Informatie

Wat is de conventie voor het aanduiden van genomische primerplaatsen?


Wat is de meest gebruikelijke notatie voor het aangeven van genomische bindingsplaatsen van primers ten opzichte van een ORF?

Als ik bijvoorbeeld een primer als volgt wil aangeven:

... tccgccGCCCGTCCACACCCGCCGCCagctcaccATGGATGATGATATCGCCGCGCTCGT ... [ Primer ] [ Hs ACTB coderende sequentie ]

Moet de locatie van deze primer worden aangegeven als -8 of -28 (van ACTB startcodon) of iets anders?


Zo'n conventie is er niet. Mensen noemen hun primers meestal willekeurig (of alleen FP en RP) en vermelden in de tekst hun bindingsplaatsen.

In het algemeen worden in de context van specifieke genen de posities beschreven met betrekking tot de transcriptiestartplaats (TSS).


SARS-CoV-2-varianten efficiënt sequensen en identificeren

Virale surveillance kan onderzoekers essentiële informatie geven over de oorsprong van virussen, transmissieroutes, getroffen populaties en mutatie- en evolutiesnelheden. Dit kan worden gebruikt om diagnostische tests te ontwerpen en te evalueren om het aantal virusinfecties te volgen. Dit type genomische surveillance-informatie kan worden gegenereerd met behulp van next-generation sequencing (NGS). NGS-methoden omvatten sequencing van het hele genoom (WGS) en meer gerichte benaderingen om interessegebieden te verrijken via hybridisatie-opname of multiplex-PCR. NGS-methoden kunnen worden gebruikt voor op afvalwater gebaseerde epidemiologie, genomische epidemiologie en variantoproep naast virale surveillance.

Nieuwe SARS-CoV-2-varianten worden in een alarmerend tempo ontdekt. Als reactie daarop zijn NGS-workflows opgezet om nieuwe stammen te identificeren en te karakteriseren. Het ARTIC-netwerk, een samenwerkingsproject om de moleculaire epidemiologie vooruit te helpen, heeft een NGS-panel beschikbaar gesteld op basis van amplicon-sequencing, de ARTIC v3 Multiplex PCR Primer Assay. Amplicon-sequencing is een soort gerichte sequencing van de volgende generatie die PCR gebruikt om DNA-sequenties te creëren die amplicons worden genoemd. &ldquoHet ARTIC nCov-2019 amplicon-sequencingprotocol is wereldwijd algemeen toegepast, en de genoomgegevens zijn van cruciaal belang voor het begrijpen en volgen van de uitbraak,&rdquo, zegt dr. Josh Quick, een onderzoeker aan de Universiteit van Birmingham die een vroege gebruiker was van de ARTIC netwerk.

Een andere ampliconverrijkingstest, de Midnight Multiplex PCR Primer Assay, werd ontwikkeld door Drs. Nikki Freed en Olin Silander van Massey University in Nieuw-Zeeland. Het Midnight Panel genereert minder, maar veel langere, amplicons dan het ARTIC Panel, wat een meer gelijkmatige sequencingdekking mogelijk maakt. In combinatie met de IDT Lotus&trade DNA Library Prep Kit tonen interne benchmarkonderzoeken van zowel de ARTIC- als de Midnight Multiplex PCR Primer-assays volledige SARS-CoV-2-genoomdekking. Bovendien kunnen ze allebei worden gebruikt om het S-gen te sequensen, een vaak gemuteerd gen dat bijdraagt ​​aan de infectiviteit van SARS-CoV-2 en kan worden gebruikt als een indicator van virale evolutie. Bezoek onze website voor meer informatie over de ARTIC- en Midnight-protocollen.

Een zwak punt van deze multiplex-PCR-assays is dat mutaties in de sequenties van het virus die overeenkomen met PCR-primers uitval van virussequentiebepaling kunnen veroorzaken. Alle huidige SARS-CoV-2-stammen kunnen worden geïdentificeerd met behulp van de ARTIC-primersets, hoewel sommige sets hiaten in de sequentiedekking veroorzaken. Langere amplicongroottes gegenereerd door de Midnight-assay betekenen dat er minder primersets nodig zijn om het virale genoom te amplificeren, waardoor Midnight minder snel wordt verstoord door mutaties.

Het Swift Normalase&trade Amplicon Panel (SNAP) past ook ampliconsequencing toe op virale surveillance. De SNAP SARS-CoV-2 Multiplex Assay maakt gebruik van Swift's gepatenteerde multiplex PCR-technologie, waardoor bibliotheekconstructie van cDNA met overlappende primerparen mogelijk is om 99,7% van het SARS-CoV-2-genoom te targeten met een enkele pool van gemultiplexte primerparen. De SNAP-assay is geoptimaliseerd voor short-read sequencing, maar is ook compatibel met lage input en beschadigde monsters, inclusief afvalwater, en volledige S-gendekking is ook beschikbaar. Het SNAP-protocol duurt de helft van de tijd van de ARTIC- en Midnight-protocollen (3 uur versus 6+ uur) en wordt uitgevoerd in een enkele buis, waardoor overlappende amplicons ontstaan. Deze technologie resulteert in ingebouwde redundantie, die dekking kan bieden in het geval van mogelijke uitval van primers om een ​​hoog niveau van genomische dekking te behouden, waardoor het ontdekken van varianten mogelijk is. Adriana Heguy, PhD, van Langone Health aan de NYU Grossman School of Medicine, zei dat &ldquoSwift een gewaardeerde onderzoekspartner is geweest, en we kijken ernaar uit om met hen samen te werken om het vermogen van op amplicon gebaseerde methoden voortdurend te verbeteren om een ​​grotere dekking te bereiken in minder leest, wat ons in staat zou stellen een goede genoomdekking te bereiken voor monsters met een lage virale belasting. Bekijk onze webinar voor meer informatie over Swift's multiplex-PCR-technologie of de SNAP SARS-CoV-2-assay. Titel: Efficiënte en schaalbare amplicon-sequencing-oplossingen voor SARS-CoV-2-bewaking

RUO - Alleen voor onderzoeksdoeleinden. Niet voor gebruik bij diagnostische procedures. Tenzij schriftelijk anders is overeengekomen, is het niet de bedoeling van IDT dat deze producten worden gebruikt in klinische toepassingen en garandeert het niet hun geschiktheid of geschiktheid voor klinisch diagnostisch gebruik. De Koper is als enige verantwoordelijk voor alle beslissingen met betrekking tot het gebruik van deze producten en alle bijbehorende regelgevende of wettelijke verplichtingen.


Evaluatie en verbetering van SSU-rRNA PCR-primerdekking voor bacteriën, archaea en eukaryoten met behulp van metagenomen van Global Ocean Surveys

Kleine subeenheid ribosomaal RNA (SSU rRNA) amplicon-sequencing kan natuurlijke microbiomen kwantitatief en volledig profileren, wat een uiterst belangrijk hulpmiddel vormt voor het bestuderen van diverse wereldwijde ecosystemen. De resultaten zijn echter alleen nauwkeurig als PCR-primers perfect overeenkomen met het rRNA van alle aanwezige organismen. Om te evalueren hoe goed mariene micro-organismen in alle 3 de domeinen worden gedetecteerd door deze methode, vergeleken we veelgebruikte primers met > 300 miljoen rRNA-gensequenties die zijn opgehaald uit wereldwijd verspreide mariene metanomen. De best presterende primers in vergelijking met 16S rRNA van Bacteria en Archaea waren 515Y/926R en 515Y/806RB, die perfect overeenkwamen met meer dan 96% van alle sequenties. Gezien Cyanobacteria en Chloroplast 16S rRNA, had 515Y/926R de hoogste dekking (99%), waardoor deze set ideaal is voor het kwantificeren van mariene primaire producenten. Voor eukaryote 18S-rRNA-sequenties presteerde 515Y/926R ook het beste (88%), gevolgd door V4R/V4RB (18S-rRNA-specifiek 82%) - wat aantoont dat de 515Y/926R-combinatie het beste presteert voor alle 3 de domeinen. Met behulp van monsters uit de Atlantische en Stille Oceaan demonstreren we een hoge overeenkomst tussen 515Y/926R-amplicon-abundanties (gegenereerd voor deze studie) en metagenomisch 16S-rRNA (mediaan R 2 = 0,98, n = 272), wat aangeeft dat amplicons even nauwkeurige gemeenschapssamenstellingsgegevens kunnen produceren versus shotgun metagenomica. Onze analyse onthulde ook dat de verwachte prestaties van alle primersets kunnen worden verbeterd met kleine aanpassingen, wat wijst op een bijna volledig universele primerset die biogeochemisch belangrijke taxa nauwkeurig kan kwantificeren in ecosystemen variërend van de diepzee tot het oppervlak. Bovendien kan onze reproduceerbare bio-informatische workflow microbioomonderzoekers begeleiden die verschillende ecosystemen of de menselijke gezondheid bestuderen om op dezelfde manier bestaande primers te verbeteren en nauwkeurigere kwantitatieve amplicongegevens te genereren.

Betekenisverklaring PCR-amplificatie en sequentiebepaling van markergenen is een goedkope techniek voor het monitoren van prokaryote en eukaryote microbiële gemeenschappen in ruimte en tijd, maar zal alleen optimaal werken als omgevingsorganismen exact overeenkomen met PCR-primersequenties. In deze studie hebben we geëvalueerd hoe goed primers overeenkomen met wereldwijd gedistribueerde, kort gelezen oceanische metagenomen. Onze resultaten tonen aan dat primersets sterk variëren in prestaties, en dat, in ieder geval voor mariene systemen, rRNA-amplicongegevens van sommige primers significante vooroordelen missen in vergelijking met metanomen. We laten ook zien dat het mogelijk is om een ​​bijna universele primerset voor diverse zoute omgevingen te creëren door een specifiek mengsel van enkele tientallen oligonucleotiden te definiëren en een softwarepijplijn te presenteren die rationeel ontwerp van primers voor elke omgeving kan begeleiden met beschikbare meta'omische gegevens.


Genomics en Precision Oncology Learning Library

Ontdek wat u kunt leren in onze online leerbibliotheek over Precision Oncology. Verken bronnen die zijn samengesteld uit zowel ONS als externe inhoud, zoals oefentools, cursussen, casestudy's, webinars, podcasts, websites en meer.

De ONS Genomics Advisory Board nodigt u uit om uw verhalen, ideeën of behoeften te delen met betrekking tot de integratie van genomics in de kankerzorg. Dien uw vragen, opmerkingen en gedachten in voor overweging door de Genomics Advisory Board.

Meer informatie over de ONS Genomics-adviesraad

De ONS Genomics Advisory Board is in mei 2019 opgericht om de ontwikkeling van genomisch onderwijs en praktijkhulpmiddelen voor oncologieverpleegkundigen te begeleiden. De kankerzorg bevindt zich midden in een enorme paradigmaverschuiving. De beroepsbevolking in de kankerzorg, zowel nu als in de toekomst, is onvoldoende voorbereid op de snelle toepassing van genomische ontdekkingen en de veranderingen die nodig zijn in de kankerzorg. We willen ervoor zorgen dat de huidige en volgende generatie oncologieverpleegkundigen de wetenschap kennen, de nieuwste inzichten in de praktijk kunnen toepassen en deze informatie kunnen vertalen naar patiënten en families.

Leden van de Raad van Advies

Kathleen Calzone, PhD, RN, AGN-BC, FAAN
Patricia Friend PhD, APRN-CNS, AOCNS®, AGN-BC
Patricia A. Kelly, DNP, APRN, CNS, AGN-BC, AOCN®
Suzanne Mahon, RN, DNSc AOCN®, AGN-BC
Mary L. Schmitt, MS, APRN, FNP-BC, AOCNP®


Onderwerp Deskundige bijdragers

Julie Martin, DNP, AOCN®, FNP-BC
Kerensa Marty, RN MSN/Ed OCN
Jessica Pforr, MSN, NP-C, AOCNP®
Kathy Pratt, BSN, RN, OCN, CBCN, ONN-CG
Yvonne Ruddy-Stein APRN AGN-BC
Meaghan Ryan, MSN, FNP-BC

ONS zoekt verpleegkundigen met expertise in genomics! Solliciteer voor verschillende mogelijkheden om mee te doen, afhankelijk van expertise en beschikbaarheid.

Hulpmiddelen voor klinische praktijken – NIEUW

Middelen uit de klinische praktijk ondersteunen de integratie van het meest recente bewijs in de praktijk en helpen bij de vertaling van deze informatie naar patiënten en families.

Gebruik deze tool om het erfelijke kankerrisico met een patiënt te bespreken. Het biedt een lijst met rode vlaggen voor erfelijke risico's en helpt de patiënt te informeren over waarom hij mogelijk moet worden doorverwezen naar een geneticus.
Deze bron is ontwikkeld door ONS via een sponsoring van AstraZeneca.

Raadpleeg deze infographic om de rode vlaggen van erfelijk kankerrisico te herinneren en te bepalen wanneer een patiënt geschikt zou zijn om naar een geneticus te verwijzen. Het verzamelen van aanvullende informatie kan leiden tot meer geïndividualiseerde behandelingsopties voor de patiënt en cascadetests voor familie.
Deze bron is ontwikkeld door ONS via een sponsoring van AstraZeneca.

Het uitleggen van het complexe testproces voor biomarkers aan uw patiënten kan eenvoudig worden gemaakt door gebruik te maken van de discussietool voor biomarkertests in niet-kleincellige longkanker om dit gesprek met uw patiënten te begeleiden. Het biedt patiëntvriendelijke taal om het testen van biomarkers en het waarom, wanneer en hoe van het proces te beschrijven. Het geeft de patiënt de ruimte om aantekeningen te maken en de biomarkers van hun kanker vast te leggen. U kunt ook de gids voor begeleiders downloaden, waarin twee modellen worden beschreven die u kunt gebruiken bij het doornemen van de discussietool met een groep verpleegkundigen.
Deze bron is ontwikkeld door ONS via sponsoring van Amgen.

ONS-leerhulpmiddelen

Neem deel aan het geval van een jonge borstkankerpatiënt van Ashkenazi-joodse afkomst die thuis genetische tests heeft voltooid om haar erfelijke risico op kanker te informeren. Ontdek wat die test haar vertelde en de misvattingen die veel patiënten hebben over hun genetische testresultaten thuis.
Deze bron is ontwikkeld door ONS via een sponsoring van AstraZeneca.

Deze beknopte en uitgebreide referentiebladen voor genetische aandoeningen bevatten details over de aandoening, het risico op kanker, aanbevelingen voor zorg en verpleegkundige implicaties. CHEK2 en Lynch Syndrome zijn momenteel beschikbaar en om de maand worden er meer uitgebracht.

Genomische technologieën worden snel geïntegreerd in de kankerzorg. Genetische/genomische tests worden toegepast in het gehele kankerzorgcontinuüm voor risico-identificatie, risicovermindering en kankerpreventie, diagnose en behandeling. Oncologieverpleegkundigen moeten kennis hebben van de verschillende soorten technologieën/tests, inclusief wanneer en hoe ze worden gebruikt, zodat ze patiënten en families door het doolhof van precisie-oncologie kunnen navigeren.
Verdien 1 NCPD ILNA-categorieën: wetenschappelijke basis, professionele, ziektegerelateerde biologie en basisconcepten en indicaties voor transplantatie

Studenten zullen genomics in verschillende details vinden, afhankelijk van de cursus die ze volgen. Enkele voorbeelden zijn Kankerbiologie, ONS/ONCC Chemotherapie en Immunotherapie Certificaatcursus, Immunotherapie bij de behandeling van kanker, Een inleiding op de rol van het immuunsysteem en nog veel meer!

ONS-lid Celeste Adams, RN, BSN, MBA, verpleegkundig navigator bij Intermountain Healthcare in Salt Lake City, UT, en lid van het ONS Intermountain Chapter, en Kathleen Wiley, RN, MSN, AOCNS ® , directeur van de oncologische verpleegpraktijk bij ONS, bespreek hoe navigators voor verpleegkundigen patiënten en zorgverleners kunnen helpen de vooruitgang van het genoom te begrijpen, hoe iemands genen de preventie en behandeling van kanker beïnvloeden, en de impact die genomica-testen kunnen hebben op de kwaliteit van leven van een patiënt. (Podcast: 29 minuten)

Genomic "Glad You Asked"-videoserie

In een recent onderzoek vroegen we ONS-leden waar ze meer over wilden weten als het gaat om genomics. In deze korte video's beantwoorden leden van onze Genomics Advisory Board de vragen en onderwerpen die tijdens dat onderzoek naar voren zijn gekomen.

Wat is de rol van de KRAS-biomarker bij NSCLC?
Deze bron is ontwikkeld door ONS via sponsoring van Amgen.

Hoe praat ik met patiënten over genomics?
Deze bron is ontwikkeld door ONS via een sponsoring van AstraZeneca.

Hoe worden DNA-testtechnologieën gebruikt in de kankerzorg?
Deze bron is ontwikkeld door ONS via een sponsoring van AstraZeneca.

Wat zijn biomarkers?
Deze bron is ontwikkeld door ONS via een sponsoring van AstraZeneca.

ONS-artikelen

Clinical Journal of Oncology Nursing en Oncologie Verpleegkundig Forum

Bekijk de uitgebreide lijst met genomics-artikelen gepubliceerd in CJON en ONF. Twee onderscheidende en evidence-based publicaties.

ONS-stem Lidwoord

ONS-stem heeft meer dan 75 artikelen gepubliceerd over het onderwerp genomics in de kankerzorg. Bekijk de bibliotheek met artikelen. Uitgelichte artikelen en informatie:

Stem Artikel

Belangrijkste inhoud

“Genetica versus genomica: is er een verschil? Maakt het ook uit? Dat is er, en dat doet het. In ons tijdperk van precisiegeneeskunde, ook wel geïndividualiseerde of genomische geneeskunde genoemd, is het kunnen onderscheiden van de termen een eerste stap om een ​​fundamenteel begrip te krijgen van wat ze betekenen voor de kankerzorg, van preventie tot behandeling.
Volgens het National Human Genome Research Institute (NHGRI) is genetica de studie van individuele genen, terwijl genomica de studie is van het hele genoom, of alle genen van een organisme, interacties tussen genen en de rol van de omgeving bij het beïnvloeden ervan.

"Somatische Mutaties"
Somatische of verworven mutaties zijn de meest voorkomende oorzaak van kanker. Deze mutaties ontstaan ​​door schade aan genen in een individuele cel tijdens iemands leven. Kankers die optreden als gevolg van somatische mutaties worden sporadische kankers genoemd. Somatische mutaties worden niet in elke cel in het lichaam gevonden en worden niet van ouder op kind doorgegeven. Enkele veel voorkomende kankerverwekkende stoffen die deze mutaties veroorzaken, zijn tabaksgebruik, ultraviolette straling, virussen, blootstelling aan chemicaliën en veroudering.

"Kiembaan mutaties"
Kiembaanmutaties komen veel minder vaak voor. Een kiembaanmutatie treedt op in een zaadcel of een eicel en wordt bij de conceptie rechtstreeks van een ouder op een kind doorgegeven. Naarmate het embryo uitgroeit tot een baby, wordt de mutatie van de oorspronkelijke sperma- of eicel gekopieerd naar elke cel in het lichaam. Omdat de mutatie reproductieve cellen aantast, kan deze van generatie op generatie worden overgedragen.

"Wat is het verschil tussen de technieken?"
Zie DNA als letters van het alfabet. Letters zijn gerangschikt om woorden, zinnen, hoofdstukken en hele boeken te maken. Genen worden gedefinieerd als DNA dat functioneel actief is of dat codeert voor een eiwit, maar de meeste elementen van menselijk DNA worden als niet-coderend beschouwd. Niet-coderend DNA (geen gen) heeft nog steeds belangrijke regulerende functies en kan de expressie en regulatie van nabijgelegen genen beïnvloeden (coderend DNA). De technieken verschillen op basis van hoeveel DNA wordt gesequenced.
- Het hele boek: Sequenties elk van de ongeveer 3 miljard basenparen, inclusief alle niet-coderende regio's. Dit staat bekend als whole genome sequencing (WGS).
- Een paar zinnen in elk hoofdstuk: Bepaalt alleen de coderende gebieden van het genoom van een persoon (de exons). Dit staat bekend als whole-exome sequencing (WES) en vertegenwoordigt ongeveer 2% van het totale DNA van een persoon.
- Een alinea of ​​zelfs een enkele regel tekst: Dit staat bekend als gerichte DNA-sequencing en wordt gebruikt voor bekende pathogene varianten. Gerichte sequencing kan zoeken naar die varianten in een enkel gen (bijv. BRCA) of meerdere genen (gelijktijdig geanalyseerd met NGS), zoals met multi-genpanels.

Enkele hoogtepunten uit het genoomrapport zijn:

Het gemiddelde kankergenoom wordt aangedreven door vier of vijf kankerverwekkende mute.
- Ongeveer 13% van de kankergerelateerde mutaties werd gevonden in niet-coderend DNA, of delen van het genoom die geen eiwitten coderen.
- Veel kankerverwekkende mutaties treden jaren voorafgaand aan een kankerdiagnose op, wat aangeeft dat het nodig is om de inspanningen voor vroege opsporing en screening te vergroten.
- De mutaties werden gezien in bijna 100 verschillende moleculaire processen, allemaal met unieke mutatiesignaturen.
- Sommige handtekeningen werden in verband gebracht met bekende kankeroorzaken, waaronder afwijkend DNA-herstel en blootstelling aan kankerverwekkende stoffen zoals tabaksrook of UV-licht. Andere handtekeningen waren onverklaarbaar, wat suggereert dat er veel meer onderzoek moet worden gedaan.

Dit ONS Voice-artikel beschrijft hoe elke kankerdiagnose even geïndividualiseerd en uniek is als de persoon die hem ontvangt.

Onderwerpen zijn onder meer:
- testen in de praktijk begrijpen
- veelvoorkomende misvattingen
- soorten gerichte therapieën
- bronnen, waaronder online cursussen, handleidingen en gepubliceerde artikelen over gepersonaliseerde geneeskunde

ONS Genomics-taxonomie

De ONS Genomics-taxonomie is samengesteld uit 89 fundamentele genomische termen, onderverdeeld in zes groepen die gestandaardiseerde genomische taal bieden voor de oncologische verpleegpraktijk en het begrip bevorderen van genomische concepten die de stand van de wetenschap weerspiegelen.


Gen Gen Test Uno

A (een purine) bindt met T (een pyrimidine) door de vorming van twee waterstofbruggen.

G (een purine) bindt aan C (een pyrimidine) door de vorming van drie waterstofbruggen.

Hoe identificeert FISH de chromosomale locatie van een gen?
(Er wordt een korte DNA- of RNA-sonde ontworpen die complementair is aan het gen in kwestie. De sonde bevat een fluorescerend gelabeld label dat alleen helpt bij het identificeren van de genomische locatie die hybridiseert met de sonde.)

Welke van de volgende DNA-sondes zou je kunnen gebruiken om de genomische locatie van gen A bij muizen te detecteren? De gedeeltelijke sequentie van gen A wordt hieronder getoond. Selecteer alle antwoorden die van toepassing zijn.
5'. AGCTTGGGAGCGGCGGTGAGGCGGGAGGCGTCCTCTCTCCCCCAGGGCCCACCAGCTCTG. 3'
(5' TTGGGAGCGG 3'
3' AACCCTCGCC 5)

Hoewel de volgorde van slechts één streng wordt gegeven, is het gen in het genoom aanwezig als dubbelstrengs DNA. Daarom kan een probe worden gemaakt om met beide strengen te hybridiseren. De sonde moet complementair en antiparallel zijn.

Welke van de volgende DNA-sondes zou je kunnen gebruiken om de genomische locatie van gen A bij muizen te detecteren? De gedeeltelijke sequentie van gen A wordt hieronder getoond. Selecteer alle antwoorden die van toepassing zijn.
5'. AGCTTGGGAGCGGCGGTGAGGCGGGAGGCGTCCTCTCTCCCCCAGGGCCCACCAGCTCTG. 3'
(5' CCAGGGCCCA 3'
3' GGTCCCGGGT 5')


Bisulfietconversie

Natriumbisulfietconversie van genomisch DNA om ongemethyleerde versus gemethyleerde cytosines te differentiëren en te detecteren, is de gouden standaard voor DNA-methyleringsanalyse. Het biedt een kaart met een enkele nucleotideresolutie van 5-mC van het genoom (1). Bisulfietconversie omvat de deaminering van niet-gemodificeerde cytosines tot uracil, waarbij de gemodificeerde basen 5-mC en 5-hmC overblijven. Deze procedure kan vervolgens worden gevolgd door PCR-amplificatie of massaal parallelle sequentiemethoden om de methyleringsstatus van elk cytosine in genspecifieke amplificatie of amplificatie van het hele genoom te onthullen.

Behandeling van gedenatureerd DNA (d.w.z. enkelstrengs DNA) met natriumbisulfiet leidt tot deaminering van niet-gemethyleerde cytosineresiduen tot uracil, waarbij 5-mC of 5-hmC intact blijft. De uracils worden in de daaropvolgende PCR-reactie geamplificeerd als thymines, terwijl 5-mC- of 5-hmC-residuen als cytosines worden geamplificeerd. Vergelijking van sequentie-informatie tussen het referentiegenoom en met bisulfiet behandeld DNA kan informatie verschaffen over cytosinemethyleringspatronen. Andere toepassingen, zoals Methylation-Specific PCR (MSP), omvatten het analyseren van onbehandeld en met bisulfiet behandeld DNA met behulp van twee verschillende sets PCR-primerparen, één paar dat zich richt op de ongewijzigde, gemethyleerde sequentie en het andere dat zich richt op de geconverteerde niet-gemethyleerde sequentie.

Een nieuwe methode voor methyloomanalyse op enkelvoudig baseniveau, NEBNext® Enzymatic Methyl-seq (EM-seq&trade) (NEB #E7120), is nu beschikbaar. Deze op enzymen gebaseerde technologie minimaliseert schade aan DNA en produceert hoogwaardige bibliotheken die superieure detectie van 5mC en 5hmC mogelijk maken door minder sequentielezingen.

Kies Type:

Toekomstige artikelen

Brochures

Dit product valt onder een of meer patenten, handelsmerken en/of copyrights die eigendom zijn van of beheerd worden door New England Biolabs, Inc (NEB).

Hoewel NEB haar producten voor verschillende toepassingen ontwikkelt en valideert, kan het voor het gebruik van dit product van de koper zijn dat hij voor bepaalde toepassingen aanvullende intellectuele eigendomsrechten van derden moet verkrijgen.

Neem voor meer informatie over commerciële rechten contact op met het Global Business Development-team van NEB via [email protected]

Dit product is uitsluitend bedoeld voor onderzoeksdoeleinden. Dit product is niet bedoeld voor therapeutische of diagnostische doeleinden bij mensen of dieren.

Videos

Wat is epigenetica?

Als alle cellen zijn gemaakt van hetzelfde genetische materiaal, waarom zijn er dan zoveel verschillende celtypen? Luister naar Sriharsa Pradhan, Senior Scientist, RNA Biology bij NEB, terwijl hij beschrijft hoe DNA wordt gemethyleerd en hoe dit het pad van het lezen van de DNA-code beïnvloedt op dezelfde manier als een obstakel een trein van zijn spoor zou laten ontsporen.


GEBRUIKER ® Klonen

De gebruiksvriendelijke DNA-engineeringmethode maakt het mogelijk om meerdere PCR-fragmentassemblage, nucleotidesequentiewijziging en directioneel klonen te combineren. In deze benadering worden doel-DNA-moleculen en kloneringsvector gegenereerd door PCR met 6-10 basen van homologie tussen de naburige fragmenten. PCR-primers bevatten een enkele deoxyuracil-rest (dU) die het 3'-uiteinde van het homologiegebied flankeert en kunnen worden ontworpen om nucleotidesubstituties, -inserties en/of -deleties mogelijk te maken. De primers worden vervolgens gebruikt om de vector en het doelwit-DNA te amplificeren in discrete overlappende fragmenten die aan elk uiteinde een dU bevatten. De daaropvolgende behandeling van PCR-fragmenten met USER Enzyme creëert een enkele nucleotide-gap op elke locatie van dU, wat resulteert in PCR-fragmenten geflankeerd met enkelstrengs extensies die naadloze en directionele assemblage van aangepaste DNA-moleculen tot een gelineariseerde vector mogelijk maken. Op deze manier kunnen assemblages met meerdere fragmenten, evenals verschillende mutagene veranderingen, allemaal worden bereikt in een experiment met één formaat.

GEBRUIKER-workflow

Effect van PCR-productconcentratie op de kloneringsefficiëntie


Wat is de conventie voor het aanduiden van genomische primerplaatsen? - Biologie

1.a. De frequentie van het knippen in een willekeurige DNA-sequentie voor een bepaald restrictie-enzym is eenmaal per elke 4 n, waarbij n het aantal basen is in de herkenningssequentie van restrictie-enzymen. De 4 komt voort uit het feit dat er vier verschillende mogelijke nucleotiden zijn die op elke positie (G, A, T of C) kunnen worden ingevoegd.

Eco RI en hihi dIII hebben een herkenningsplaats met zes basen, dus ze zullen eens per 4 6 of 4096 basen snijden.

hihi dII heeft een herkenningsplaats met vijf basen, dus het zal eens per 4 5 of 1024 basen snijden.

Hpa II heeft een herkenningsplaats met vier basen, dus het zal eens per 4 4 of 256 basen snijden.

B. Om het aantal plaatsen te bepalen, deelt u het aantal basen in het DNA door de gemiddelde lengte van de restrictiefragmenten die het resultaat zijn van het gegeven enzym. De grootte van l is 48.502 basenparen, dus het aantal verwachte locaties is:

2a. Snijden met hihi dIII zal fragmenten van 1, 2 en 2,5 kilobasen opleveren. Snijden met Eco RI zal fragmenten van 1,5, 2 en 3,5 kilobasen opleveren. Snijden met beide hihi dIII en Pvu II zal fragmenten van 1, 1,5 en 2 kilobasen opleveren.

B. Het cDNA in pBR322 zal alleen bestaan ​​uit de twee exons, die aan de uiteinden worden geflankeerd door EcoRI. Wanneer geknipt door EcoRI, zal het cDNA 0,5, 1,5 en 2 kilobase fragmenten opleveren. Verteren met zowel EcoRI als HindIII zal fragmenten van 0,5, 1 en 1,5 kilobase opleveren.

C. De 1 kb radioactief gemerkte probe is van het tweede exon in het cDNA. Als het wordt gehybridiseerd met genomisch DNA dat is gedigereerd tot EcoRI, zal het hybridiseren met het 3,5 kilobase-fragment.

NS. De radioactief gemerkte probe die is afgeleid van het wildtype cDNA zal alleen in staat zijn te hybridiseren met het gedeelte van genomisch DNA dat het eerste exon bevat. Wanneer het genomische DNA wordt geknipt met HindIII, is dit fragment 2,5 kilobasen lang.

e. Omdat de lengte van de Pvu II-restrictiefragment in de mutant is hetzelfde als dat van het wildtype, er lijkt geen deletie tussen de twee te zijn PvuII plaatsen. De mutatie is dus niet dezelfde als die in onderdeel d. De mutatie hier is waarschijnlijk een puntmutatie.

B. Er is ten minste één intron, omdat het radioactief gemerkte cDNA niet hybridiseerde met de 1,5 en 0,5 fragmenten, maar wel met de flankerende fragmenten. Andere introns kunnen zich in de 2,5 en 4,5 fragmenten bevinden.

C. Twee methoden die kunnen worden gebruikt om cDNA's te labelen zijn primerverlenging en nick-translatie. Primer-extensie gebruikt een oligonucleotide-primer en Klenow-fragment om een ​​gelabelde DNA-streng te synthetiseren. Bij nick-translatie wordt een kleine hoeveelheid DNase gebruikt om inkepingen in het dDNA te maken. Gelabelde oligonucleotiden worden vervolgens toegevoegd met DNA-polymerase I om de inkepingen op te vullen.

4.a. De "kleverige uiteinden" die het gevolg zijn van vertering met de enzymen zijn hetzelfde, maar de feitelijke restrictieplaatsen zijn anders.

B. Nadat het plasmide is geïsoleerd, verteerd het met beide enzymen, zuivert u het fragment van 4,5 kb, ligeert u het fragment zelf en transformeert u het nieuwe plasmide in bacteriën.

C. Er zal geen .... zijn BamHI of BglII plaatsen.

NS. Je kunt na ligatie weer met beide enzymen knippen - dit zou ervoor zorgen dat alleen een plasmide zonder beide plaatsen de bacteriën zou transformeren.

5. Loop naar een kloon die het einde van een translocatie of deletie overlapt (dit zal verschil laten zien in Southern blots van organismen met en zonder de genetische afwijking). Gebruik een kloon van wildtype om een ​​junctiefragment op te pikken in de mutante stam. Gebruik dit fragment om een ​​kloon aan het andere uiteinde van de chromosomale afwijking op te halen uit een wilde bibliotheek.

6.a. Een restrictiekaart van het fragment wordt hieronder getoond:

B. Isoleer mRNA en genomisch DNA van een dier. Voer het mRNA uit op een gel en breng het over naar een blot (dit wordt Northern blotting genoemd). Gebruik primerverlenging of nick-translatie, label geïsoleerd genomisch DNA en gebruik het als een sonde om te hybridiseren met de blot. De sonde moet hybridiseren met het overeenkomstige mRNA en de locatie van de sonde op de blot zou u de grootte van het mRNA moeten vertellen.

C. Zie hierboven, het cDNA zal worden toegewezen aan gebieden die zijn aangewezen door |/////////|

7.a. Gebruik RNase (of base) om alleen DNA te isoleren. Gebruik DNAse om RNA te isoleren.

B. Gebruik een restrictie-enzym, laat de gel opnieuw lopen en tel de bandgroottes bij elkaar op als er meer dan één DNA is, ze moeten optellen tot meer dan de oorspronkelijke band.

C. Een methode om a . te isoleren D. melanogaster homoloog van het gen is het maken van een gelabelde probe van de gekloonde C.elegans gen en hybridiseren met een bibliotheek van D. melanogaster DNA. Een andere methode is om primers te maken van sequenties in het C. elegans-gen en deze te gebruiken om de homoloog uit D. melanogaster genomisch DNA.

NS. Voer het mRNA uit op een gel, breng het RNA over naar een blot en hybridiseer vervolgens de Northern-blot met een gelabelde sonde die op basis van het gen is gegenereerd.

e. Laat het wildtype nageslacht zichzelf paren. Als de mutatie onvolledige penetrantie vertoont, zou het wildtype nageslacht enig mutant nageslacht moeten opleveren.

8 . Omgekeerde transcriptie wordt gebruikt om cDNA van mRNA te maken en PCR wordt gebruikt om het te amplificeren.

9 . A. l) Bam hallo ii) hihi dIII iii) Eco RI (iv) hihi dIII en Eco Ri?

B. Alleen de 4 en 5 kb Bam HI-fragmenten (die de exons bevatten) zullen hybridiseren op de Northern-blots (tot een mRNA van 6 kb) en dit zal alleen in de leverbaan worden gevonden.

C. Alleen een band van 2 kb en 3 kb zal worden gevonden op de blot die het resultaat is van de DNA/RNA-hybridegebieden die niet werden verteerd door het S1-nuclease, dat enkelstrengs nucleïnezuren afbreekt.

NS. Door de aanvankelijke 6 kb . te elimineren hihidIII-regio zijn regulerende elementen die nodig zijn voor transcriptie weggelaten.

10. Niet waar, het tegenovergestelde is waar.

11. YAC's (kunstmatige gistchromosomen) bevatten ARS-elementen van gist (voor replicatie), telomeersegmenten en CEN-elementen (centromeersegmenten) ze kunnen enkele honderden Kb DNA bevatten. Cosmiden zijn gemodificeerde plasmiden met de cos (cohesieve uiteinden) van faag lambda en plasmidesequenties (voor replicatie en medicijnselectie) ze kunnen 20-40 Kb DNA bevatten.


De geavanceerde genomics-kern

missie is om onderzoek op de allernieuwste gebieden van genetica en genomica te vergemakkelijken door complexe technologieën te implementeren. De belangrijkste hiervan is 'next-generation' sequencing (NGS), die het afgelopen decennium een ​​revolutie teweeg heeft gebracht in het onderzoek op vrijwel alle biologische gebieden. Door NGS en begeleidende genomische technologieën in één faciliteit te huisvesten, bieden we gecentraliseerde expertise in geavanceerde methoden die alle onderzoekers in staat stelt deze effectief te benutten voor het doen van wetenschappelijke ontdekkingen.


Wat is de conventie voor het aanduiden van genomische primerplaatsen? - Biologie

Een geschiedenis van genoomsequencing:

De sequentiebepaling van het menselijk genoom samen met verwante organismen vertegenwoordigt een van de grootste wetenschappelijke inspanningen in de geschiedenis van de mensheid. De informatie die uit sequencing wordt verkregen, zal de ruwe gegevens opleveren voor het exploderende veld van de bio-informatica, waar informatica en biologie in symbiotische harmonie leven. De grootschalige sequencing die in 1990 door het Human Genome Project werd voorgesteld, had nooit een realiteit kunnen zijn zonder moderne computerfaciliteiten. Slechts twintig jaar geleden zouden computers machteloos zijn geweest in het licht van zo'n ontmoedigende hoeveelheid en reeks gegevens. Homologe identificatie en genoomkarakterisering tussen organismen die miljoenen nucleotiden vormen, was ondenkbaar tot de snelle vooruitgang van microchips en processors in de afgelopen twee decennia. Bovendien zou het eerste genoom van een levend organisme, Haemophilus influenzae, onmogelijk zijn geweest zonder de rekenmethoden die zijn ontwikkeld in de faciliteiten van het Instituut voor Genetisch Onderzoek (TIGR). While this is not technically an aspect of bioinformatics, this development would have been impossible with the computers of yesterday. The short history of genome sequencing began with Frederic Sanger's invention of sequencing almost twenty-five years ago.

The art of determining the sequence of DNA is known as Sanger sequencing after its brilliant pioneer. This technique involves the separation of flourescent labeled DNA fragments according to their length on a polyacrilimide gel (PAGE). The base at the end of each fragment can then be visualized and identified by the dye with which it reacts. The time and labor intensive nature of gel preparation and running, as well as the large amounts of sample required, increase the time and costs of genomic sequencing. These conditions drastically reduce the efficiency of sequencing projects ultimately limiting researchers in their sequencing attempts.

Bacteriophage fX174, was the first genome to be sequenced, a viral genome with only 5,368 base pairs (bp). Frederic Sanger, in another revolutionary discovery, invented the method of "shotgun" sequencing, a strategy based on the isolation of random pieces of DNA from the host genome to be used as primers for the PCR amplification of the entire genome. The amplified portions of DNA are then assembled by their overlapping regions to form contiguous transcripts (otherwise known as contigs). The final step involved the utilization of custom primers to elucidate the gaps between the contigs thus giving the completely sequenced genome. Sanger first used "shotgun" sequencing five years later to complete the bacteriophage l sequence that was significantly larger, 48,502 bp. This method allowed sequencing projects to proceed at a much faster rate thus expanding the scope of realistic sequencing venture. Since then a couple of other viral and organellar genomes have been sequenced using similar techniques such as the 229 kb genome of cytomegalovirus (CMV), the 192 kb genome of vaccinia, and the 187 kb mitochondrial and the 121 kb chloroplast genomes of Marchantia polymorpha , and the 186 kb genome of smallpox.

The success with viral genome sequencing stemmed from the relatively small length of their genetic codes. In 1989, Andre Goffeau set up a European consortium to sequence the genome of the budding yeast Saccharomyces cerevisiae (12.5 Mb). Goffeau's European collaboration involved 74 different laboratories drawn to the project in hopes of sequencing the homologs of their favorite genes. Most laboratories utilized Sanger's "shotgun" method of sequencing that had become the accepted standard for genome sequencing. S. Cerevisiae had a sequence approximately 60 times larger than any sequence previously attempted indicating why Goffeau felt compelled to invite the cooperation of a group of laboratories. At the time the sequencing of model organisms such as S. Cerevisiae appeared to be the logical step towards the eventual characterization of the human genome, a task that seemed beyond the scope of technology due to its tremendous size of 3,000 Mb. Sequencing smaller genomes would highlight the problems with sequencing techniques eventually refining the technology to be used on large-scale projects like H. Sapiens . In addition, valuable insight concerning these organisms would be gained with the elucidation of their genetic makeup.

The following year saw the initiation of a plethora of ambitious sequencing proposals the foremost being the introduction of the Human Genome Project in 1990. The U.S. Human Genome Project (HGP) is a joint effort of the Department of Energy and the National Institute of Health that was designed as a three-step program to produce genetic maps, physical maps, and finally the complete nucleotide sequence map of the human chromosomes. The first two aims of the project are practically fulfilled and now the majority of work is concentrated on the exact nucleotide sequence of the human. In the wake of this pronouncement came the start of three projects aimed at elucidating the sequences of smaller model organisms, similar to S. Cerevisiae in their academic utility, such as Escherichia. coli , Mycoplasma capricolum , and Caenorhabditis. elegans . It was hoped that these projects would increase the efficiency of sequencing but unfortunately they fell short of this task. Many anticipated that E. coli would be the first genome to be sequenced entirely but to the shock of the science community, an outsider won the race for the first complete genome sequence of a free living organism, Haemophilus influenzae .

A team headed by J. Craig Venter from the Institute for Genomic Research (TIGR) and Nobel laureate Hamilton Smith of Johns Hopkins University, sequenced the 1.8 Mb bacterium with new computational methods developed at TIGR's facility in Gaithersburg, Maryland. Previous sequencing projects had been limited by the lack of adequate computational approaches to assemble the large amount of random sequences produced by "shotgun" sequencing. In conventional sequencing, the genome is broken down laboriously into ordered, overlapping segments, each containing up to 40 Kb of DNA. These segments are "shotgunned" into smaller pieces and then sequenced to reconstruct the genome. Venter's team utilized a more comprehensive approach by "shotgunning" the entire 1.8 Mb H. Influenzae genome. Previously, such an approach would have failed because the software did not exist to assemble such a massive amount of information accurately. Software, developed by TIGR, called the TIGR Assembler was up to the task, reassembling the approximately 24,000 DNA fragments into the whole genome. After the H. Influenzae genome was "shotgunned" and the clones purified sufficiently the TIGR Assembler software required approximately 30 hours of central processing unit time on a SPARCenter 2000 containing half a gigabyte of RAM testifying to the enormous complexity of the computation.

Venter's H. Influenzae project had failed to win funding from the National Institute of Health indicating the serious doubts surrounding his ambitious proposal. It simply was not believed that such an approach could sequence the large 1.8 Mb sequence of the bacterium accurately. Venter proved everyone wrong and succeeded in sequencing the genome in 13 months at a cost of 50 cents per base which was half the cost and drastically faster than conventional sequencing. This new method of sequencing led to a multitude of completed sequences over the ensuing years by TIGR. Mycoplasma Genitalium , a bacterium that is associated with reproductive-tract infections and is renowned for having the shortest genome of all free-living organisms was sequenced by TIGR in a period of eight months between January and August of 1995 an extraordinary example of the efficiency of TIGR's new sequencing method. TIGR subsequently published the first genome sequence of a representative of the Archaea , Methanococcus jannaschii , the first genome sequence of a sulfur-metabolizing organism, Archaeoglobus fulgidus , the genome sequence of the pathogen involved in peptic ulcer disease, Helicobacter pylori , and the genome sequence of the Lyme disease spirochaete, Borrelia burgdorferi .

TIGR's dramatic leadership role in the field of genome sequencing was paralleled by the final completion of two of the largest genomic sequences , the bacterium E. Coli K-12 , and the yeast, S. Cerevisiae in 1997. These projects were the culmination of over seven years of intensive work. The yeast genome was the final result of a tremendous international collaboration of more than 600 scientists from over 100 laboratories representing the largest decentralised experiment in modern molecular biology. The final work represented efforts of scientist from Japan, Europe, Canada, and the United States producing the largest full length sequence (12 Mb) ever done. In an incredible display of organizational mastery only 3.4% of the total sequencing efforts were duplicated among laboratories. The E.Coli sequence was considerably smaller (4.6 Mb) but equally important in terms of experimental utility. E. Coli is the preferred model in biochemical genetics, molecular biology, and biotechnology and its genomic characterization will undoubtedly further research toward a more complete understanding of this important experimental, medical, and industrial organism.

At the close of 1997, we are halfway through the time allotted for completing the Human Genome Project projected to finish on September 30, 2005 approximately fifty years after the landmark paper of Watson and Crick. Currently major groups have sequenced approximately 50 Mb of human DNA representing less than 1.5% of the 3,000 Mb genome. The estimated finish of the human genome by the year 2,000 appears quite optimistic considering that the world's large-scale sequencing capacity is approximately 100 Mb per year. To complete the genome the average production must increase to 400 Mb per year. Several factors including the slow rate of Sanger sequencing and the high accuracy goal of the HGP which allows for one error in 10,000 bases limits the ability of researchers to proceed more quickly. Advancements in Sanger sequencing or possible replacements for this time intensive process will be necessary to ensure the HGP's goal of completion by the year 2005.

As of September of 1997, thirteen genome sequences of free-living organisms had been completed including the two largest, E. Coli and yeast, and eleven other microbial genomes under the length of 4.2 Mb. Four other large-scale projects are in progress including the sequencing of the Nematode, C. Elegans , which is 71% completed, the fruit fly, Drosophola Melanogaster which is 6% completed, the mouse which has less than 1% finished, and the human which is only 1.5% completed. These statistics are impressive considering that only four years ago no completed sequences existed.

The rapid proliferation of biological information in the form of genome sequences has been the major factor in the creation of the field of bioinformatics, that focuses on the acquisition, storage, access, analysis, modeling, and distribution of the many types of information embedded in DNA sequences. This field will be challenged by the heightening demands of increased information on the algorithms currently utilized for sequence manipulation. The growing sequence knowledge of the human genome has been likened to the establishment of the periodic table in the 19th century. Just as past chemists systematically organized all elements in an array that captured their differences and similarities, the Human Genome Project will allow modern scientists to construct a biological periodic table relating units of nucleotides. The periodic table will not contain 100 elements, but 100,000 genes reflecting not their similarity in electronic configuration but their evolutionary and functional relationship. Bioinformatics will be the tool of the modern scientist in interpreting this periodic table of biological information.

For any comments on the paper email the author: Edmund Pillsbury.
Cool Genome Sequencing Sites

To see the pioneers of genomic sequencing check out The Institute for Genomic Research
and their private affiliate Human Genome Sciences. Sequences for Haemophilus influenzae, Mycoplasma Genitalium, Methanococcus jannaschii, Archaeoglobus fulgidus , Helicobacter pylori , and Borrelia burgdorferi can be found at the TIGR site along with links to their papers.

Non-commercial sequencing projects exceeding 1Mb of production (listed from the largest to smallest):

Government sequence databases :

1) The National Center for Biotechnology Information (NCBI)---This is a great resource. . . includes GenBank the federal sequence repository where everyone submits sequences.
2) Genome Sequence Database (GSDB) at the National Center for Genome Resources (Sante Fe, New Mexico).
3) The Genome Data Base (GDB)---worldwide repository for mapping information.

Sequencing projects in progress:

List compiled by Edmund Pillsbury, any problems or questions please email.


Bekijk de video: VN conventies deel 1 (November 2021).