Informatie

Primer Dimeer / Haarspeld Algoritmen


Wat zijn de algoritmen / methoden die worden gebruikt voor de berekening van primerdimeren en haarspelden?

Als voorbeeld zal IDT's OligoAnalyzer-tool deze analyse genereren op basis van bepaalde sequenties.

De homo-dimeeranalyse lijkt me gewoon een glijdende scan van twee sequenties over elkaar. Ik neem aan dat dit geen rekening houdt met mogelijke haarspeldproblemen? of zijn dergelijke structuren minder waarschijnlijk in vergelijking met de talloze andere, meer voorkomende problemen. Bovendien, hoe worden de ΔG-waarden berekend bij een bepaald dimerisatiepatroon?


Het is belangrijk om meer gezichten te visualiseren om primer- of oligo- en PCR-experimenten te ontwerpen:

- thermodynamische parameters van DNA-hybridisatie berekenen (Oligo/Template)

  • bereken haarspeld-lus, dimeer, basen straf en smelttemperatuur over primer of paar primer

  • bereken statistieken over smelttemperatuur met de verandering in samenstelling en meng PCR-concentratie

met google zou je meer tools kunnen vinden, maar je moet een tool van een sequencing-team kiezen. bijna alle tools gebruiken het mfold-algoritme, het is eenvoudig en effectief:

M. Zuker, D.H. Mathews & D.H. Turner. Algoritmen en thermodynamica voor RNA-secundaire structuurvoorspelling: een praktische gids in een biochemie en biotechnologie, 11-43, J. Barciszewski en B.F.C. Clark, eds. , NATO ASI Series, Kluwer Academic Publishers, Dordrecht, NL, 1999.

Ik werkte in een sequencing-team en er was een programmeur. hij ontwikkelde een fantastisch gereedschap. hij is een beetje Engels, maar hij zou je kunnen ondersteunen: http://promix.cribi.unipd.it/cgi-bin/promix/melting/melting_main.exe


Biologie:Primerdimeer

EEN primer dimeer (PD) is een potentieel bijproduct in de polymerasekettingreactie (PCR), een veelgebruikte biotechnologische methode. Zoals de naam al aangeeft, bestaat een PD uit twee primermoleculen die aan elkaar zijn gehecht (gehybridiseerd) vanwege reeksen complementaire basen in de primers. Als resultaat amplificeert het DNA-polymerase de PD, wat leidt tot competitie voor PCR-reagentia, waardoor mogelijk de amplificatie wordt geremd van de DNA-sequentie die is gericht op PCR-amplificatie. Bij kwantitatieve PCR kunnen PD's de nauwkeurige kwantificering verstoren.


AutoDimer uitvoeren

1. Bereid een invoerbestand voor met: tenminste twee sequenties volgens het invoerbestandsformaat.

Opmerking: jij moeten gebruik een invoerbestand. Sequenties kunnen niet handmatig worden ingevoerd in het blauwe tekstvak.

2. Open het bestand vanuit het menu "Bestand".

3. Controleer of het juiste aantal sequenties is ingelezen door het vakje "# sequenties" te bekijken.

4. Varieer desgewenst de parameters voor Score, [Na+] of totale DNA-strengconcentratie (Ct).

5.Klik op "Primer Dimer Checker" of "Hairpin Checker", de meter geeft de voortgang aan.

6. Potentiële structuren worden weergegeven in het tekstvak in het onderste gedeelte van het programmascherm.

7. Als u de screeningresultaten wilt opslaan, gaat u naar "Bestand" en "Opslaan als". De informatie kan later worden geopend in Word, Excel, Notebook etc.

8. De resultaten kunnen ook rechtstreeks vanuit het AutoDimer-programma worden afgedrukt.

Terwijl het algoritme wordt uitgevoerd, slaat AutoDimer tijdelijke bestanden op uw "C" (C:)-station op. Het wist deze bestanden wanneer u het programma afsluit. Als u het programma echter op een D, E (niet C)-schijf laadt of als uw "C"-schijf vol is, zult u problemen ondervinden bij het uitvoeren van het programma.

Stuur opmerkingen of suggesties voor deze database naar het STRBase-team via [email protected]

We hebben grote inspanningen geleverd en zullen ons blijven inspannen om de juistheid en volledigheid van de gegevens in deze STR-database te waarborgen. Er zal van tijd tot tijd informatie worden toegevoegd om deze site zo up-to-date mogelijk te houden. Het National Institute of Standards and Technology (NIST) is op geen enkele manier verantwoordelijk voor informatie die via deze site wordt verstrekt, inclusief hyperlinks naar commerciële materiaalbronnen. Bepaalde commerciële verkopers worden op deze website geïdentificeerd ten voordele van de DNA-typeringsgemeenschap. In geen geval impliceert een dergelijke identificatie een aanbeveling of goedkeuring door NIST, noch impliceert het dat het geïdentificeerde materiaal, instrument of uitrusting noodzakelijkerwijs de beste is die beschikbaar is voor het testen van de menselijke identiteit.

Alle gebruikers gaan ermee akkoord dat alle toegang tot en gebruik van deze website en van elke site die hieraan is gekoppeld en de inhoud ervan op eigen risico is. Noch NIST, noch de webmaster van de STR DNA-internetdatabase aanvaarden verantwoordelijkheid of aansprakelijkheid voor de inhoud van pagina's buiten deze website.


Materialen en methodes

Aanname

Om trainingsgegevens op RNN te creëren, werd de hele PCR-reactie schematisch gepland. (Afb.  1 ). De binding van de primer aan de sjabloon is niet beperkt tot de volledige lengte en er wordt aangenomen dat slechts een deel van 3′ kan binden (Fig.  1 B). Er wordt aangenomen dat de haarspeldstructuur van de primer en zijn dimeer zijn gevormd voordat de primer aan de template wordt gebonden (Fig.  1 B). Er wordt dus aangenomen dat DNA-synthese plaatsvindt uit sommige haarspeldstructuren en dimeren 21, 22. Naarmate de DNA-synthese van gedeeltelijk gebonden primers vordert, begonnen PCR-producten die volledig complementair zijn aan de primers te worden gesynthetiseerd (Fig.  1 C). Uiteindelijk worden de meeste PCR-producten volledig complementair aan de primers (Fig.  1 D).

PCR-procesdiagram van primers met onvolledige homologie met de sjabloon. Schematisch diagram van de reactie aangenomen door PCR van gedeeltelijk gematchte primers. DNA-verlenging kan beginnen bij primers waarop gedeeltelijk 3′-end overeenkomt (B). Aan het einde van de tweede cyclus komt het 3′-uiteinde van het langwerpige DNA volledig overeen met een primer (C). Aan het einde van de derde cyclus is gesynthetiseerd DNA volledig gematcht aan beide uiteinden van gesynthetiseerd DNA (NS).

Om de relaties van deze schema's in woorden uit te drukken, hebben we besloten om de haarspeld, primerdimeer, primer-template-binding en primer-PCR-productbinding als woorden uit te drukken. De sterkte van de primer-template binding op de voorwaartse en achterwaartse flanken heeft een grote invloed op de totstandkoming van de PCR-reactie. Voor combinaties die niet van de originele primer-template zijn, moet de bindingspositie worden bepaald door PCR uit de mogelijke binding van meerdere primer-templates. Hiermee construeerden we de woorden voor de lerende RNN.

Sjablonen voor PCR

Een deel van de 16S rRNA-nucleotidesequentie (v6-v8) (supplement 1 tabel 1) werd gesynthetiseerd door OE-PCR (supplement 1 tabel 2) voor 30 phyla als matrijzen voor PCR-modelexperimenten. Van de 30 phyla werden 16S-rRNA-sequenties in Firmicutes gesynthetiseerd in twee geslachten, de Bacillus en de Calditerricola. Deze sequenties waren significant verschillend in v6-v8. Eenendertig dubbelstrengs DNA's met 435 tot 481 basen werden bereid als een matrijs voor PCR-modelexperimenten waarbij gebruik werd gemaakt van de standaard thermodynamische index.

PCR-experiment als basisgegevens voor primerontwerp met RNN

Ontwerp van primersets voor voorbereidend leren van RNN

We ontwierpen 72 sets PCR-primers die in staat zijn tot het amplificeren van 31 DNA-templates, volgens de specifieke kenmerken van de primersequentie voor de specifieke template en de amplificatiegrootte van ongeveer 100� (Tabel ​ (Tabel 1). 1). In een voorlopige proef waarbij primers werden ontworpen met behulp van Primer3-primerontwerpsoftware, amplificeerden alle primers alle 31 sjablonen (gegevens niet getoond). Op basis van het resultaat hebben we in dit stadium 72 sets PCR-primers ontworpen, waarbij we enkele van de conventioneel bekende uitgloeitemperaturen en enkele indicatoren zoals het vermijden van herhaling van een enkele base negeren. De grootte van de primers was ingesteld op 19� basen. De belangrijkste index is een hoge homologie met de doeltemplate en een lage homologie met andere.

Tafel 1

Primer sets voor het hoofdexperiment.

Primer nr.Primer naamVolgorde
1aim_1fGTCCAGGGCTTCACACATGCTA
aim_22rTGTTACCAACTTTCATGACGTG
2aim_71fAGCGCAACCCTCACCTTATGTT
aim_94rGGGACCGGATTTTTGAGATTAG
3aim_122fTTCAGTTGGGCACTCGTAAGGA
aim_94rGGGACCGGATTTTTGAGATTAG
4aim_94fCTAATCTCAAAAATCCGGTCCC
aim_143rCCTTCACGAGTTTCACCTTAGT
5aim_94fCTAATCTCAAAAATCCGGTCCC
aim_147rCTTCACCCCCTTCACGAGTTTC
6aim_161fGAGGTGGAGCGAATCCCAGAAA
aim_194rCTTACCAAGCATACCTTAGGCA
7aim_263fCAAATCCCAGAAAGCCGCTCTC
aim_250rACCAGCCCTGCCGTCGGCCCCT
8aim_348fGTTGTTGCCTAGCAATAGGATCT
aim_282rTGCTGCCCTCTGTCTATGCCAT
9aim_386fGCTGAGGACTCTAATTGAACTG
aim_394rAGACAGCTTTTAAGGGATTTCC
10aim_386fGCTGAGGACTCTAATTGAACTG
aim_461rCCGACCGGACTGAGACAGCTT
11aim_394fGGAAATCCCTTAAAAGCTGTCT
aim_436rCGAGCGTCTTTGGGTACTCCTG
12aim_468fGGCGGAGGAAATCCTAAAAACT
aim_515rCTTCAGATACTTCGGGTGCGAC
13aim_555fACGGGACTGCCCGCGAAAGCGG
aim_562rGGGCCCACCTTTTTGCGATTAG
14aim_599fGTGCTACAACGGTAGCGAAAC
aim_652rCCGCCGAGGCGGAGTTGGGTCA
15aim_764fCTTATCCTTTGTTGCCAGCGGT
aim_744rCGACATACTTTATGAGGTCCGC
16aim_812fCTGCCAGTGATAAACTGGAGGA
aim_744rCGACATACTTTATGAGGTCCGC
17aim_842fTCTCATAAAACCGTTCTCAGTT
aim_848rTGTTACAAACTCTCGTGGTGTG
18aim_1016fCTAATCGGAAAAAGCCGGCCTC
aim_1036rATGAATTACACCTTGGGCGGCT
19aim_1209fGTGTCGGTAGTTACAGGTGTCT
aim_1159rATTGTCGTGGCCATTGTAGCGT
20aim_1248fCGCCGTGACCGGCGGAGGAAGG
aim_1193rCCGCGCCATGGCTGATACGCGG
21aim_1175fTCGCCTAAACGTGGTCTCAGTG
aim_1264rTCCCAGTCGCGGCCCCTGCCCT
22aim_1177fGCCTAAACGTGGTCTCAGTGCA
aim_1264rTCCCAGTCGCGGCCCCTGCCCT
23aim_1316fCTAGTGGGACAGCCGGAGTAAT
aim_1285rTGCAATCCGAACTAAGACAAGG
24aim_1332fCCGGAGTAATCCGGAGGAAGGT
aim_1276rAGGTTTTTTGAGGTTGGCTCACT
25aim_1285fCCTTGTCTTAGTTCGGATTGCA
aim_1293rGCTTCTGGCAAAACCGACTTTC
26aim_1401fTGAGGTGTCGGCTTAAGTGCCA
aim_1368rGCTAGCTGCCTTCTGTACCCCC
27aim_1401fTGAGGTGTCGGCTTAAGTGCCA
aim_1383rTTTGGGATTAGCATACGGTCAC
28aim_1415fGAGGTGTCGGCTTAAGTGCCAT
aim_1368rGCTAGCTGCCTTCTGTACCCCC
29aim_1447fAGGTCATGCTGAGGACTCTGGA
aim_1368rGCTAGCTGCCTTCTGTACCCCC
30aim_1447fAGGTCATGCTGAGGACTCTGGA
aim_1391rTCGATCCGAACTGAGAGAGGA
31aim_1391fTCCTCTCTCAGTTCGGATCGAA
aim_1465rCCCTAGGACGATCCTTGCGGTT
32aim_1549fGGGTAATGCCGGGTACTCACAG
aim_1504rCATTGTCCCTGCCACTGTAGCG
33aim_1504fCGCTACAGTGGCAGGGACAATG
aim_1550rTAGCTCGGGGACTTCCGATGAA
34aim_1758fGCCAATACAAACAGTTGCAAAT
aim_1775rTACCAGCTCTCATAGTTTGACG
35aim_1770fCTTGAAAGTTGGTCTCAGTTCG
aim_1775rTACCAGCTCTCATAGTTTGACG
36aim_1770fCTTGAAAGTTGGTCTCAGTTCG
aim_1811rCTACCTAGACATGCGCTTCCT
37aim_1948fCAAAGGGCAGCGACATAGTGAT
aim_1984rATGAGCCGTAGCTGATGCCCAT
38aim_2085fAGTACAGAAGGTAGCAAGATCG
aim_2138rAACGTATTCACGGCGTTATGGC
39aim_2109fGATGGAGCAAATCCTTAAAGCT
aim_2164rTCAACGACTTAAGGTAAAACCA
40aim_2292fGGTTAAGTCCCCTAACGAGCGA
aim_2247rATGACTTTGCAGCCTAGCAACG
41aim_2547fTCGAGTACATGAAGTTGGAATC
aim_2581rTACGGTTAGGCCTGCTACTTCA
42ai2_1242_fTACTTTGTCTAACGAGACTGCC
ai2_1242_rCGAACTGAGACCAACTTTACAG
43ai2_100_fACGAGCCGGAGGAAGGAGG
ai2_100_rACCCCGGGAACGTATTCACC
44ai2_1213_fCCTAAACCCTGTCGTGGTGCAG
ai2_1213_rTAGCTCGGGGACTTCCGATGAA
45ai2_1325_fTAAGGGACTGCCCCGGATAAC
ai2_1325_rGCGCTTTCTGAGATTCGCTCAG
46ai2_6_fCAAGTCGAGCGGAGAAGATTT
ai2_6_rGGTATTCCCATCCTTTCGGAT
47ai2_1194_fGCGGGTGACCGTATGCTAATCC
ai2_1194_rCTTGCGGTTACGTACTTCAGGT
48ai2_1315_fCGTTGCTAGGCTGCAAAGTCAT
ai2_1315_rGCGGCTCCGGCGACTTCGGATG
49ai2_1147_fCGCCGTGACCGGCGGAGGAAGG
ai2_1147_rCACTGAGACCACGTTTAGGCGA
50ai2_23_fGAGACTGCCGGTGACAAACC
ai2_23_rAGTTGCAGACTCCAATCCGGA
51ai2_1244_fGCCAATACAAACAGTTGCAAAT
ai2_1244_rTACCAGCTCTCATAGTTTGACG
52ai2_1125_fACCGCTGCAACCCCGCGAGGGT
ai2_1125_rTGGGCGGCTGCTCCCTTGCGGT
53ai2_1238_fGGCACAGGTGGTGCACGGCCGT
ai2_1238_rGGCATAAGGGGCACGAGTACCT
54ai2_1166_fCCGGAGTAATCCGGAGGAAGGT
ai2_1166_rTGCAATCCGAACTAAGACAAGG
55ai2_1143_fTGCCGCCGTGACCGGCGGAGGA
ai2_1143_rCACTGAGACCACGTTTAGGCGA
56ai2_1124_fACCGCTGCAACCCCGCGAGGGT
ai2_1124_rAGCGCACCGACTTCTATGGCAA
57ai2_1284_fACGAGACTGCCTGGGTTAACCA
ai2_1284_rAGCTTTAAGGATTTGCTCCATC
58ai2_1288_fCTGCCTGGGTTAACCAGGAGGA
ai2_1288_rGAACTGGGGCCAGCTTAAGGA
59ai2_1090_fAAAGGAGACTGCCAGTGATAAA
ai2_1090_rTCCAATCCGGACTACGACATAC
60ai2_1142_fGTGTCGGTAGTTACAGGTGTCT
ai2_1142_rCAACTCCGCCTTCACGGGGGGCG
61ai2_1195_fGCGGGTGACCGTATGCTAATCC
ai2_1195_rCCCTAGGACGATCCTTGCGGTT
62ai2_101_fGTCGTCGTCAGCTCGTGCC
ai2_101_rCTCCTTCCTCCGCCTCGTC
63ai2_1189_fCGTCGTAAGATGTGAGGAAGGT
ai2_1189_rTCGATCCGAACTGAGAGAGGA
64ai2_1088_fCTTATCCTTTGTTGCCAGCGGT
ai2_1088_rTCCAATCCGGACTACGACATAC
65ai2_1192_fGGGGGTACAGAAGGCAGCTAGC
ai2_1192_rCTTGCGGTTACGTACTTCAGGT
66ai2_1303_fGCCATAACGCCGTGAATACGTT
ai2_1303_rCTTCATCCCTAGTCATCAGCCTC
67ai2_1102_fAAGTTGGGCAGTCTAAGGTGAC
ai2_1102_rTCTGCAGCTCTTTGTACCGTC
68ai2_54_fCGGGTGAGTAACACGTATCTAA
ai2_54_rTCTCAGTTCGGCTACGTATCAT
69ai2_1275_fTGATATGGAGCGAATCCCCAAA
ai2_1275_rGTCTGCCTCCTGCAAGCAGGTT
70ai2_1327_fCTGAGCGAATCTCAGAAAGCGC
ai2_1327_rTTGCCTGGGTTGGGCCACCGGC
71ai2_10_fCTGGCGGCGTGGATAAGACA
ai2_10_rATGGGCTATTCCCCACTTCAG
72ai2_1071_fAGCGATGCCACCCGGCAACGGG
ai2_1071_rCCTGCCCGTAGGCTCCCGGCGA

Het primerpaarnummer, de primernaam en de basenvolgorde (5′ →𠂓′) die in de experimenten voor RNN-training werden gebruikt, worden getoond. Primers met hetzelfde primerpaarnummer worden gebruikt als een set primers.

We ontwierpen ook 54 sets phylum-specifieke primers, die werden ontworpen op basis van analyse met voorlopige testprimers (tabel ​ (tabel 2). 2). Als ontwerpmethode werd eerst een veelvoud van primerkandidaten geëxtraheerd uit de matrijssequentie, en een combinatie van de geëxtraheerde primerkandidaten werd gebruikt als een primerpaarkandidaat. Een primerpaar waarvoor PCR naar verwachting alleen in een specifieke bacteriële stam door RNN zal optreden, werd bepaald als een primerset voor een testexperiment.

Tafel 2

Primerset nr.Primer naamPrimervolgorde
11_f_180AACGCGCTGCGAGCCTGTGA
1_r_369CCCACAAGGGTTAGGCCACT
21_f_180AACGCGCTGCGAGCCTGTGA
1_r_397ATCGCCGATCCCACCTTCGA
31_f_180AACGCGCTGCGAGCCTGTGA
1_r_400CCAATCGCCGATCCCACCTT
41_f_180AACGCGCTGCGAGCCTGTGA
1_r_408ACTTCGTCCCAATCGCCGAT
51_f_186CTGCGAGCCTGTGAGGGTGA
1_r_369CCCACAAGGGTTAGGCCACT
61_f_186CTGCGAGCCTGTGAGGGTGA
1_r_397ATCGCCGATCCCACCTTCGA
71_f_186CTGCGAGCCTGTGAGGGTGA
1_r_400CCAATCGCCGATCCCACCTT
81_f_186CTGCGAGCCTGTGAGGGTGA
1_r_408ACTTCGTCCCAATCGCCGAT
92_f_50TCAGTTGGGCACTCGTAAGG
2_r_342TGGCAAAGACCACTTCGGGT
104_f_251CAAAGCCACCCCCAGTTCA
4_r_395CTCTTCGCCTGACTTCGGGT
114_f_251CAAAGCCACCCCCAGTTCA
4_r_403TCGGCAGGCTCTTCGCCTGA
125_f_0TGCCTGGGAGCCCTAGCACA
5_r_228CCCCTTACGGGTTCGCTTCC
135_f_223CAGAGGGAAGCGAACCCGTA
5_r_410TCCGGGGGTTGGGATAGCGA
146_f_66GCCTAGCAATAGGATCTCTC
6_r_211GGGCATAGTTTAGGGATTGG
156_f_211CCAATCCCTAAACTATGCCC
6_r_363AGACGACCTGAGCACTTCTG
166_f_211CCAATCCCTAAACTATGCCC
6_r_385TACTAATCACAACTTAGGGC
177_f_205AATCCCTTAAAAGCTGTCTC
7_r_347AGCGTCTTTGGGTACTCCTG
188_f_78ACTGCCCAGATCAACTGGGA
8_r_349TGGCTTCAGATACTTCGGGT
198_f_78ACTGCCCAGATCAACTGGGA
8_r_359TCCTTGCGGTTGGCTTCAGA
209_f_87GACTGCCCGCGAAAGCGGGA
9_r_181GTTGCCGGGTGGCATCGCTT
2110_f_226TCCCTAAAAAGCATCCTCAG
10_r_381AGGCGGAGTTGGGTCACTGA
2212_f_190GGCATATACAAAGAGAAGCG
12_r_395TAAGCGCCCTCCCGAAGGTT
2312_f_216CGAGGCAAGCGGACCTCAT
12_r_395TAAGCGCCCTCCCGAAGGTT
2412_f_236AAAGTATGTCGTAGTCCGGA
12_r_395TAAGCGCCCTCCCGAAGGTT
2513_f_203GGTACAAAGAGCTGCAAGAC
13_r_397CTCCAAAAAAGGTTTACCCCAC
2614_f_64GCAAGGGGGCCCTCTTGGAGA
14_r_341TAGAGCACTCCCTTCTCCCA
2715_f_60TGGCGAAACCGCCTCGGATA
15_r_349CTCCCTTGCGGTTAGCGCAC
2818_f_17TGTCGGTAGTTACAGGTGTC
18_r_177GATCTGCACTGAGACCACGT
2918_f_173CTAAACGTGGTCTCAGTGCA
18_r_330TCCCCGACTGGGGTTAGCAC
3019_f_83TAGTGGGACAGCCGGAGTAA
19_r_177AGGTCGCATCCCGTTGTCCT
3119_f_90ACAGCCGGAGTAATCCGGAG
19_r_371CTATCCGAAGATTCGGTCAC
3219_f_196TCGCGAGAGTGAGCCAACCT
19_r_346TCTGGCAAAACCGACTTTCG
3319_f_196TCGCGAGAGTGAGCCAACCT
19_r_371CTATCCGAAGATTCGGTCAC
3420_f_225ATCCCAAAATCCTCTCTCAG
20_r_382GACGATCCTTGCGGTTACGT
3521_f_61GGGTAATGCCGGGTACTCAC
21_r_211ACCACGACAGGGTTTAGGGG
3621_f_61GGGTAATGCCGGGTACTCAC
21_r_217ATCTGCACCACGACAGGGTT
3721_f_61GGGTAATGCCGGGTACTCAC
21_r_227GCAACCCTCAATCTGCACCA
3821_f_179AATGGGCTGCAACGCCGTAA
21_r_359GTTAGCTCGGGGACTTCCGA
3921_f_216AAACCCTGTCGTGGTGCAGA
21_r_348GACTTCCGATGAACCCGACT
4023_f_151ATGACGTCAGGTACTCGTGC
23_r_437CCCCCCTCACCAGGTTCTCC
4124_f_84CTGCCAACGTAAGTTGGAGG
24_r_360CTTGCGGTTAGCAACACGGT
4226_f_74AGACTGCCCGTGTTAAGCGG
26_r_169TCACTATGTCGCTGCCCTTT
4326_f_74AGACTGCCCGTGTTAAGCGG
26_r_358CTGCAAGCAGGTTGGCGCAA
4428_f_165AATGGGGCGGACAGAGCGTT
28_r_333CCCCCGCTTTGGTGGCTTGA
4528_f_165AATGGGGCGGACAGAGCGTT
28_r_397ACTTAGTCCCCATCACGGGT
4628_f_170GGCGGACAGAGCGTTGCTAG
28_r_339GGATGCCCCCCGCTTTGGTG
4728_f_173GGACAGAGCGTTGCTAGGCT
28_r_333CCCCCGCTTTGGTGGCTTGA
4828_f_192TGCAAAGTCATGCCTAATCGC
28_r_333CCCCCGCTTTGGTGGCTTGA
4928_f_192TGCAAAGTCATGCCTAATCGC
28_r_397ACTTAGTCCCCATCACGGGT
5028_f_204CTAATCGCAAAAACCGTTCC
28_r_397ACTTAGTCCCCATCACGGGT
5129_f_237GCGAATCTCAGAAAGCGCTC
29_r_437CCCAGTCGCCAGCCATACCA
5230_f_128CAATGCTACGGACAAAGGGC
30_r_306TTCGGGCGTGGCCAACTTCC
5330_f_128CAATGCTACGGACAAAGGGC
30_r_328CCACAAGGGTTGGAGTAACG
5430_f_128CAATGCTACGGACAAAGGGC
30_r_342TTCGGCGTCCTCCTCCACAA

Het primerpaarnummer, de primernaam en de basenvolgorde (5′- >𠂓′) die in de experimenten voor de RNN-test werden gebruikt, worden getoond. Primers met hetzelfde primerpaarnummer worden gebruikt als een set primers.

PCR-amplificatie-experimenten

Met behulp van de 72-primer-sets voor het leren en valideren van RNN en 54-primer-sets voor het testen van RNN, hebben we geprobeerd alle 31 sjablonen te versterken. PCR werd uitgevoerd met behulp van 2× GoTaq Green Hot Master Mix (Promega) voor een totaal van 3.906 PCR's met 31 templates en 126 (72 plus 54) sets primers. De PCR-oplossing bevatte 0,5 µM primer, 100.000 exemplaren van de sjabloon, en werd aangepast tot 1× GoTaq Green Hot Master Mix door water en 2× GoTaq Green Hot Master Mix toe te voegen. Na aanpassing werd de PCR-oplossing onderworpen aan denaturatie bij 95 ଌ gedurende 2 min en gevolgd door 33 cycli bij 95 ଌ gedurende 30 s, 56 ଌ gedurende 30 s, 72 's x000b0C gedurende 30 s, en gevolgd door incubatie bij 72 ଌ gedurende 2 min. Na afkoeling tot 8 ଌ, werd het bewaard bij 4 ଌ totdat het werd verwerkt in agarosegelelektroforese.De PCR-producten werden aan elektroforese onderworpen met gebruikmaking van 1,5% agarose in 1× TBE buffer bij 100â V gedurende 40â min. De agarosegel werd gekleurd in 1 µg/ml ethidiumbromide-oplossing en gefotografeerd onder UV.

Symbolen voor RNN-leren

De gegevens voor RNN-leren bestonden uit een symbool (Tabel &# (Tabel 3) 3 ) gegenereerd uit de haarspeldstructuur van de primer, het primerdimeer en de homologie tussen de primer en de sjabloon, en meerdere 5-tekencodes (pentacode ) gegenereerd op basis van het symbool (Fig.  2 ). De juiste antwoordgegevens voor RNN waren het PCR-resultaat voor elke primerset en sjabloon. Omdat de RNN is geoptimaliseerd voor het leren van zinnen in natuurlijke taal, die uit woorden zijn samengesteld, wordt de gegenereerde pentacode een pseudo-woord genoemd en wordt de pentacode die wordt vermeld volgens de nucleotidesequentie van de sjabloon een pseudo-zin genoemd. Specifieke ontwerpmethoden worden beschreven in de sectie pseudo-woorden en pseudo-zinnen maken.

Tafel 3

Basispaartekens voor zintuiglijke of antisense richting.

Basepaar (primer base'x02013template base)Primer-sjabloonPrimer haarspeld of dimeer
BeginstadiumMidden stadium
Naar vorenAchteruitNaar vorenAchteruit
A-T, T-AeenFPjijk
CG, GCBGQvik
A-A, A-G, G-A, G-G, C-CCHRmet wiem
T-T, T-C, C-TNSlsxN
CA, AC, GT, T-GeJtjaO

Een symbool voor het genereren van pseudo-woorden voor RNN-leren. De codes worden in de nucleotideduplex op elk basenpaar op de complementaire positie gezet. Niet-overeenkomende basenparen zoals A-A, T-T en C-A kunnen binnen het gedeeltelijk complementaire gebied voorkomen. Basenparen worden gegroepeerd op basis van invloed op de stabiliteit van gedeeltelijk complementaire strengen.

Het proces van het genereren van pseudo-woorden en pseudo-zinnen wordt getoond. Pseudowoorden worden gegenereerd in relatie tot een bepaald primerpaar en template. Bereid eerst het primerpaar en de sjabloongegevens voor in een formaat dat kan worden gelezen door het analyseprogramma (EEN). Dan, de basenvolgorde alternatieven die gesynthetiseerd op de primer haarspeld (B) en dimeer (C) worden toegevoegd aan de oorspronkelijke primersequenties. De plausibele dubbelstrengsvorming die wordt verwacht tussen de primersets en de template wordt aangenomen en uitgedrukt als letters (NSE). Eerst worden een deel van de complementaire primer inclusief een deel van de primer en de template en de positie van de template vermeld (NS), en hun interactie wordt uitgedrukt door een letter voor elk basenpaar (E). De code van één teken die wordt gebruikt om de interactie uit te drukken die op dat moment werd gebruikt, wordt weergegeven in E. Om machinaal leren met RNN te doen, is het noodzakelijk om de primer-bindende positie op de sjabloon te voorspellen, die de bron is van de productie van het PCR-product. Bij de voorspelling worden andere primer-bindende posities geclassificeerd als niet-gerelateerde bindingsposities van de PCR-productproductie. In deze studie werd de vrije energie van elke plausibele primerbindingspositie op de template berekend voor alle mogelijke primerbindingsposities. Verwijzend naar de vrije energie van bindingsposities, werden twee primerbindingsposities, die minimale vrije energie hebben, geïdentificeerd als de PCR-amplificeerbare primerbindingsposities. Voor deze bepalingen werd de vrije energie berekend op geneste dimeren en somvrije energieën op de bindingsposities van de primer-sjabloon (F). De vrije energieën worden berekend op basis van enthalpie, entry en absolute temperatuur van de geneste dimeren. Volgens de vrije energieën op de bindingsposities van de primer-sjabloon, hebben we twee bindingsplaatsen voor de primer-sjabloon bepaald, van waaruit PCR het meest waarschijnlijk zal voortgaan, en nucleotide-interactie-letters met hoofdletters (G). Net als bij primer-template-interacties, zoekt het programma naar haarspeld- of dimeervorming in een primer en primers. Codes van één letter worden gegenereerd voor elk basenpaar in deze haarspeld en dimeer (H). Strings van interacties tussen primers of tussen primers en templates werden opgesplitst in 5 letters (codes van vijf tekens) als woorden en gedupliceerd om hun belang weer te geven, afhankelijk van hun lengte en positie vanaf het 3'-uiteinde (l). Evenzo wordt de interactie voorspeld voor het PCR-product en de primers getoond in Fig. 1D, 1D, en karakters die verschillen van de interactie die in het midden van het proces wordt aangenomen, worden toegewezen (J). Een pseudo-zin wordt gegenereerd door alle op deze manier toegewezen codes van vijf tekens op posities te rangschikken op basis van de reeks sjablonen (K).

Creatie van pseudo-woorden en pseudo-zinnen uit de relatie tussen primers en templates

Voor haarspelden en dimeren werd DNA-synthese uit het complementaire gebied voorspeld en werden de gesynthetiseerde primers toegevoegd aan de primerset. Voor het complementaire gebied tussen het haarspeld-, dimeer-, primer-sjabloon en primer-PCR-product werden tekens die overeenkomen met het complementaire basenpaar ingesteld voor het gehele complementaire gebied, en een pseudo-codesequentie werd gegenereerd. De overeenkomstige tekenreeks werd verdeeld in 5 basen in volgorde vanaf het 3′ uiteinde, en 5 basen werden herhaaldelijk gegenereerd volgens de lengte van het complementaire gebied tussen de primer-template en het primer-PCR-product (pseudo-woord). De laatste pseudowoorden werden gegenereerd in de volgorde van haarspeld-, dimeer- en sjabloonvoorwaartse strengposities.

Haarspeld werd doorzocht op elke primer. Dimeren werden ook doorzocht op mogelijke combinaties van primers die in de primerset waren opgenomen. De waterstofbinding tussen primer en template werd gezocht door elke combinatie van primer-template, primer-primer en 5′-end en 3′-end van een primer.

Bij het aftasten van veronderstelde primerset, werd het zoeken uitgevoerd voor zowel de primerset als de dubbelstrengs matrijs (Figuur   2A). Een complementair gebied met 5 of meer basen werd verondersteld een haarspeld of dimeer te vormen, en het relevante gebied wordt doorzocht. Indien aanwezig, werd een 3′-end terminal van de gedeeltelijke duplex doorzocht. Ervan uitgaande dat complementaire strengen werden gesynthetiseerd uit de gedeeltelijke duplex. Bij de synthese van DNA uit de gedeeltelijke duplexprimers werden de extra primers achtereenvolgens in de primerset opgenomen (Fig.  2 B, C).

Als algemene regel werd de homologie tussen de primersequentie verdeeld in 5 tot 22 basen en de templatesequentie bevestigd, en toen het aantal basen in tabel 1 van supplement 2 hetzelfde was (ongeveer 80%), werd een pseudo-code gegenereerd (Afb.  2 D). Met betrekking tot de homologie, het gebied dat moet worden gegenereerd als een pseudo-code, werd de pseudo-code bepaald door te verwijzen naar Tabel 3 3 voor de volledige homologie, en werden alle pseudo-codes in kleine letters gegenereerd (Fig. 2E).

Veel combinaties van primerset-template hebben meerdere complementaire regio's waarvoor priming-posities moeten worden bepaald. Aangezien het complementaire gebied waarvoor een dergelijke priming-positie moet worden bepaald kort genoeg is, wordt verwacht dat de meest stabiele combinatie van complementaire gebieden de priming-positie is. Om de meest stabiele complementaire regio te bepalen, werd de combinatie van complementaire regio's met de minimale Gibbs-energie ingesteld als de priming-positie (Fig.  2 F). De Gibbs-energie werd berekend volgens de formule van DG =𠂝H-TDS door achtereenvolgens de entropie en enthalpie te berekenen van de twee basen van de primer en de twee basen van de template op de complementaire positie, uitgaande van een uitgloeitemperatuur van 56 ଌ. Daarom werd, na berekening voor alle combinaties van twee complementaire basen, de totale waarde geminimaliseerd en werden de complementaire posities van vooruit en achteruit, die gescheiden zijn door 100 basen of meer, ingesteld als de priming-posities. Met behulp van numerieke referentiewaarden 23 werden complementaire dimeersetberekeningen voor entropie en enthalpie uitgevoerd waarbij hun oorspronkelijke en onze geëxtrapoleerde waarden werden gebruikt (supplement 2, tabel 4). De pseudo-code voor de complementaire positie, waarvan werd voorspeld dat het de priming-positie zou zijn, werd omgezet in hoofdletters (Fig.  2 G). Homologe posities van 6 basen of meer werden doorzocht op haarspelden en dimeren, en pseudocodes werden gegenereerd voor de overeenkomstige homologe regio's (Fig.  2H). Voor de pseudo-codesequentie die werd gegenereerd tussen de primer en de template, werden 5 karakters achtereenvolgens geëxtraheerd uit het 3′-uiteinde van de primer om een ​​pentacode te verkrijgen. De pseudo-code werd gegenereerd door een deel van de pentacode te herhalen volgens de lengte van het homologe gebied om de sterkte van de binding tussen de primer en de template tot uitdrukking te brengen (Fig.  2 I).

Wat betreft het PCR-product, het complementaire gebied van de primer is ook volledig complementair aan de primer omdat de synthese verloopt met de primer als een sjabloon in de verlengingsreactie (Fig.  1 D). Voor de pseudo-code in dit gebied werd een pseudo-code ingesteld die verschilt van de relatie tussen de sjabloon en de primer, en een pseudo-code werd op dezelfde manier gegenereerd als in het complementaire gebied van de primer-sjabloon (Fig.   2 J). De pentacodes gegenereerd uit haarspelden, dimeren werden eerst geplaatst, gevolgd door de primer-templates, en de pentacodes gegenereerd uit de primer-PCR-producten in de volgorde van de voorwaartse strengen van de template. De pentacode werd gegenereerd en geplaatst uit een set primers en een sjabloon werd gebruikt als pseudo-zinnen van de primerset-sjabloon (Fig.  2 K). Pseudo-zinnen werden gegenereerd voor alle primer- en sjablooncombinaties en gebruikt als leergegevens tijdens machine learning.

Scripts voor pseudo-zingenerator

Er werden Ruby- en Python-scripts gebruikt om pseudo-zinnen te genereren in de volgorde die wordt getoond in Fig.  2 (Supplement 3 , List 1𠄹). Het Ruby-script las de structuur van de template-base-sequentie, primer-base-sequentie en primer-set, en genereerde pseudo-zinnen volgens de volgorde getoond in Fig.  2 . SeqKit (//bioinf.shenwei.me/seqkit/, v0.14.0) werd gebruikt om te zoeken naar homologie tussen de primer en de sjabloon. De pseudo-zinnen die voor elke sjabloon-primerset werden gegenereerd, werden eerst gecategoriseerd door PCR-resultaten en elk werd gecategoriseerd in 5 groepen. Een van de vijf groepen werd niet gebruikt om te leren als een groep om RNN-leren te verifiëren, maar werd gebruikt om de voorspellingsnauwkeurigheid voor elk tijdperk te voorspellen.

We merkten op dat een bepaalde primerset veel positieve PCR-resultaten opleverde en de groep organiseerde om de effecten ervan te verspreiden. Vijf groepen werden willekeurig geconstrueerd voor elke positieve en negatieve PCR-resultaten na het verzamelen van de resultaten voor elke sjabloon. Om het totale resultaat in 5 groepen te verdelen, werden de primerpaar-templategegevens, de eenheid van gegevens, gecombineerd zodat het totale aantal even was voor elke groep. Wanneer we de verhouding van PCR-positieven en -negatieven gelijkmaken, worden de verkregen gegevens aangepast zodat de cijfers zelfs in het stadium zijn van het verzamelen van de resultaten voor elke sjabloon (onderbemonstering).

Axlsx (https://github.com/randym/axlsx, v3.0.0) werd gebruikt voor het inkleuren van spreadsheets (tabellen ​ (tabellen4, 4 , ​ ,7). 7 ). MatPlotLib (https://matplotlib.org/, v3.3.3) werd gebruikt voor het maken van lijngrafieken op tijdvaknauwkeurigheid (Fig.  4 ). GnuPlot (//www.gnuplot.info/, v5.4) werd gebruikt om de scatterplot voor Gibbs-energieën te maken (Fig.  5 ).

Tabel 4

PCR-resultaten met een combinatie van 72 primersets en 31 sjablonen.

PCR-resultaten worden uitgedrukt door de volgende numerieke waarden gebaseerd op waarneming op agarosegels. Nummer 0: Geen PCR-product, 1: PCR-product kan worden bevestigd. Resultaten op de primerparen die positieve resultaten hebben op meer dan 20 sjablonen worden weergegeven met een roze achtergrond. Evenzo worden primerparen die resultaten hebben met enkel of geen positief op 31 templates getoond met respectievelijk limoen- of blauwe achtergrond.

Gemiddelde voorspellingsnauwkeurigheid op validatiegroepen in kruisvalidatie. Het gemiddelde van de voorspellingsnauwkeurigheid werd berekend op 5 validatiegroepen in kruisvalidatie. (EEN) Hele sets in 72-primer-31 sjabloonsets werden gebruikt voor leren of valideren. (B) Het aantal primerpaar-template-sets in 72-primer-31template werd gecontroleerd op 1:1 door onderbemonstering. Groepen zijn Oranje: PCR-positieve primerpaar-sjabloonsets, Groen: PCR-negatieve primerpaar-sjabloonsets en Blauw: alle primerpaar-sjabloonsets. Standaarddeviatie binnen validatiegroepen werd weergegeven als foutbalken.

Tabel 7

Kleursamenvatting van PCR-resultaten en voorspellingen, (A) voorspellingen van volledige gegevens, (B) voorspellingen van onderbemonsteringsgegevens.

Kleurpresentaties voor PCR-resultaat en RNN-voorspelling. Kleuren tonen de volgende resultaten en voorspellingen rood: PCR-positief-voorspelling-positief, roze: PCR-positief-voorspelling-negatief, blauw: PCR-negatief-voorspelling-negatief, lichtblauw: PCR-negatief-voorspelling-positief, wit: primerpaar-sjabloonsets uitgesloten van voorspellingen tijdens onderbemonstering.

Scatterplot van PCR-resultaten en voorspellingen. Plot de PCR-resultaten en RNN-voorspellingen tegen de Gibbs-energie bij de waterstofbrug op de voorwaartse (horizontale as) en achterwaartse (verticale as) primingposities bepaald op het moment van pseudo-zinbepaling (Fig.  2 ). Kleuren en vorm tonen de volgende resultaten en voorspellingen rode driehoek: PCR-positief-voorspelling-positief, roze driehoek: PCR-positief-voorspelling-negatief, blauwe cirkel: PCR-negatief-voorspelling-negatief, lichtblauwe cirkel: PCR-negatief- voorspellend positief. Primerpaar-sjabloonsets die waren uitgesloten van voorspellingen tijdens onderbemonstering, werden niet uitgezet.

Leerresultaten

De PCR-resultaten die werden uitgevoerd met de annealingtemperaturen ingesteld op 56 ଌ, werden ingesteld als pseudo-teksten gegenereerd uit elke primer-template-set en werden getraind door RNN. Voor het leren werd de pseudo-zin gemaakt voor de combinatie van primer en sjabloon gebruikt als invoergegevens en werden de PCR-resultaten gerangschikt als een leraar. Voor de RNN werd een RNN-Long kortetermijngeheugen (LSTM) -module van PyTorch (https://pytorch.org/, v1.7.1) gebruikt. Python-scripts voor het leren van pseudo-zinnen en het extraheren van voorspellingsresultaten zijn geschreven op basis van de scripts die in een boek zijn gepubliceerd (Shinqiao Du, "Can be used in the field! Introduction to PyTorch development Creation of deep learning model and implementatie in application", Shosuisha 2018 /9/18 in het Japans). Na het lezen van de pseudo-zinnen en PCR-resultaten van elk primerpaar-sjabloon, genereerde RNN een beslissingsalgoritme dat overeenkwam met de uitvoerresultaten voor alle ingevoerde pseudo-zinnen (aangeleerd algoritme) (Fig.  3 ). Als de negatieve controle van zinnen, werden willekeurig geselecteerde nucleotide-pentameren uitgelijnd als onzinnige pseudo-zinnen.

Leren en voorspellen door RNN. Schematisch diagram van het leren van pseudo-zinnen door RNN. De bovenste rij toont de verwerking tijdens het leren en de onderste rij toont de verwerking tijdens het testen. De leerresultaten worden opgeslagen in het door PyTorch gespecificeerde bestand, gelezen tijdens de test en gebruikt voor de voorspellingsstap.

De voorspellingsnauwkeurigheid van het gegenereerde getrainde algoritme werd bevestigd door gesplitste verificatie (kruisvalidatie). De primerpaar-template-sets werden in vijf groepen verdeeld en de RNN werd geleerd met behulp van vier groepen onder hen en het leren. De overige groep werd niet gebruikt als leergegevens, maar werd gebruikt als verificatiegegevens. Verificatie vond plaats tijdens de leerstappen.

Bij het evalueren van de voorspelling door RNN, werd de vraag of de verwachte PCR-band werd gevonden op agarose-gelelektroforese behandeld als de echte omstandigheden, en de voorspelling door RNN werd behandeld als de voorspellende omstandigheden. Een echt positief, vals negatief, vals positief, echt negatief, gevoeligheid, specificiteit en nauwkeurigheid werden dienovereenkomstig berekend. Significante verschillen in gevoeligheid, specificiteit en nauwkeurigheid tussen condities werden gemaakt op basis van Student's en Welch's t-test 24 .


Primer Dimer / Haarspeld Algoritmen - Biologie

DNA-oligonucleotiden zijn essentiële componenten van een groot aantal technologieën in de moleculaire biologie. De belangrijkste gebeurtenis van elke op oligonucleotide gebaseerde test is de specifieke binding tussen oligonucleotiden en hun doel-DNA. Enkelstrengs DNA-moleculen hebben echter ook de neiging zich te binden aan onbedoelde doelen of aan zichzelf. De waarschijnlijkheid van een dergelijke niet-specifieke binding neemt toe met de complexiteit van een test. Daarom zijn nauwkeurig gegevensbeheer en ontwerpworkflows noodzakelijk om de in-silico ontwerp van primers en probes. Zowel voor databeheer als voor het ontwerpproces moeten belangrijke overwegingen worden gemaakt met betrekking tot de rekeninfrastructuur en de runtime. Het ophalen van gegevens, het bijwerken van gegevens, opslag, filtering en analyse zijn de belangrijkste onderdelen van een sequentiegegevensbeheersysteem. Elk onderdeel moet goed worden geïmplementeerd, aangezien de resulterende sequenties de basis vormen voor het oligonucleotide-ontwerp. Belangrijke hoofdkenmerken, zoals de lengte van de oligonucleotiden, smelttemperatuur, secundaire structuren en vorming van primerdimeer, evenals de specificiteit, moeten worden overwogen voor de in-silico selectie van oligonucleotiden. De ontwikkeling van een efficiënte workflow voor het ontwerpen van oligonucleotiden vereist de juiste balans tussen de precisie van de toegepaste computermodellen, de algemene tijdsbesteding en de rekenbelasting.

Dit document geeft een overzicht van belangrijke parameters tijdens het ontwerpproces, beginnend bij het ophalen van gegevens tot de ontwerpparameters voor geoptimaliseerd oligonucleotide-ontwerp.


Hoe herken je primerdimeer?

Let er veel meer op. Trouwens, wat veroorzaakt primerdimeer?

Oorzaken van PCR/Primer dimeren in Sequentiereacties Besmetting van de sjabloon, inleiding voorraad of andere sequencing reagentia met primer dimeren. Een te lage gloeitemperatuur tijdens de PCR. Twee inleiding bindingsplaatsen aanwezig in de sjabloon. Directe sequencing van PCR-producten waarbij er meer dan één band is.

  1. Vermijd complementaire klemmen aan het 3'-uiteinde van uw primers, b.v. GC of GCGC, enz.
  2. Meet en pas uw primer- en sjabloonconcentraties aan de aanbevolen waarden aan.
  3. Gebruik touchdown PCR (temperatuurgradiënt) om giswerk uit de gloeitemperaturen te halen.
  4. Gebruik high-fidelity DNA-polymerasen, b.v. Pfoe.

Hoe kom ik van de primer dimeer af?

  1. verhoog de gloeitemperatuur.
  2. verhoog de tijdtemperatuur van de denaturatie van de sjabloon.
  3. verlaag de concentratie primers (10 pmol is OK)
  4. gebruik een PCR-versterker zoals DMSO.
  5. Bekijk je sjabloon. (
  6. gebruik Tag van hoge kwaliteit.

Mark K Chee. Martin Methodistencollege. Hallo Deepthi, Haarspelden formulier wanneer uw inleiding is in staat om een ​​aantal basenparen te vormen tussen twee afzonderlijke gebieden langs zijn lengte nadat het op zichzelf is teruggevouwen.


Een alternatief mechanisme voor Primer Dimer-artefacten

Er zijn enkele aanvullende waarnemingen die aanwijzingen geven voor een alternatief mechanisme voor primerdimerisatie.

  1. Over het algemeen worden homodimeren (d.w.z. dimeren waarbij dezelfde streng betrokken is) zelden waargenomen.
  2. Primerdimeerartefacten treden typisch op bij een groot aantal drempelcycli (meestal > 35 cycli), dat hoger is dan het aantal drempelcycli voor het gewenste amplicon.
  3. Primerdimeren nemen aanzienlijk toe wanneer heteroloog genomisch DNA wordt toegevoegd.
  4. Primerdimeren worden het vaakst waargenomen wanneer een of beide primers inefficiënt binden aan het doelwit-DNA (bijvoorbeeld vanwege de secundaire structuur van het doelwit of zwakke thermodynamica).
  5. Wanneer de sequentie van de primerdimeren wordt bepaald, zijn er vaak een paar extra nucleotiden van mysterieuze oorsprong in het midden van het dimeeramplicon.

Waarnemingen 1 en 2 suggereren dat DNA-polymerase niet efficiënt bindt aan primerduplexen met complementaire 3'-uiteinden of deze verlengt. Observatie 2 zou ook zo kunnen worden geïnterpreteerd dat de concentratie van de primerduplex vrij laag is in vergelijking met de normale primer-doelwitduplex. In de vroege stadia van PCR suggereren observaties 3 en 5 echter dat genomisch achtergrond-DNA een rol kan spelen in het mechanisme van primerdimeervorming. Observatie 4 suggereert dat primerdimerisatie moet plaatsvinden in de vroege PCR-rondes om te voorkomen dat het gewenste amplicon de reacties in de reageerbuis overneemt. Figuur 9 illustreert een mechanisme dat het genomische DNA in de vroege cycli van PCR betrekt en dat een verklaring geeft voor alle vijf waarnemingen.

Het in Fig. 9 gepresenteerde mechanisme kan ook met de computer worden gecontroleerd, maar het zoeken naar zo'n site in een groot genoom kan behoorlijk rekenkundig veeleisend zijn. Het ThermoBLAST-algoritme dat is ontwikkeld door DNA Software, Inc. kan deze uitdaging aan (zie mythe 5).


Primerontwerp met software

Er is een aantal primerontwerptools beschikbaar die kunnen helpen bij het ontwerpen van PCR-primers voor zowel nieuwe als ervaren gebruikers. Deze tools kunnen de kosten en tijd die nodig zijn voor experimenten verminderen door de kans op mislukte experimenten te verkleinen.

Primer Premier volgt alle richtlijnen die zijn gespecificeerd voor het ontwerpen van PCR-primers. Primer Premier kan worden gebruikt om primers te ontwerpen voor enkele sjablonen, uitlijningen, gedegenereerd primerontwerp, restrictie-enzymanalyse. contig-analyse en ontwerp van sequencing-primers.

De richtlijnen voor het ontwerp van de qPCR-primer variëren enigszins. Software zoals AlleleID en Beacon Designer kunnen primers en oligonucleotide-probes ontwerpen voor complexe detectietesten zoals multiplex-assays, primerontwerp voor verschillende soorten, soortspecifiek primerontwerp en primerontwerp om de kosten van experimenten te verlagen.

PrimerPlex is software die ASPE-primers (Allele-specific Primer Extension) en capture-probes kan ontwerpen voor multiplex SNP-genotypering met behulp van suspension array-systemen zoals Luminex xMAP'174 en BioRad Bioplex.


Hoe zich te ontdoen van PCR-primerdimeer - (17 maart 2003 )

Welke concentraties kunnen het beste worden gekozen voor een Mg2+-titratie? Ik bedoel, welke waarden moet ik precies proberen?

Mg2+ bij een eindconcentratie van 1,5, 2,0, 2,5 en 3,0 mM moet worden geprobeerd.

Ik probeer een RT-PCR efficiënter te maken omdat ik, hoewel ik mijn gewenste PCR-product heb, een betere reactie wil krijgen. Ik denk dat het probleem is dat de primers dimeren krijgen. Ik heb gehoord over het gebruik van detergenten of DMSO in het reactiemengsel, maar ik weet dit niet zeker. Weet iemand een manier om dit te doen zonder de Tm te veranderen?

Dimeren hebben de neiging zich te vormen wanneer de templateconcentratie laag is. Als je kunt, probeer dan meer van de sjabloon te titreren.

Door gist-tRNA-drager toe te voegen, kan de hoeveelheid sjabloon die aan de buiswanden kleeft, verminderen, waardoor er meer beschikbaar komt voor amplificatie.

Wanneer u uw primers ontwerpt, controleert u ze op homodimeer- en heterodimeervorming met het Oligo Analyzer-programma op de IDT-website www.idtdna.com.

dmso kan tussen de 2-10% worden gebruikt, maar hoe hoger je gaat, hoe minder actief het polymerase wordt, dus het kan zijn dat je niet dezelfde hoeveelheid cycli krijgt. u kunt proberen op 2 en 5% om veilig te zijn.

100bp klinkt te groot voor primerdimeer - je oligo's zouden elk >50 basen moeten hebben om dat te krijgen - ziet eruit als een echt pcr-product. MgCl2-titratie kan helpen, evenals het proberen van verschillende Tms.

1) Probeer de DMSO tot 5%. Sommige polymerasen zijn oké met DMSO en andere niet. Je weet het nooit totdat je het probeert.

2) Probeer een tweestaps-PCR. Er is een paper in Biotechniques over een tweestaps PCR-reactie, maar ik heb de referentie niet bij me omdat ik thuis ben en het in het laboratorium is. Het is de moeite waard om op te zoeken. In principe heb je sjabloon plus voorwaartse primer in één buis en sjabloon plus omgekeerde primer in een andere buis en doe dan tussen de 1-15 PCR-rondes. Combineer vervolgens de inhoud van de twee buizen en doe uw normale 25 PCR-rondes. Soms kan de primer hierdoor effectief aan de sjabloon binden en kunt u enkele initiële transcripten krijgen die vervolgens aan elkaar binden wanneer u de inhoud van de twee buizen combineert.

3) Als je geen polymerase gebruikt voor een hoog GC-gehalte, koop er dan een. Het zal je een hoop gedoe besparen. Het zal uw probleem niet oplossen, maar het zal u helpen de zaken te verfijnen bij het oplossen van problemen. KOD XL-polymerase (novagen) is niet gevoelig voor DMSO tot 5% en het heeft me geholpen om al mijn mutanten te krijgen, maar niet zonder veel pogingen, alleen omdat het GC-gehalte van primer en sjabloon meer dan 60% was. Sommige mensen houden van de quik change-kit van stratagene, maar ik heb hem nooit werkend gekregen, wat erg duur is als het een kit is voor 30 rxn of iets dergelijks. Ieder zijn eigen.

4) Ik zou niet onder de 55 graden gaan voor een gloeitemperatuur. 50 is misschien goed, maar daaronder probeer je je geluk te beproeven met een temperatuur die hoog genoeg is om eventuele haarspeldstructuren op te lossen die veel voorkomen in primers met een hoog GC-gehalte, om nog maar te zwijgen van het mogelijk verminderen van de specificiteit van de bijpassende primer en sjabloon.

veel succes, er is veel probleemoplossing nodig en het is moeilijk om consistente resultaten te krijgen.

Het kan zo simpel zijn als het gebruik van een Hot-Start polymerase. Ik denk dat Vent voor een hogere betrouwbaarheid is, terwijl hot-starts helpen om onzuiverheden of niet-specifieke bindingen, dimeren, enz. Te verwijderen. We hadden dimeren in onze gels en schakelden over op een hot-start genaamd RepliTaq Thermal en het deed de truc .


Ahn Y, Park J, Lee CG, Kim JW, Jung SY (2010) Nieuw memetisch algoritme geïmplementeerd met GA (genetisch algoritme) en MADS (mesh adaptive direct search) voor een optimaal ontwerp van een elektromagnetisch systeem. IEEE Trans Magn 46 (6): 1982-1985

Andreson R, Mols T, Remm M (2008) Voorspelling van het faalpercentage van PCR in grote genomen. Nucleïnezuren Res 36(11):e66

Boehnke M, Arnheim N, Li H, Collins FS (1989) Genetische mapping van menselijke chromosomen met fijne structuur met behulp van de polymerasekettingreactie op één sperma: overwegingen bij experimenteel ontwerp. Ben J Hum Genet 45(1):21

Boutros R, Stokes N, Bekaert M, Teeling EC (2009) UniPrime2: een webservice die een eenvoudiger Universal Primer-ontwerp biedt. Nucleïnezuren Res 37 (probleem met webserver): 209-213

Boyle B, Dallaire N, MacKay J (2009) Evaluatie van de impact van enkelvoudige nucleotidepolymorfismen en primermismatches op kwantitatieve PCR. BMC Biotechnologie 9:75

Bryksin AV, Matsumura I (2010) Overlap-extensie PCR-klonering: een eenvoudige en betrouwbare manier om recombinante plasmiden te maken. Biotechnieken 48(6):463-465

Chang HW, Yang CH, Chang PL, Cheng YH, Chuang LY (2006) SNP-RFLPing: restrictie-enzymmijnbouw voor SNP's in genomen. BMC Genomics 7:30

Chang HW, Chuang LY, Cheng YH, Hung YC, Wen CH, Gu DL, Yang CH (2009) Prim-SNPing: een primerontwerper voor kosteneffectieve SNP-genotypering. Biotechnieken 46(6):421-431

Chang HW, Cheng YH, Chuang LY, Yang CH (2010) SNP-RFLPing 2: een bijgewerkte en geïntegreerde PCR-RFLP-databasetool voor SNP-genotypering. BMC Bioinformatica 11:173

Chuang LY, Cheng YH, Yang CH (2012) URPD: een specifiek hulpmiddel voor het ontwerpen van productprimers. BMC Res-opmerkingen 5(1):306

Ciornei I, Kyriakides E (2012) Hybride mierenkolonie-genetisch algoritme (GAAPI) voor wereldwijde continue optimalisatie. IEEE Trans Syst Man Cybern B Cybern 99:1-12

Croning MD, Fricker DG, Komiyama NH, Grant SG (2010) Geautomatiseerd ontwerp van genomische Southern-blot-probes. BMC Genomics 11:74

Dawkins R (2006) Het egoïstische gen. Oxford University Press, Cambridge

Duitama J, Kumar DM, Hemphill E, Khan M, Mandoiu II, Nelson CE (2009) PrimerHunter: een primerontwerptool voor PCR-gebaseerde identificatie van virussubtypes. Nucleïnezuren Res 37(8):2483-2492

Elnifro EM, Ashshi AM, Cooper RJ, Klapper PE (2000) Multiplex PCR: optimalisatie en toepassing in diagnostische virologie. Clin Microbiol Rev 13(4):559-570

Haas S, Vingron M, Poustka A, Wiemann S (1998) Primerontwerp voor grootschalige sequencing. Nucleïnezuren Res 26(12):3006-3012

Heidari-Bateni G, McGillem CD, Lcc A (1994) Een chaotisch communicatiesysteem met directe sequentie met gespreid spectrum. IEEE Trans Commun 42 (234 Deel 3): 1524-1527

Holland J (1992) Aanpassing in de natuur en kunstmatige systemen. MIT Press, Cambridge

Housley DJE, Zalewski ZA, Beckett SE, Venta PJ (2006) Ontwerpfactoren die het succes van PCR-amplificatie van primers tussen verschillende soorten onder 1147 zoogdierprimerparen beïnvloeden. BMC Genomics 7(1):253

Hsieh MH, Hsu WC, Chiu SK, Tzeng CM (2003) Een efficiënt algoritme voor minimale selectie van primersets. Bio-informatica 19(2):285-286

Kellert SH (1993) In de nasleep van chaos: onvoorspelbare orde in dynamische systemen. University of Chicago Press, Chicago

Kennedy J, Eberhart R (1995) Optimalisatie van de deeltjeszwerm. IEEE Int Conf Neural Netw 4:1942-1948

Kwok S, Mack DH, Mullis KB, Poiesz B, Ehrlich G, Blair D, Friedman-Kien A, Sninsky JJ (1987) Identificatie van menselijke immunodeficiëntievirussequenties door gebruik te maken van in vitro enzymatische amplificatie en detectie van oligomeersplitsing. J Virol 61 (5): 1690-1694

Mallona I, Weiss J, Egea-Cortines M (2011) pcrEfficiency: een webtool voor voorspelling van PCR-amplificatie-efficiëntie. BMC Bioinformatica 12:404

McPherson MJ, Hames BD, Taylor GR (1995) PCR 2: een praktische benadering. Oxford University Press, New York

Mei Y, Tang K, Yao X (2011) Op ontleding gebaseerd memetisch algoritme voor multiobjectief capacitated arc routing-probleem. IEEE Trans Evol Comput 15(2):151-165

Merz P, Freisleben B (1997) een genetische lokale zoekbenadering van het kwadratische toewijzingsprobleem. Paper gepresenteerd op de 7e internationale conferentie over genetische algoritmen

Modiri A, Kiasaleh K (2011) Efficiënt ontwerp van microstrip-antennes voor SDR-toepassingen met behulp van gemodificeerd PSO-algoritme. IEEE Trans Magn 47(5):1278-1281

Monoyios D, Vlachos K (2011) Multiobjectieve genetische algoritmen voor het oplossen van het probleem met bewuste routering en golflengtetoewijzing. IEEE/OSA J Opt Commun Netw 3(1):40–47

Moscato P (1989) Over evolutie, zoeken, optimalisatie, genetische algoritmen en vechtsporten: naar memetische algoritmen. techniek. Rep. Caltech Concurrent Computation Program, Rep. 826, California Inst. Technol., Pasadena

Oggioni MR, Meacci F, Carattoli A, Ciervo A, Orru G, Cassone A, Pozzi G (2002) Protocol voor realtime PCR-identificatie van miltvuursporen van neusuitstrijkjes na verrijking van de bouillon. J Clin Microbiol 40(11):3956-3963

Pessoa AM, Pereira S, Teixeira J (2010) PrimerIdent: een webgebaseerde tool voor geconserveerd primerontwerp. Bio-informatie 5(2):52–54

Piriyapongsa J, Ngamphiw C, Assawamakin A, Wangkumhang P, Suwannasri P, Ruangrit U, Agavatpanitch G, Tongsima S (2009) RExPrimer: een geïntegreerd hulpmiddel voor het ontwerpen van primers verhoogt de PCR-effectiviteit door het vermijden van 3 'SNP-in-primer en verkeerde priming van structurele variatie. BMC Genomics 10(Suppl 3):S4

Quill E (2008) Bloedafstemming wordt genetisch bepaald. Wetenschap 319(5869):1478-1479

Rozen S, Skaletsky H (2000) Primer3 op het WWW voor algemene gebruikers en voor bioloogprogrammeurs. Methoden Mol Biol 132(3):365–386

Saiki RK, Sharf SJ, Faloona F, Mullis KB, Horn GT, Erlich HA, Arnheim N (1985) Enzymatische amplificatie van b-globuline-genoomsequenties en restrictieplaatsanalyse voor de diagnose van sikkelcelanemie. Wetenschap 230(4732): 1350–1354

Sambrook J, Russell DW (2001) Moleculair klonen: een laboratoriumhandleiding. CSHL Press Cold Spring Harbor, New York

Sambrook J, Fritsch EF, Maniatis T (1989) Moleculaire klonering. Cold Spring Harbor-laboratoriumpers Cold Spring Harbor, NY

Shi Y, Eberhart RC, Team E, Kokomo IN (2001) Fuzzy adaptieve deeltjeszwermoptimalisatie. Proc IEEE Int Conf Evol Comput 1:101–106

Untergasser A, Nijveen H, Rao X, Bisseling T, Geurts R, Leunissen JA (2007) Primer3Plus, een verbeterde webinterface voor Primer3. Nucleïnezuren Res 35 (probleem met webserver): 71-74

Vallone PM, Butler JM (2004) AutoDimer: een screeningtool voor primer-dimeer- en haarspeldstructuren. Biotechnieken 37(2):226-231

Várallyay E, Burgya′n J, Havelda Z (2007) Detectie van microRNA's door Northern-blot-analyses met behulp van LNA-sondes. Methoden 43:140-145

Wallace RB, Shaffer J, Murphy RF, Bonner J, Hirose T, Itakura K (1979) Hybridisatie van synthetische oligodeoxyribonucleotiden met phi chi 174 DNA: het effect van een mismatch van een enkel basenpaar. Nucleïnezuren Res 6(11):3543-3557

Wang J, Li KB, Sung WK ​​(2004) G-PRIMER: hebzuchtig algoritme voor het selecteren van een minimale primerset. Bio-informatica 20(15):2473–2475

Wu JS, Lee C, Wu CC, Shiue YL (2004) Primer-ontwerp met behulp van genetisch algoritme. Bio-informatica 20(11):1710–1717

Yang CH, Cheng YH, Chang HW, Chuang LY (2009a) Fuzzy adaptieve deeltjeszwermoptimalisatie voor een specifiek primerontwerpprobleem. In: IEEE internationale conferentie over fuzzy systems, pp 1021-1026

Yang CH, Cheng YH, Chuang LY, Chang HW (2009b) Specifiek PCR-productprimerontwerp met behulp van memetisch algoritme. Biotechnol Prog 25(3):745–753

Yang CH, Cheng YH, Chang HW, Chuang LY (2010a) Primerontwerp met specifiek PCR-product met behulp van Particle Swarm Optimization. Int J Chem Biomol Eng 3(1):18–23

Yang CH, Cheng YH, Chuang LY (2010b) Een nieuwe chaotische traagheidsgewichtdeeltjeszwermoptimalisatie voor PCR-primerontwerp, internationale conferentie 2010 over technologieën en toepassingen van kunstmatige intelligentie (TAAI), pp 373-378

Yang CH, Cheng YH, Chuang LY, Chang HW (2010c) Confronterend twee-paar primerontwerp voor enzymvrije SNP-genotypering op basis van een genetisch algoritme. BMC Bioinformatica 11:509

Yang CH, Cheng YH, Yang CH, Chuang LY (2012) Mutageen primerontwerp voor mismatch PCR-RFLP SNP-genotypering met behulp van een genetisch algoritme. IEEE/ACM Trans Comput Biol Bioinform 9(3):837–845

Ye J, Coulouris G, Zaretskaya I, Cutcutache I, Rozen S, Madden T (2012) Primer-BLAST: een hulpmiddel om doelspecifieke primers voor polymerasekettingreactie te ontwerpen. BMC Bio-informatica 13(1):134

You FM, Huo N, Gu YQ, Luo MC, Ma Y, Hane D, Lazo GR, Dvorak J, Anderson OD (2008) BatchPrimer3: een webtoepassing met hoge doorvoer voor PCR en sequencing-primerontwerp. BMC Bioinformatica 9:253

Yuryev A, Huang J, Pohl M, Patch R, Watson F, Bell P, Donaldson M, Phillips MS, Boyce-Jacino MT (2002) Voorspelling van het succes van genotyperingstesten met primerverlenging met behulp van statistische modellering. Nucleïnezuren Res 30(23):e131


Bekijk de video: Bioinformatics lecture 17 primer dimer check bioinformatics practical (November 2021).