fragment sizes directly. A standard curve of fragment sizes will be obtained by running marker DNA on each gel. Each gel will generate a standard curve for use with that gel only. Very small fragments may not be visible and their presence might need to be inferred.

2 μL 10× restriction buffer

Some enzymes require BSA for proper function. You have a 10× stock solution of BSA when adding BSA, reduce the volume of water added accordingly. Be sure to add the restriction buffer that is appropriate for the enzyme being used. An attached page details the buffer conditions required of each enzyme. Stock solutions of 1 M NaCl and 1 M Tris HCl are provided—dilute them to the appropriate final concentration in your double digests when you need to change buffer conditions. For example, after a 1-h incubation of a 20 μL Apa L1 digest, remove 4 μL to run on the gel. Divide the rest into two tubes. In one tube, add 1 M NaCl to bring the NaCl concentration to 100 m M then add 1 μL of Bgl I. Bring NaCl concentration of the other tube to 50 m M NaCl and add Eco RI. Incubate both for another hour. An easy way to figure out the volume of stock solution needed (e.G. 1 M NaCl, in this case) is:

Final Volume desired × Final Concentration desired = Stock Concentration × Stock volume to use

Solve this equation for whichever variable you don't know, in this case, volume of stock to use. Remember that NaCl is already in some of the buffers to begin with—so in going from Eco RI to Bgl I, for example, you only need to add to a final concentration of 50 m M , since you start at 50 m M and end at 100 m M . Please ask for help if you need it!

Restriction digests should be done in 0.5 mL eppendorf tubes. Add the enzyme last—keeping the tube of enzyme out of the freezer for as brief a time as possible. Digests are done at 37C for 1 hour. Finished reactions may be put into the freezer. Label the tubes—you can re-run digests on later gels thus saving your time and reagents. Return enzymes to the freezer immediately.

Following the 1-h incubation, remove 4 μL to a fresh tube and add 1 μL of loading dye. This mixture can be loaded onto a gel. Alternatively (to save tubes) you can put the dye and digest together on a piece of parafilm if you are ready to load the gel immediately. By NOT adding dye to your reaction tube, you can later add a second or third enzyme to the reaction rather than having to re-do the reaction.

OPMERKINGEN

Always wear gloves when handling DNA and enzymes. Turn them inside out to dry out to reuse. Discard holey gloves in EtBr waste.

Altijd use a clean sterile pipette tip to pipette DNA, enzymes, and buffers.

Keep enzymes in the freezer or for minimal time on ice. Keep DNA on ice or at 4C (refrigerator) buffers should be at −20°C (freezer) when not in use.

You are responsible for keeping the lab clean. All gel boxes moeten be emptied and rinsed after each use. Turn them upside down on towels to dry. If left with buffer in them, the water will evaporate leaving salts encrusted on the electrodes.

Allow agarose to cool a bit before pouring the gel. Very hot agarose will create stress fractures in the gel beds.

Agarose Gel Electrophoresis

Prepare an agarose gel in 40 mL of 1× TBE (dilute the 10× TBE appropriately). You should microwave the agarose/buffer mixture until you no longer see bits of agarose floating in the mixture. Use medium power and do not allow the agarose to boil over. Allow agarose to cool so you can easily touch the flask. Gels should be allowed to set for about 15 min before use.

Use 1× TBE as running buffer just covering the top of the gel. Load the gel through the buffer. Connect the leads, recalling that DNA is negatively charged and will migrate to the positive pole. Set the power supply to 100 mamps constant current for 1 h. Stain the gel in a large weigh boat with 1 μg/mL ethidium bromide Wear GlovesCarcinogen for 10 minutes. View gel on the UV box—take a picture indien it is a useful gel.

marker uncut Bam HI Bam/Hinc II Hinc II Hinc II/Bsr Bsr BI

Hints: You do not need to do all possible combinations of digests. You can save digests to re-run on later gels for division into two additional digests. Keep them in your freezer box and mark things well.

Additional Materials

In addition to the earlier-mentioned laboratory instructions, students are given the manufacturer's instructions for each restriction enzyme and the overview on restriction endonucleases and their reactions from their catalog [NEB]. They are also given instructions on completing the required written report.


Restriction Mapping and Gel Electrophoresis

Download de video van iTunes U of het internetarchief.

Goedemorgen. Goedemorgen.

I don't know about you, but I can't take too many more nights like this.

I confess, I haven't gotten a thing done for so many nights in a row now, but what a game! How many of you saw the game? Excellent.

Very good, very good. You have your priorities straight in the world. Heel goed. Well, if it's possible to get your minds off Curt Schilling last night, and off more importantly tonight.

Perhaps we can spend a bit of time this morning in the meanwhile with whatever spare neurons you have talking about recombinant DNA for a bit, OK? What we talked about last time was different ways to clone your gene based on its properties. We started off with cloning by complementation, right, the idea that if you took a library of clones, you would be able to put it into bacteria and select a bacterium whose phenotype had been restored by virtue of having the plasmid. You would complement the defect.

You'd find the clone you wanted because it complemented the defect.

That's great if you can put it into an organism that has a defect.

You can do it with bacteria. You can do that with yeast.

It's harder to do with large organisms because you can't inject enough of them with different clones to be able to make that practical unless you're working in cell culture or some very small, fast growing organism. We talked about being able to use a protein sequence, reverse translating that protein sequence in the computer from amino acid sequence to nucleotide sequence, and using the nucleotide sequence to design a probe to hybridize back to the genome. That works fine if you have a protein sequence.

But the last topic we talked about that I wanted to just touch on again this morning was suppose you were trying to clone the gene that causes a certain human disease, and you have no idea what the protein was. Then, you can't use its amino acid sequence because you don't have the protein. What can you possibly do when all you know is that you have a gene which causes a genetic defect that causes a disease? And I said you could clone it using the ideas of genetic mapping, position, the things that Sturtevant developed. And, I touched on it briefly, and I want to just touch on it a bit more because some people had some questions about it. And I've set up a very simple example to show you. Suppose that, to make it easy, we're working in a fruit fly first. We're working drosophila, and suppose that the true picture of the underlying chromosome is like this.

There's a locus that could either have a mutant allele M or the wild type allele plus. There's a bunch of other loci along the chromosome. And, let's suppose we know all of where they are and all that. And, they have two alternative alleles. At this locus the alleles are orange or pink. At this locus I'll call the alleles orange or pink.

Now, these are different loci. These are different alleles. I've just called them orange and pink in both cases so I don't have a rainbow of colors up here to confuse us. But all I mean is there's two possible alleles here, two alleles here, two alleles here.

This is the diseased gene we're interested in, and these are passive markers. These are other markers along the chromosome. If we were to set up a cross between heterozygotes, a heterozygote here, and a heterozygote here, and it were the case that on the chromosome bearing the mutant allele, it happened that at these three markers we had orange alleles. I don't know what they are, but whatever these orange alleles are, they might be a visible phenotype, forked or yellow or bristled. They could be a DNA sequence difference. They could be whatever you want, but let's suppose the M chromosome has a set of alleles that are different in each location than the plus chromosome. Then, when we look at the offspring that come out of this cross, let's only, for the sake of simplicity, look at those offspring who are homozygous mutants.

Well, in general, if there's been no crossover here, then the M chromosome will have orange, orange, orange, orange, orange, orange. If there's been a crossover, however, it could go orange, orange, pink on one of those chromosomes. Or if there's been crossovers like this, it could go orange, orange, pink on one chromosome, and orange, pink, pink on the other chromosome. It could even, in the extreme, have had crossovers very close to the gene maybe here, and even maybe here. And you've got orange, pink, pink, and pink, pink, pink.

But if we look at the many segregates, you know from genetic mapping that the closer the locus is to the disease gene, the more strongly correlated the inheritance will be, the tighter the linkage will be. This is nothing more than linkage mapping. But now, suppose we were doing linkage mapping, but for the sake of argument the whole genome had already been sequenced. Suppose the genome had been sequenced in a cross, and the whole genome of the fruit fly had been sequenced which it has been sequenced.

And, we looked at a cross and we looked at the mutants.

And what we did was we tried different positions along the genome.

And at each position, we had some genetic marker.

And that genetic marker might be as simple as the fact that at that position, maybe there is an A in the DNA sequence on one of the chromosomes, and maybe I don't know a G in the other sequence.

And over here, this marker might be, there's a T in some particular position, and there's a C in some particular position.

If we could assay that, if we could tell, we could look whether this spelling variation is closely correlated with the mutant.

And this spelling variation is closely correlated with the inheritance of the mutant allele. And we could just try up and down the genome, different sites of spelling difference as if they were genetic markers in our cross because they are genetic markers in our cross, and see which one is most tightly correlated.

The minute we get any genetic sequence difference, that shows co-inheritance linkage in this cross, we know that this spot in the genome must be nearby our mutation.

So, we'll try one closer, and we'll try one on the other side.

And, what you do is you test sites of genetic variation, first to find one that shows any co-inheritance.

And once you've got that, you try ones closer, and closer, and closer. Last time I talked about the process of, if you had one of those markers you could use it to isolate the next clone and the next clone and the next clone. But you know what I realized? That's so old fashioned. We might as well deal with the fact we have a sequence of the genome. No more would you ever isolate the next clone and the next clone and the next clone.

You just look it up in the computer. So, even if you have the whole sequence of the genome, we have to figure out what part of it was co-inherited along with this disease, and that's the way you do it, OK? Genetic mapping, ust as Sturtevant invented it, can be applied if you have a whole sequence of the genome, and enough sites of variation. And, I've drawn it for a fruit fly cross, but this could equally well be cystic fibrosis.

The only difference is if we're doing this in human families and it's cystic fibrosis we don't have as many offspring.

So, we have to pool data from many families. And, we can't arrange it so that every family has exactly the same orange alleles up here and pink alleles down there, but computers can deal with that. They can still figure out the correlation across many families, and you find the spot in the genome where for many, many, many families the kids who all got the disease show correlated inheritance with this marker. And that eventually pins you down to a region of the genome. It pins you down to those genetic markers that show the absolute tightest correlation, tight correlation, and that's where you look.

And in that fashion, people went being able to map the location of Huntington's Disease in 1984 to, by now, mapping the locations of more than 1, 00 different human genetic diseases where people didn't know the protein in advance. They did it entirely based on this positional mapping. So, Sturtevant's idea, which I like so much, has played itself out so beautifully now in the area of modern molecular medicine. OKE. Dus verder.

I want to talk about a few other variations on the theme rather quickly, and then I think I want to talk about how you analyze your clones. First, variations on cloning, I should just at least mention it. We talked about cloning in an autonomously replicating plasmid in a bacteria.

So, you go to a bacteria. They have some autonomously replicated pieces of DNA. There are circles. You can clone in them, and you can typically, these things are on the order of, I don't know, 1,000 to 2,000 to 5, 00 bases can be readily cloned in these plasmids. You can do more, but that's a typical kind of number is the insert size, typically. But we in the lab go up to much higher numbers like 10,000 sometimes. You can also, if you wanted to study yeast, it turns out yeast happily have plasmids as well, and you can do a similar sort of thing for yeast.

It turns out that instead of using plasmids, you can use bacterial viruses. These bacterial viruses have all different shapes as we've talked about, circular or linear, and they can typically hold, oh, 15, 00-40,000. Some of these viruses are quite big.

The bacteriophage lambda tends to carry a lot of stuff.

And, it can replicate. So, you could do the same thing to that. You can even use viruses that infect mammalian cells and there are all sorts of viruses now that people clone in again, linear or circular. I don't know, for mammalian cells, you often, the viruses like 1,000-5, 00. You can even make artificial whole chromosomes now. You can do this in yeast.

Artificial chromosomes are called YACs. They have all the little machinery, little telomeres on them, little centromeres. They have a selectable marker, and then you can clone into it your piece of DNA. And these can take up to a million bases of DNA.

So, if you wanted, there are bacterial artificial chromosomes.

They're called BACs if they're in bacteria. And recently, people have developed artificial chromosome systems for mammalian cells, and specifically human cells. And they're called unfortunately MACs and HACs and things like that. Basically, any molecule that can replicate in any system, some smart molecular biologist will come along and say, how do I use that for my purpose, to stick my DNA in it, and get it to replicate in this organism?

And so, if something's not on this list, it will be soon, OK? Now, here's another thing. This is cloning chunks of DNA.

Just to have the piece of DNA in a library, but suppose we want to do more than just have the DNA sitting there in the bacterium, suppose what I'd really like to do is take a bacterium, E coli, and put it to work for us. Maybe what I'd like to do is take a plasmid and insert in that plasmid the gene for human insulin.

So, I'm going to take the DNA locus corresponding to human insulin, clone it into my plasmid. Maybe I'll have isolated it from my library because, let's see, insulin's protein sequence is known so I could reverse translate it to a nucleotide sequence. So, I could probe a library.

So, I could find the clone that has insulin. Now what I'd like to do is persuade this bacteria not just to carry the DNA but to make insulin for me. Would that be useful? Yeah, how did people used to get insulin? Cadavers, dead bodies it would be much easier to get them from a fermenter, right, to get insulin from a fermenter, if you could just ask E coli to make it.

So, if we put it into E coli, will it make insulin for us?

Here's the human locus, DNA for insulin. Will it make insulin? Let's see, how do you make a protein?

You've got to start by making RNA, right? You've got to transcribe the gene. Will E coli transcribe this gene?

Well, why? It's got a promoter, right? It's got the insulin promoter. Daar gaan we. The insulin promoter is here.

So, E coli will come along to the insulin promoter and start making RNA? No, it turns out that promoters in humans and promoters in bacteria are sufficiently different. They don't work across species.

They won't recognize the human promoter. Too bad. Om het even welke ideeën?

Yep? Stick a bacterial promoter there. Good, you're acting like a good molecular biology designer here. Let's put a bacterial promoter here.

It will recognize its own promoter. Dat is geweldig. Then, let's put the DNA for the human insulin gene here. And now, maybe we'll put the Lac operon, and when it has lactose it'll start making RNA from the human insulin gene. And it'll start translating it.

And, we get insulin. Any problems? Well, will it make any, for starters? What's another aspect of mammalian genes that's different from bacterial genes?

Processing, what kind of processing with the RNA? And the splicing, ooh, the insulin gene has introns that have to be spliced out.

So, this is going to make some RNA, insulin RNA, and it needs to be processed like this. Will bacteria carry on our splicing for us? They don't do splicing. Yep? Well, that's a very interesting question because we haven't. But, what do you propose? You see, I've just taken a piece of human DNA from the human genome, which encodes the introns and the exons. But, you seem to have a solution to our problem, and what would that be? So, instead of making a library of genomic DNA, what you're suggesting is a radical idea.

Let's instead take human RNA. Here's some human RNA, lots of human RNA, a big collection of human RNA. What was at the end of the human RNA: a poly(A) tail. And what I understand you to be suggesting is if we take human mRNAs, a whole collection of them, you want me to turn these mRNAs back into DNA and clone them instead of using the chromosomal DNA. How do I turn an RNA back to DNA?

Is that possible? What do you use: reverse transcriptase.

We have to give it a primer. So remember, five prime to three prime, we'd like to put a primer going over here.

Any ideas for a good primer? Poly(T), isn't that convenient?

One of the reasons that mammalian messages have poly(A) tails is so that we are able to reverse transcribe them using poly(T) primers. No, that's actually not true. So, we use reverse transcriptase. And what we can do is we'll copy this RNA into a strand of DNA. Daar gaan we.

Then what we'll do, next step, is we'll take the DNA, and we'll copy back into a second strand of DNA.

And now, we have double-stranded DNA whose sequence matches the already-processed mRNAs. Sorry? So, the sequences would match the mRNAs. So what you could do is instead of taking human DNA from the nucleus, you could take RNAs, turn them back into DNA by reverse transcriptase, and make a library now that consists of zillions of inserts, each of which has what's called a cDNA, a copied DNA, copied back from the RNA. The great advantage of this is that the human cell has already done the splicing, and so there are no introns left. Now, when you stick it in a bacterium, the bacterium is able to express this. It's able, if you give it its own bacterial promoter, to make an RNA.

And if you don't ask the bacteria to have to splice, if you just give it a pre-spliced piece of DNA that doesn't need splicing, it can translate that DNA. Now, notice we used all of our tricks. You had to know about reverse transcriptase, poly(A) tails, structures of genes, introns, exons, yes, question?

Dat doet het niet. You do this in the test tube. You purify human mRNA in the test tube. You take that mRNA in a test tube, add reverse transcriptase, add poly(T), make this reaction of RNA to DNA in the test tube go back.

Where does it come from? Viruses that copy themselves back for a living, right? So, again, every single thing we're using comes from some living organism that does this kind of stuff. And, when I teach you about the facts of how viruses replicate or what the structure of mRNAs look like or whatever, it's because every bit of knowledge we get about the way biology works turns into an incredibly powerful tool as it's turning out for us to actually be able to further study biology. So, great. So, where does reverse transcriptase come from now? Originally they come from viruses that turn themselves back from RNA to DNA. Now, how do you get reverse transcriptase? Catalog, right, very good. All right, so this is called, finally, a cDNA library. And, if you had made a cDNA library, you would be able to screen the cDNA library to find the gene for insulin.

Is this useful? This happens to be, for example, one of the consequences of this was the biotechnology industry. OK, so if you have any doubts about the usefulness of understanding these abstract things about E coli and bacteria and stuff like that, one of the consequences was Genentech, Biogen, and Amgen, and if you just simply walk around Kendall Square, within a mile of this place you will see laid out before you the consequences of this ability, OK? It's transforming Cambridge. Ja?

And the world. Ja. Inderdaad.

It might be that producing large amounts of insulin was bad for the bacteria because there would be so much protein it would clump and kill the bacteria. It might be that insulin, for various reasons, might not fold appropriately in the bacterial environment.

And, this is why the biotechnology industry has lots of smart people working in it because you're totally, 100% right. You might decide that instead of cloning it in bacteria it's better to clone it in some insect cell in culture which, in fact, people like to work with, or some other cell, or a mammalian cell. And so, I simplify by saying put it in coli, but in fact that might test six different cell lines, six different host possibilities.

They might have to take the insulin out and refold it in vitro and things like that. You're totally right.

This is actually something that requires work to do it right, just like building an airplane requires work.

I could tell you Bernoulli's principles, but then Boeing does more than just writes down Bernoulli's principles.

OK, so onward. Now, I'd like to turn next to analyzing your clone.

Analyzing the clone, so suppose we have, maybe it's by positional cloning, maybe it's by cDNA cloning, but one way or the other we've got us a clone that we're very interested in.

Maybe it has the insulin gene. Maybe it has the Huntington's disease gene. Whatever it is, we're going to want to study it.

And at the moment, I haven't told you how I would even read its DNA sequence or analyze its DNA. So, the first step is, of course, I have to purify the plasmid. And, it turns out that that can be done.

There are simple biochemical techniques, as I mentioned in a previous lecture, that allow you to grow up a lot of the bacteria, crack them open, and the plasmid being a little circle, and being a little more tightly super-coiled and wound up has somewhat different physical properties. And you can use those to purify the plasmid. So, plasmid preps are not hard to do. You can get a fairly pure collection of the plasmid.

Now, suppose I've done this for, oh, I don't know, let's take my first example, orange mutants. Suppose I tried to rescue bacteria that were orange minus, and suppose I found that 50 different plasmids rescued my orange mutant because I transformed a lot of plasmids in, I plated it, and 50 colonies grew up.

Are they all the same thing or are they different?

Is there any quickie way to take a look at these 50 plasmids and see if they're identical or fairly close, or obviously different? Well, I'd like to take some way to take the DNA from the plasmid and analyze it kind of easily. I might want to see, like, how big is the insert? Right, that'd be one way, if they had different sized inserts so they couldn't be the same thing.

So, maybe what I could do is how do I clone this? I used EcoRI sites I recall. So, I have EcoRI sites here. Suppose I were to take this DNA, and I were to now cut the DNA from the plasmid with EcoRI.

Then, what I would get is two separate molecules.

I would get the vector and the insert. How could I see how big they were? Gels, gel electrophoresis is the way to do that. So, I take a gel. A gel is a slab of gelatin, Jell-O, OK, and normally it's laid flat, but I'm going to do it vertically here. I load into the top of it here a little bit of my DNA, this whole mixture. I take the plasmid. I cut it. I put it in here. DNA's positive charge or negative charge? Negative. So, where should I put the positive pull? On the bottom, well done.

That's often not done, and to the detriment of the experiment.

If you put the positive pull here, it goes the wrong way, and everybody has to do that at least once. So, what'll happen is the DNA fragments move through, and the smaller fragments move faster than the big fragments, right? If something's little, it'll move fast. If something's big, it moves slowly: little, big.

Smaller moves faster because it wiggles through the little pores in the gel better. So, suppose I were to do this for a bunch of plasmids, and what I saw was this.

First order, what do you guess? Sorry? Top road's probably the plasmid vector. This is probably the vector, and what do I know about the inserts? At least two inserts, at least two distinct inserts. Now, if I wanted to be sure that was the vector, maybe what I could do is take another row, and run a known amount of the vector, take the vector alone and I could check that the vector alone runs over here. And maybe I might take some other known molecules. These would be called molecular weight standards. So, if I run some knowns in one of the lanes of the gel, I can even measure and say, ah-ha, the insert is somewhere between the size of this one and the size of that one. And so, I get a little ruler that I can put on the gel. So, in fact, that's the first thing you would do is you digest your clone that way.

Now, does the fact that these guys have exactly the same, apparently, size on the gel mean that they're the exact same piece of DNA? No, because you can't even actually tell it's exactly the same.

There's a limit to how precisely you can measure it.

So, what else could you do? You could try another restriction enzyme. It turns out that since there are so many restriction enzymes in the catalog, if I take a piece of DNA, maybe that Eco fragment, I could try cutting it with HinDIII.

And when I cut it with HinDIII, I'm going to get three distinct lengths. I could try cutting it with, oh, I don't know, pick another enzyme, BamHI. When I cut it with BamHI, I'll get some other lengths. And, how to get these lengths by adding these, by running them out on a gel and looking at their sizes.

What if I added both HinDIII and BamHI to my test tube?

I'd cut at both sites. So, I'd cut here, here, here, here, here. So, this is cut with HinDIII, here cut with BamHI, here cut with both and I could measure these lengths. So, suppose I gave you this as a computer problem, I have a string and it's an unknown string, and I cut it at two places and I get these lengths, X1, X2, X3. And then I take that same string and I cut it at other positions, Y1, Y2, and Y3 are the lengths that result. And then suppose I now cut it at both of the sites, and I measure it, and I get Z1, Z2, Z3, Z4, Z5. If I gave you all those numbers, could you figure out where the sites must be? Waarschijnlijk. It turns out to be a reasonably doable computer problem, although it can get a little hard in places. And you could try a third enzyme and a fourth enzyme, and it's a cute exercise to write yourself a little piece of code that will figure out where the sites are based on the lengths. The reason it occasionally gets funny what if Z3 and Z4 are exactly the same length and they run on top of each other in the gel, and there are special cases.

But you can kind of reconstruct where those restriction sites must be just by writing a good piece of code that'll put these pieces together. This is called restriction mapping, and it's great fun. Everybody likes to do this once.

But, it's only a limited amount of information, right, because you get where the sites are, and I guess if I gave you ten clones and they all had exactly the same restriction maps, the exact same positions of these restriction sites, you'd feel pretty confident they were the same clone.

But you still wouldn't really know much about the clone other than it had two HinDIII sites and two BamHI sites, and here's where they were.

What do you really want to know about this clone? It's DNA sequence, right? Let's not settle for anything less than the exact nucleotide sequence of the clone. So, that's really the last key topic is sequencing DNA.

How are you going to sequence DNA? Well, suppose I give you some double strand of DNA, five prime to three prime, five prime, three prime, double stranded DNA.

Let me heat it up. What happens when I heat up DNA?

It melts the hydrogen bonds, the non-covalent hydrogen bonds here break, and I got my two strands separated. Now, what I'd like to do is I want to start reading out this DNA sequence.

So, I'm going to make me a primer. Now, golly, here's a primer.

You're going to ask me, how did I even know what primer to use if I don't know the DNA sequence? How can I make a primer?

Hold that question. Make sure I remember to come back and answer that, OK? But for the moment, grant me that I have a primer here.

What I'd like to do is add DNA polymerase. So, let's add some DNA polymerase. And, I'd like to add nucleotide triphosphates, dNTPs, the dATP, dCTP, the dGTP, dTTP, and if I add DNA polymerase and I add my nucleotides, what does Arthur Kornberg tell us will happen? It'll start polymerizing, right? And, it'll stop there. So, the polymerase knows the bases, right? It knows what base to put in because polymerase is very smart.

So, the bases get put in correctly. The only problem is, how do we get polymerase to tell us what it just did?

Here's a cute trick. This is, by the way, a cute trick that won the Nobel Prize. So, suppose my primer is like this: five prime, T, A, A, T, T, C, T, and the template strand here, A, T, T, A, A, G, A, now let's keep going, A, T, G, C, C, A, A, T, G, G, A, T, T, A, five prime. So, there's my primer.

There's my template. I'm going to start adding. Well, let's add our polymerase. Let's add our dNTPs, polymerase, dATP, dCTP, dTTP, dGTP, and then I want to add a special extra good old ingredient into this.

The special extra ingredient I want to add is a defective T, a defective dTTP. What do I mean by defective? I mean chemically modified in such a way that it can't be extended, that you can't extend past it. So now, let's follow my reaction.

I'm going to start with, I'm just going to write them down here, T, A, A, T, T, C, T. What's the next base I'm going to put in?

T, OK? Is that a defective T or a good T? Ik weet het niet.

It could be. Maybe it's a defective T, which I'll put a little star there, OK? If so, what happens to my polymerase?

Het stopt. It can't go any further. It can't go any further because the T's defective. But what if it wasn't a defective T?

What if it was a good T? Then what goes on? The polymerase will put in, keep going guys. A, C, G, G, and what does it put in now? T, right? Now, is that a defective T? Kan zijn. Wij weten het niet.

If it is a defective T, it stops there. Otherwise, polymerase goes here, and the next space is what?

T, and is that a defective T? Kan zijn.

And, if it's not a defective T, then polymerase goes on, puts in an A, puts in a G, a C, C, and then a T.

And maybe that's defective. All right, which of these possibilities is what polymerase does when I throw it in?

Well, all of them. There's a lot of molecules there.

Some of the molecules, by chance, happen to install a defective T, and they grind to a halt here. Sometimes, a good T's put in and the molecules stop here. Sometimes they stop here, and if I start with a big collection of primers in a lot of my template DNA, I'm going to get this whole collection of different molecules of different lengths. What lengths do I get?

The lengths correspond precisely to the positions of the Ts.

I get a series of molecules whose lengths perfectly match the positions of Ts. Well, first off, how do I measure their lengths? Run a gel, bingo, run a gel.

So, if I could run a gel that could separate nucleotides based on length that two next to each other, another one up there, I'd see a small molecule, length one, two, three, four, five, three, six, eight, I'd see one of length eight. I'd see one of length, what's the next one, 13, eight, nine, ten, 13, 14, so eight, nine, ten, 11, 12, 13, 14, 15, what's that, 13, 14, 15, 16, 17, 18. OK, those would be the positions at which I would see this T. So, I'd need to have a special kind of gel that's so accurate that it can separate single nucleotides, right, that the lengths, but that can be done.

There's acrylamide, the polymer that will do that.

That'll tell me the exact lengths of the T's. What else do I do?

Well, let's obviously do it from the other bases.

Let's try defective A, defective C, defective G.

Let's see, if I got it right, which we'll try, it ought to end up looking something like that. And if not, you get the picture, that this ought to match up as to which columns have which lengths.

OK, I think I got it right. That tells me the lengths of the molecules. So, I could read off at sequence.

The sequence of that molecule ought to be, starting over there, the sequence of what I've added in, ought to be something like T, A, C, G, G, T, T, A, C, C, T, yep, it worked.

It's exactly right. Bingo. I can now read the sequence.

Fred Sanger, a brilliant scientist, thought up this method of just exploiting E coli's own polymerase or other organism's own polymerases.

So, copying and all the chemistry that had to be done was thinking up a defective nucleotide that could not be extended.

It could obviously be inserted. It can't be extended. So, one question is, what's a defective nucleotide? Well, you will recall that our nucleotide in the sugar phosphate chain is sitting like this. Let's see, hanging off the one prime carbon is the base. This is the one prime carbon, the two prime carbon, the three prime carbon, the four prime carbon, the five prime carbon. What do we know in DNA at the two prime carbon?

Normally in ribose there would be a hydroxyl here, right? But in deoxyribose, there's just a hydrogen.

So, if this is deoxyribose, so a dNTP really means a two prime deoxyribose, where do I now attach my next base in the sugar phosphate train? Three prime ends, and what do I attach it to: the OH.

What do you think would happen if there's no OH there?

You're stuck. All you've got to do is take off that hydroxyl.

No hydroxyl group. If you made nucleotides that don't have that hydroxyl group, they can't be extended.

So, instead of these being just deoxy at the two prime position, they are dideoxy, deoxy at two positions.

They are two prime, three prime, dideoxynucleotides.

Dat is het. Now, if you needed to get two prime three prime dideoxynucleotides, they're in the catalogue of course, right, because Fred Sanger had to make them himself and all that, but you can just buy them now. And so, you can do the sequence.

A few other little details here, though, guys.

How do we see the DNA and the gel? One possibility would be staining it. There are some dies like ethidium bromide, and for doing your restriction mapping, using a dye that sticks to DNA like ethidium bromide does is pretty good. And then you put it under fluorescent light and you look. For sequencing, the amount of DNA is so little that it's hard to see with a dye by the naked eye, which is what you do with restriction map. So, sorry?

So, the first thing people did was radioactive. What they did was they took a primer, made it radioactive, and you did this whole sequencing reaction with radioactive primer.

Then, when you run the gel, you take your gel and you expose it for some number of hours, eight hours maybe, a piece of x-ray film, develop the x-ray film, and you'll see that picture. So, one solution that you could do to visualize is using radioactive nucleotides. So, we got the defective nucleotide.

We now need to visualize our DNA. Let's visualize the sequence.

One possibility: radioactive. The second possibility, someone already mentioned it, a fluorescent dye.

Now, here, a fluorescent dye could be put on, and you can't read it with your eye, but lasers are very good at reading.

So, you might run a whole gel here and have lasers scan it.

But, you can actually do better than that. Suppose I put my fluorescent dye on my dideoxynucleotides.

Suppose I put it on my dideoxynucleotides, and suppose I even had enough chemistry at my disposal that I could put a different color of fluorescent dye on each of my nucleotides. Then, whenever the dideoxy is put in to terminate the chain, it carries with it its own color.

Wouldn't that be cool? And, that's what's done. Not just can you buy dideoxynucleotides now, but you can buy the four different dideoxynucleotides each with its own dye attached to it.

So, there are di-dideoxies I guess, sorry, but it's different di's, right? They're dye-dideoxies. So, you could do that.

And then what you get would be that in this column you get this color.

And in this column, you'd get this color. And in this column you'd get this color, etc. I'm not worrying about where they are here. And they'd all be different colors and it would be very pretty. You know what? Why do we need to run separate lanes anymore? If we got a laser, we can tell the laser scan it to tell it different. Stick it in one way. In fact, what's done is stick it in a capillary tube, throw in all four at the same time now, and as these fragments come by, each has its own color. And all we need is a laser scanner capable of sitting right here. Here's my laser scanner. And the laser scanner, positive here, negative here, as the DNA flows by through this polymer, the laser scanner reads off which colors just went by.

And it goes A color, C color, T color, G color. Dat is het. So, there are actually machines now that have 96 different capillaries.

These are called capillary tubes. And you can have 96 of them with laser scanning across, and in each column now, it turns out that you can read almost 1,000 letters, 1,000 bases per column per capillary times about 100 capillaries.

Or in other words, you can read out about 10^5 bases of information.

You can read out 10^5 bases of information in about two hours.

Of course, you can do that ten times a day. So, you can actually read out 10^6 or about a million bases of information per machine. And here at MIT, we have 100 of these machines. So, we actually can read out a little shy of 100 million letters of DNA sequence per day, which I mean is a lot.

We read about 40 billion letters per year here at MIT, and this is how we do it. How much does a machine cost?

List, or do you want a deal? They list for $300, 00, but if you buy in bulk, I can do better. [LAUGHTER] We buy it in bulk, by the way. So now, how are we going to get our primer there? That was the only little bit we were missing is where did our primer come from? The last little detail: here's my vector, remember, and I want to sequence this insert.

How am I going to get a primer in the insert? I don't know what its sequence is. How do I even start this? Sorry? Well, but that won't tell me what the sequence is that I have to, I mean, I was looking to try to get a primer that matches the insert.

And I don't know what the insert is. So, how am I going to get a primer?

Oh, I know the vector. The vector is well known.

It sequence is in the catalog. Let me instead just use a primer that happens to sit in the vector, and I'll match to a known sequence to start with, and then I'll sequence into my unknown territory. So, this is how you get the initial primer was you arrange that your initial primer is sitting in known vector sequence. All right, so you can now sequence DNA. I've got to say, I've taught this course for a little more than a decade, and being able to say, now we can routinely sequence about a million letters per machine, and 100 million letters per day, and things like this was not routinely the case. When we started teaching this course, I was describing what we di


Bekijk de video: The Most Important Plant to Grow: Propagate Comfrey 4 Ways (December 2021).