Informatie

MRNA-probleem met metaglobine bij muizen


Dit is een mRNA-streng van muismetaglobine:

5'-ccccagauacggaauucgaau-3'

A) Welk klein RNA (hieronder) reguleert de expressie van metaglobine het meest waarschijnlijk?

  1. 5'-auucgaauuuucuaucugggg-3'
  2. 5'-ggggucuuaucuuuuaagcuua-3'
  3. 5'-ccccagauacggaauucgaau-3'
  4. 5'-uaagcuuaaggcauagacccc-3'

B) Dit RNA hoogstwaarschijnlijk?

  1. werkt als een siRNA
  2. metaglobine-translatie remmen
  3. metaglobinevertaling verhogen
  4. helpen bij het transporteren van metaglobine-mRNA terug naar de kern

Mijn poging:

Ik denk dat A 2 is omdat de streng complementair is en mooi zal binden aan de mRNA-streng. Voor B zit ik tussen 2 en 3, maar kan niet beslissen.


Er zijn altijd uitzonderingen, maar u kunt enkele algemene regels overwegen.

A is 1 d.w.z. de sequentie die perfect complementair is (2 is complementair maar richting is parallel - kan geen basenpaar zijn), dan zou B 1 zijn (siRNA). Redenen (sommige zijn alleen gebaseerd op algemene regels van siRNA-ontwerp):

  • siRNA's moeten perfect complementair zijn
  • De maat is ook perfect voor een siRNA (21nt)
  • U/A (2-3 residuen) aan de 5' van het siRNA
  • U op de 10e positie
  • GC-gehalte 43% (ideaal 30-50%)

Zie hier voor richtlijnen voor siRNA-ontwerp.


Synthetisch chemisch gemodificeerd mRNA (modRNA): naar een nieuw technologieplatform voor cardiovasculaire biologie en geneeskunde

In de afgelopen twee decennia is een groot aantal nieuwe moleculaire routes ontdekt die de ontwikkeling en ziekte van het hart van zoogdieren leiden. Het vermogen om deze routes in vivo genetisch te manipuleren is grotendeels afhankelijk geweest van het genereren van genetisch gemanipuleerde muismodelsystemen of de overdracht van exogene genen in een verscheidenheid aan DNA-vectoren (plasmide, adenovirale, adeno-geassocieerde virussen, antisense-oligonucleotiden, enz.) . Onlangs is een nieuwe benadering gerapporteerd voor het manipuleren van het genprogramma van het volwassen zoogdierhart dat snel de zeer efficiënte expressie van vrijwel elk eiwit in het intacte hart van muizen, ratten, varkens, niet-menselijke primaten en menselijke hartcellen mogelijk zal maken via het genereren van chemisch gemodificeerd mRNA (modRNA). Het technologieplatform heeft belangrijke implicaties voor het afbakenen van de specifieke paracriene signalen die menselijke cardiogenese aansturen, en de routes die hartregeneratie kunnen veroorzaken via de snelle generatie van modRNA-bibliotheken van paracriene factoren voor directe in vivo toediening. Bovendien kan de strategie worden uitgebreid naar een verscheidenheid aan andere cardiovasculaire weefsels en vaste organen over meerdere soorten, en recente verbeteringen in de kerntechnologie hebben de overgang naar de eerste menselijke studies van modRNA in de komende 2 jaar ondersteund. Deze recente ontwikkelingen worden beoordeeld samen met projecties van de potentiële impact van de technologie op tal van andere biomedische problemen in het cardiovasculaire systeem.

Copyright © 2015 Cold Spring Harbor Laboratory Press alle rechten voorbehouden.

Figuren

Benaderingen om de moleculaire...

Benaderingen om de moleculaire routes van het menselijk hart in vivo te manipuleren. EEN…

Vasculaire endotheliale groeifactor (VEGF)…

Vasculaire endotheliale groeifactor (VEGF) modRNA stuurt zeer efficiënte expressie van uitgescheiden VEGF van ...

VEGFA modRNA stuurt een puls…

VEGFA-modRNA stuurt een expressiepuls van de paracriene factor in vivo, ...

( EEN ) Cardiaal mesodermaal...

( EEN ) Cardiale mesodermale voorlopers geven aanleiding tot twee verschillende subsets van...


Lane, C.D., Marbaix, G. & Gurdon, J.B. J. molec. Biol. 61, 73–91 (1971).

Hill, M. & Huppert, J. Biochim. biofysica. Acta 312, 26–35 (1970).

Furusawa, M., Nishimura, T., Yamaizumi, M. & Okada, Y. Natuur 249, 449–450 (1974).

Loyter, A., Zakai, N. & Kulka, R.G. J. Cell Biol. 66, 292–304 (1975).

Maeyer-Guignard, J., Maeyer, E. & Montagnier, L. Proc. nat. Acad. Wetenschap. VS. 69, 1203–1207 (1972).

Graesmann, A. Uitleg Cell Res. 60, 373–382 (1970).

Stacey, D.W. & Allfrey, V.G. Cel 9, 725–732 (1976).

Dimitriadis, G.J. FEBS Lett. 86, 289–293 (1978).

Dimitriadis, G.J. Nucleïnezuren Res. 5, 1381–1386 (1978).

Mayhew, E., Papahadjopoulos, D., O'Malley, J.A., Carter, W.A. & Vail, W.J. Molec. Apotheek 13, 488–495 (1977).

Papahadjopoulos, D., Vail, W.J., Jacobson, K. & Poste, G. Biochim. biofysica. Acta 394, 483–491 (1975).

Weismann, G. et al. Proc. nat. Acad. Wetenschap. VS. 72, 88–92 (1975).

Heywood, S.M. Proc. nat. Acad. Wetenschap. VS. 67, 1782–1788 (1970).

Prichard, P.M., Picciano, D.G., Laycock, D.G. & Anderson, W.F. Proc. nat. Acad. Wetenschap. VS. 68, 2752–2756 (1971).

Stavnezer, J. & Huang, R.C.C. Natuur nieuwe Biol. 230, 172 (1971).

Dimitriadis, G.J. & Georgatsos, J.G. FEBS Lett. 46, 96–100 (1974).

Dimitriadis, G.J. & Georgatsos, J.G. Nucleïnezuren Res. 2, 1719–1726 (1975).

Craig, R.K., Brown, P.A., Harrison, O.S., McIlreavy, D. & Campbell, P.N. Biochem. J. 160, 57–74 (1976).

Laemmli, VK Natuur 227, 680–685 (1970).

Harris, R. & Ukaejiofo, E.O. Br. J. Haemat. 18, 229–235 (1970).

Avramea, S. Immunochemie 6, 43–52 (1969).

Ternynck, T. & Avrameas, S. FEBS Lett. 23, 24–28 (1972).

Bonner, W.M. & Laskey, R.A. EUR. J. Biochem. 46, 83–88 (1974).


Resultaten

De antisense cDNA-expressievector verlaagde de globine-mRNA-niveaus in stabiele MEL-cellijnen

Drie stabiele MEL-cellijnen genaamd ES10, ES21 en ES22 werden vastgesteld met behulp van het miniconstruct HS2γβ. We observeerden constitutieve expressie voor de γ- en β-globinegenen in alle lijnen (Figuur 1, lanen 1 en 5), zoals aangetoond door RNase-beschermingsassays (RPA's). Initiële experimenten om β-globine-expressie te remmen werden uitgevoerd met twee antisense-oligodeoxynucleotiden (ODN's), één gericht op de cap-plaats van het β-globine-gen en een tweede naar de staart, in verschillende concentraties. Er was geen aantoonbaar effect op β-genexpressie (gegevens niet getoond). Vervolgens testten we de expressievector pZeoβAS, die een antisense -globine-cDNA-fragment bevat onder de controle van een SV40-promoter, op het vermogen om β-globine-expressie te remmen. Deze vector werd getransfecteerd in ES21-cellen om drie antisense-stabiele lijnen tot stand te brengen. Gezien het gebrek aan effectiviteit van de ODN's, hebben we ervoor gekozen om het β-globine-cDNA-fragment van volledige lengte te analyseren om maximale remmende effecten te verkrijgen, hoewel er 74% sequentiehomologie is tussen de γ- en β-genen. We observeerden een afname in mRNA-niveaus voor zowel β- als γ-globine op dag 14 (Figuur 1, lanen 2-4) en dag 28 (Figuur 1, lanen 6-8) voor alle drie de antisense-lijnen. Verscheidene andere stabiele controle-MEL-cellijnen werden geanalyseerd, waaronder BS211, BS212 en BS213, vastgesteld met een sense-georiënteerd -globine-cDNA-fragment in ES21-cellen, en de negatieve controlelijn pZeo, vastgesteld met de oorspronkelijke pZeoSV-expressievector. Er was geen significante verandering in het niveau van β- of γ-globine-mRNA voor de vier controlecellijnen (Figuur 1, lanen 9-13). Het niveau van RNA-transcriptie geproduceerd door de pZeoAAS-vector werd gemeten met behulp van een sense β-globine-probe door RPA op verschillende tijdstippen. Antisense -globinetranscripten werden gedetecteerd tot dag 42 (gegevens niet getoond), wat aangeeft dat de SV40-promotor op lange termijn antisense-RNA-transcripten bleef produceren om de onderdrukte globinegenexpressie te verklaren.

RNase-beschermingsgel voor de β-globine-stabiele MEL-cellijnen. RNA werd op dag 14 en dag 28 na transfecties uit cellen geïsoleerd. Totaal RNA (2 μg) werd gehybridiseerd met sondes die specifiek zijn voor muisactine (mActin), humaan β (hβ) en humaan γ (hγ) (zie Materialen en methoden). De autoradiografie toont het patroon voor hβ-, hγ- en mActin-genexpressie in de experimentele lijnen: ES21 (controle) en de drie antisense-stabiele cellijnen ASB211, ASB212 en ASB213 (lanen 1-8). Verschillende stabiele controlelijnen werden geanalyseerd, waaronder ES 10 (laan 9) vastgesteld met het HS2γβ-plasmide alleen of in combinatie met een sense-georiënteerd -globine-cDNA-fragment: BS211, BS212 en BS213 (lanen 10-12). Een negatieve controlelijn werd tot stand gebracht met het oorspronkelijke plasmide pZeo (laan 13). Lanen 14 en 15 bevatten positieve en negatieve (niet-getransfecteerde MEL-cellen) controles voor de gebruikte RNA-probes.

De mRNA-niveaus voor zowel β- als γ-globine in de drie antisense-lijnen werden berekend als een verhouding tegen actine van de muis, gecorrigeerd voor het aantal genkopieën. Voor de antisense-stabiele lijnen ASB211, ASB212 en ASB213 was het gemiddelde aantal kopieën respectievelijk 0,18, 0,15 en 0,15 en 0,20 voor de controle-ES21-lijn. De niveaus van β- en γ-globine-mRNA waren met gemiddeld 73,9% en 61,6% verlaagd (P < 0,05), respectievelijk (Tabel 1 en Figuur 2) in alle drie de antisense-lijnen op dag 14. Het relatieve niveau van β versus γ-globine-mRNA (β/γ-verhouding) nam af met 31,8%, wat aangeeft dat de reductie in -globine-mRNA-synthese groter was dan die voor γ-globine-mRNA (Tabel 2). Op dag 21 was de β/γ-verhouding 68,1%, wat aangeeft dat er van dag 14 tot 21 een snellere afname van de -globine-mRNA-productie was dan die van γ-globine-mRNA. Evenzo bleven op dag 28 en 35 zowel a- als p-globine-mRNA-niveaus laag, maar consequent werd de expressie van a-globine in sterkere mate geremd dan die van a-globine (tabellen 1 en 2). De reductie in a- en γ-globine-mRNA-productie door antisense-RNA-transcripten bereikte ongeveer gelijke niveaus van 77% remming op dag 42 in kweek (tabellen 1 en 2, figuur 2). Uit deze gegevens concludeerden we dat de antisense-vector zowel de genexpressie van γ- als -globine blokkeert, maar dat er een sneller effect was op het β-globine-gen.

Humaan globine-mRNA-niveaus in de β-globine antisense stabiele lijnen. Humaan (hβ), humaan γ (hγ) en muizenactine (mActin) globine-mRNA-niveaus werden geanalyseerd met RPA. De gemiddelde β- en γ-globine-mRNA-niveaus voor de drie antisense-lijnen ASB211, ASB212 en ASB213 worden weergegeven als een verhouding tot mActine gecorrigeerd voor het aantal genkopieën in vergelijking met de ES21-controlelijn (mRNA-niveau was genormaliseerd tot 100%). De waarden vertegenwoordigen drie tot vier onafhankelijke experimenten met de standaardfout van het gemiddelde dat wordt weergegeven voor dag 14 tot dag 42.

Verminderde β globineketenbiosynthese in antisense β globine MEL-cellijnen

Totaal eiwit werd op dag 14 geïsoleerd uit niet-getransfecteerde MEL-cellen en de stabiele ES21-, ASB211- en ASB213-lijnen. Het niveau van β- en γ-globineketenbiosynthese werd geanalyseerd door middel van high-performance vloeistofchromatografie (HPLC) die pieken vertoonde voor β- en γ-globineketens in de ES21-lijn in vergelijking met controle-MEL-cellen die niet waren getransfecteerd met het HS2γβ-plasmide (Figuur 3a, b) . Transfecties met de pZeoβAS-vector resulteerden in een afname van de -globinepiek en een toename van de γ-globinepiek (Figuur 3c). We hebben een afname van 80% en 73% waargenomen in de synthese van menselijke β-globineketens in respectievelijk de ASB211- en ASB213-lijnen (Figuur 4), maar de biosynthese van γ-globineketens nam toe met respectievelijk gemiddeld 233% en 802% in de twee antisense-lijnen. Ondanks verlaagde γ-mRNA-niveaus op dag 14, was de biosynthese van de γ-keten opmerkelijk verhoogd. Een mogelijk mechanisme voor deze waarneming is een verandering in de snelheid van translatie van -globine-mRNA als reactie op de snelle afname van β-globine-mRNA-niveaus op dag 14 in de antisense-lijnen.

HPLC-tracering voor - en γ-globineketensynthese. Totaal eiwit werd geïsoleerd op dag 14 en menselijke β (hβ) en γ (hγ) globineketens werden gekwantificeerd voor de ES21-controle (paneel b) en de ASB211-antisense-lijn (paneel c) vergeleken met niet-getransfecteerde controle-MEL-cellen (paneel a). Let op verminderde β-globineketens en verhoogde γ-globineketen-biosynthese in de ASB211 antisense-lijn (paneel c) Mα, muis α-globineketens mβ maj , muis grote globineketens.

Globineketensynthese in aanwezigheid van de pZeoβAS-expressievector. Totaal eiwit werd geïsoleerd op dag 14. Menselijke , en muis α (Mα) globineketens werden gekwantificeerd door HPLC-analyse. Er was een verminderde -globine (hβ)-keten en verhoogde -globine (hγ)-keten-biosynthese in de ASB211 en ASB213 MEL-cellijnen vastgesteld met de pZeoβAS-vector vergeleken met de niveaus van de γ- en β-globineketen in ES21. De biosynthese van de globineketen werd genormaliseerd tot 100% voor de ES21-controlelijn. De gegevens vertegenwoordigen de gemiddelde waarden voor twee onafhankelijke experimenten voor elke stabiele lijn.

Verlaagde globine-mRNA-niveaus in primaire erytroïde culturen

De antisense -globine-expressievector, pZeoβAS, werd getransfecteerd in mononucleaire cellen uit perifeer bloed, geïsoleerd uit normale en sikkelcelpatiënten. RPA werd uitgevoerd om de mRNA-niveaus voor de γ- en β-globinegenen te kwantificeren als een verhouding tot glyceraldehyde-3-fosfaatdehydrogenase (GAPD) na 21 dagen in kweek. We hebben een toename waargenomen in β- en γ-globine-baseline-mRNA's voor monsters verkregen van sikkelcelpatiënten in vergelijking met normale proefpersonen (Figuur 5a, lanen 1 en 3). Dit kan te wijten zijn aan de toename in beenmergactiviteit en een groter aantal vroege voorlopercellen in sikkelcelmonsters waargenomen door andere onderzoekers.21 Net als bij de antisense MEL-celstabiele lijnen, namen de globine-mRNA-niveaus af in erytroïde voorlopers die waren getransfecteerd met pZeoβAS (Figuur 5a, lanen 2 en 4). Vergeleken met controleculturen (erytroïde voorlopers getransfecteerd met het originele pZeoSV-plasmide), nam de productie van β- en γ-globine-mRNA met gemiddeld 83% en 67% af (P < 0,05), respectievelijk, voor zowel normale als sikkel-erytroïde voorlopers (Figuur 5b, c). Bovendien nam de β/γ-mRNA-verhouding af met 63% voor normale en 77% voor sikkelvoorlopers, wat aangeeft dat de reductie in -globine-mRNA-synthese significant groter was dan die van γ-globine, een resultaat dat vergelijkbaar is met dat waargenomen voor de stabiele MEL-cellijnen. . Bovendien remden normale β-globine-antisense-RNA-transcripten geproduceerd door pZeoβAS het mutante βs-globinegen in monsters verkregen van sikkelcelpatiënten.

Globine-mRNA-niveaus in primaire erytroïde culturen die zijn behandeld met antisense RNA-transcripten. Mononucleaire cellen van perifeer bloed werden getransfecteerd met de pZeoβAS- of pZeoSV-vectoren met behulp van een lipofectiebenadering. De pZeoSV-vector diende als een negatieve controle. NZ, normale voorlopers met pZeoSV NA, normale voorlopers met pZeoβAS SZ, sikkelvoorlopers met pZeoSV SA, sikkelvoorlopers met pZeoβAS. Een representatieve RPA-gel van een van de vier geteste monsters wordt weergegeven in paneel a. We observeerden een afname in β- en γ-globinesignaalintensiteit voor de normale en sikkelcelmonsters (lanen 2 en 4). De kwantitatieve fosforimager-gegevens worden getoond in panelen b en c. Zowel β (hβ) als γ (hγ) globine-mRNA-niveaus werden genormaliseerd tot 100% voor controle-experimenten met de pZeoSV-vector (NZ en SZ). Let op de meer significante afname van β-globine-mRNA-niveaus vergeleken met γ-globine voor zowel de normale als de sikkelcelmonsters.


Discussie

We hebben een Bayesiaanse methode ontwikkeld, DecontX genaamd, om het percentage kruisbesmetting binnen elke cel als gevolg van omgevings-RNA of andere experimentele factoren te schatten. In ons model wordt elke cel behandeld als een mengsel van multinomiale verdelingen over genen, een van de oorspronkelijke celpopulatie en een andere van besmetting. Voor elke celpopulatie wordt de besmettingsverdeling gedefinieerd als een combinatie van gentellingen van andere celpopulaties. Genen die meer tot expressie komen (d.w.z. meer UMI-tellingen hebben) in andere celpopulaties, zullen eerder bijdragen aan besmetting in de huidige celpopulatie. Daarom zullen deze genen relatief hogere kansen hebben in de besmettingsdistributie in vergelijking met de expressiedistributie in de natieve celpopulatie en tellingen voor deze genen zullen waarschijnlijker "besmetting" worden genoemd. Bepaalde soorten huishoudgenen, zoals genen die coderen voor ribosomaal eiwit, kunnen in veel celpopulaties sterk tot expressie worden gebracht en zullen dus een hoge waarschijnlijkheid hebben in zowel de inheemse celpopulaties als de besmettingsdistributies. In dit geval zullen tellingen voor deze genen voornamelijk "native" worden genoemd, ervan uitgaande dat het totale aandeel van de geschatte besmetting in die cel ook relatief laag is. We hebben de nauwkeurigheid van DecontX aangetoond door te laten zien dat het in staat was om het percentage exogene, verontreinigende transcripten in een gegevensset van een mengsel van muizen en mensen nauwkeurig te schatten. Bovendien, na het schatten en verwijderen van besmette transcripten in 4K PBMC-gegevens, leken de profielen van de belangrijkste markergenen voor elke subpopulatie beter op die van gesorteerde, gezuiverde PBMC's.

We hebben waargenomen dat celtypen met een hogere totale hoeveelheid mRNA en een hogere prevalentie binnen de dataset meer kans hebben om bij te dragen aan de besmetting in andere celtypen. In de dataset van het mengsel van mens en muis hadden de menselijke cellen bijvoorbeeld gemiddeld meer uniek uitgelijnde UMI's dan muiscellen. Daarom droegen de menselijke cellen meer metingen bij aan het omgevings-RNA en resulteerden ze in meer besmetting in muizencellen. In de 4K PBMC-gegevens waren de monocyten het op één na meest voorkomende celtype en hadden ze gemiddeld het hoogste totale aantal UMI-tellingen. Bovendien waren monocyt-geassocieerde genen zoals LYZ, S100A8 en S100A9 de meest tot expressie gebrachte celtype-specifieke markergenen en droegen dus meer bij aan de besmetting in andere celtypen in vergelijking met markers van andere populaties. Deze resultaten tonen aan dat de besmettingsverdelingen in elke cel afhankelijk zullen zijn van de andere celtypes in de test, evenals van het expressieniveau van specifieke genen in die celtypes.

In sommige gevallen was DecontX niet in staat om afwijkende expressie van celtypemarkers volledig te verwijderen. 43,03% van de NK-cellen in de 4K PBMC vertoonde bijvoorbeeld nog steeds expressie van T-celmarkers. Een mogelijke verklaring is dat sommige cellen in deze dataset eigenlijk NKT-cellen waren en echt expressiekenmerken delen van zowel NK- als T-celpopulaties [19]. Een andere factor is dat voor celpopulaties die substantiële overeenkomsten vertonen in genexpressiepatronen, DecontX de neiging zal hebben om conservatief te zijn en de meerderheid van deze tellingen als natieve expressie in plaats van contaminatie te behandelen. Over het algemeen zijn we van mening dat dit gedrag gewenst is, zodat echte biologische variatie tussen celtypen niet wordt verwijderd. De cellen die naar schatting sterk vervuild waren door DecontX in 4K PBMC, werden ook geschat op doubletten door onafhankelijke algoritmen. Daarom kunnen hoge contaminatieniveaus ook nuttig zijn als kwaliteitscontrolecriterium voor het uitsluiten van cellen. Bovendien laat de DecontX-schatting op benchmarkgegevenssets zien dat 10X Chromium de laagste vervuiling heeft, terwijl CEL-seq2 de hoogste vervuiling heeft. CEL-seq2 heeft veel hogere frequenties van intronische en intergene mappings laten zien in vergelijking met andere scRNA-seq-methoden [20]. Hoewel het SORT-seq-protocol vergelijkbaar is met CEL-seq2, gebruikte het damplekolie om verdamping te voorkomen [7], wat resulteerde in minder geschatte verontreinigingen in onze analyse.

Door ruwe tellingen te gebruiken voor het schatten van de multinomiale verdelingen, elimineert DecontX de potentiële variabiliteit die zou kunnen worden geïntroduceerd door verschillende normalisatiemethoden. Een beperking is dat celclusterlabels a priori nodig zijn. Hoewel we Celda automatisch gebruiken om celclusters te identificeren als er geen zijn, kan elke snelle celclusteringsbenadering worden gebruikt. Omdat de besmettingsdistributie voor elke celpopulatie is afgeleid van alle andere populaties die aanwezig zijn in de dataset, kan het soms beter zijn om bredere celpopulatielabels te gebruiken. Als u bijvoorbeeld alle T-cellen in één cluster opneemt in plaats van individuele T-celsubpopulaties als een afzonderlijke subcluster te behandelen, kan dit helpen bij het verminderen van T-celspecifieke tellingen bij de berekening van de besmettingsverdelingen voor alle T-cellen.


Gedetailleerde beschrijving

Ai140D-muizen herbergen het voorwaardelijke allel TIGRE-Ins-TRE2-LSL-EGFP-Ins-CAG-LSL-tTA2, ontworpen met een TRE2-promotor, loxP-geflankeerde STOP-cassette en EGFP-sequentie, en vervolgens een CAG-promotor, lox2272-geflankeerde STOP-cassette en tTA2-sequentie. Voorafgaand aan blootstelling aan Cre-recombinase, is dit allel ontworpen om de twee floxed-STOP-cassettes te hebben die expressie van de stroomafwaartse genen (EGFP en tTA2) voorkomen. Wanneer gefokt met muizen die Cre-recombinase tot expressie brengen, zullen bij de resulterende nakomelingen beide floxed-STOP-cassettes worden verwijderd in de cre- tot expressie brengende cellen/weefsels - resulterend in EGFP-fluorescentie en ttA2-expressie. Vanwege de plaatsing stroomafwaarts van de TRE2-promotor, zal de daaropvolgende introductie van tetracycline (of zijn analoge doxycycline [dox]) de EGFP-expressie verminderen / elimineren.

Specifiek, de donerende onderzoeker rapporteert in afwezigheid van Cre, muizen die heterozygoot zijn voor Ai140D vertonen geen fluorescentie, en zijn levensvatbaar en vruchtbaar zonder gerapporteerde grove fysieke of gedragsafwijkingen. Anti-GFP-immunokleuring onthult enige achtergrondexpressie in de cortex en hippocampus, maar dit is een aantal keer minder dan de niveaus die werden waargenomen na blootstelling aan Cre-recombinase. Sinds september 2018 is het de ervaring van The Jackson Laboratory dat homozygote muizen levensvatbaar en vruchtbaar zijn.
Wanneer Ai140D-muizen worden gefokt met Cre-driver-lijnen om dubbele transgene dieren (EGFP+tTA2+/Cre+) te creëren, vertonen cellen die zowel tTA2 als Cre tot expressie brengen robuuste/heldere EGFP-fluorescentie. De dox-induceerbare verzwakking van EGFP-expressie is gekarakteriseerd - EGFP-fluorescentie is volledig onderdrukt na twee weken dox-behandeling.
Er zijn verschillende Cre-driver-lijnen met specifieke expressiepatronen gebruikt met Ai140D - resulterend in dubbel gemuteerde nakomelingen zonder levensvatbaarheidsproblemen (inclusief C57BL/6J-congene Etv1-CreERT2 en Sst-IRES-Cre (zie voorraadnummers 013048 en 013044). Dubbel heterozygote Emx1-IRES-CreAi140D-muizen hebben echter een verminderd hersenvolume en uitgesproken neurodegeneratie in alle subvelden van de hippocampus (zie voorraadnr. 005628). Bovendien is hun ervaring dat dubbel heterozygote Gad2-CreAi140D-muizen embryonale letaliteit vertoonden (zie voorraadnr. 019022). ) - dit is vergelijkbaar met hun bevinding van dubbele heterozygote letaliteit met dezelfde Gad2-Cre-driver met het Ai139D- of Ai148D-allel (voorraadnummers 030219 of 030328).

Tot op heden (maart 2017) heeft de donerende onderzoeker de Cre-induceerbare Ai140D-expressie in andere weefsels dan de hersenen niet geëvalueerd.


FDA keurt eerste test van CRISPR goed om genetisch defect dat sikkelcelziekte veroorzaakt te corrigeren

In 2014, twee jaar na haar Nobelprijswinnende uitvinding van CRISPR-Cas9-genoombewerking, dacht Jennifer Doudna dat de technologie volwassen genoeg was om een ​​remedie te bieden voor een verwoestende erfelijke aandoening, sikkelcelziekte, die miljoenen mensen over de hele wereld treft. de meeste van hen van Afrikaanse afkomst. Ongeveer 100.000 zwarte mensen in de VS zijn getroffen door de ziekte.

Door collega's te mobiliseren in het toen nieuwe Innovative Genome Institute (IGI) - een gezamenlijke onderzoekssamenwerking tussen de University of California, Berkeley en UC San Francisco - probeerden ze de enkele mutatie te repareren die ervoor zorgt dat rode bloedcellen kromtrekken en slagaders verstoppen, wat ondraaglijke pijn veroorzaakt. pijn en vaak de dood. Beschikbare behandelingen omvatten tegenwoordig meestal regelmatige transfusies, hoewel beenmergtransplantaties degenen kunnen genezen die een gematchte donor kunnen vinden.

Na zes jaar werk is die experimentele behandeling nu goedgekeurd voor klinische proeven door de Amerikaanse Food and Drug Administration, waardoor de eerste tests bij mensen van een op CRISPR gebaseerde therapie mogelijk zijn om de mutatie in het bètaglobine-gen dat verantwoordelijk is voor sikkel cel ziekte. Bètaglobine is een van de eiwitten in het hemoglobinecomplex die verantwoordelijk zijn voor het transport van zuurstof door het lichaam.

De proeven, die naar verwachting vier jaar zullen duren, zullen worden geleid door artsen van het UCSF Benioff Children's Hospital Oakland en het Broad Stem Cell Research Center van de UCLA, die van plan zijn deze zomer te beginnen met het inschrijven van zes volwassenen en drie adolescenten met ernstige sikkelcelziekte.

Het laboratorium voor klinische diagnostiek van de IGI, dat onder Doudna's leiding werd gebouwd om de Berkeley-gemeenschap gratis COVID-19-tests te bieden, zal een sleutelrol spelen bij de analytische ondersteuning van het onderzoek door diagnostiek te ontwikkelen om het welzijn van de patiënt te bewaken en de efficiëntie van het onderzoek te volgen. behandeling.

"We zijn gemotiveerd om te werken aan een remedie die toegankelijk en betaalbaar kan zijn voor patiënten over de hele wereld", zegt Doudna, hoogleraar moleculaire en celbiologie en scheikunde aan UC Berkeley en onderzoeker van het Howard Hughes Medical Institute. "De lancering van deze proef is een essentiële eerste stap op dat pad."

Dr. Mark Walters, hoogleraar kindergeneeskunde aan de UCSF en de Jordan Family Director van het Blood and Marrow Transplantation Program van het UCSF Benioff Children's Hospital Oakland, leidt de klinische proef. (Foto met dank aan UCSF)

Andere proeven hebben met succes CRISPR-Cas9 gebruikt om een ​​gen uit te schakelen dat het foetale hemoglobinegen onderdrukt, dat normaal gesproken bij mensen is uitgeschakeld. Die techniek wekt het foetale gen weer op en heeft bij ten minste drie patiënten de symptomen van sikkelcelziekte verlicht.

De nieuwe proef is een gen-knock-in: de onderzoekers gebruiken CRISPR-Cas9 om het defecte bètaglobine-gen te vervangen door een gerepareerde versie, met als doel normale, volwassen rode bloedcellen te creëren en de aandoening te genezen.

"Deze therapie heeft het potentieel om de zorg voor sikkelcelziekte te transformeren door een toegankelijke, curatieve behandeling te produceren die veiliger is dan de huidige therapie van stamceltransplantatie van een beenmergdonor", zegt Dr. Mark Walters, hoogleraar kindergeneeskunde aan UCSF en hoofdonderzoeker van de klinische proef en het genbewerkingsproject. "Als dit met succes wordt toegepast bij jonge patiënten, heeft het de potentie om onomkeerbare complicaties van de ziekte te voorkomen."

Een ander klinisch onderzoek waarbij CRISPR ook wordt gebruikt om de sikkelcelmutatie direct te corrigeren, maar met een iets andere benadering, is gepland om dit jaar te beginnen, uitgevoerd door Graphite Bio op basis van onderzoek uit het Matthew Porteus'8217-lab aan de Stanford University.

Patiënten zijn hun eigen stamceldonor

De techniek vereist, net als bij de alternatieve benadering die foetale hemoglobine weer wakker maakt, dat sommige van de hematopoëtische stamcellen van de patiënt - de beenmergcellen die alle rode bloedcellen van het lichaam genereren - worden geoogst voor het bewerken van genen buiten het lichaam. Nadat deze cellen zijn verwijderd, wordt het resterende beenmerg vernietigd met chemotherapie om ruimte te geven voor de herstelde en opnieuw geïnfundeerde stamcellen om te groeien.

Dr. Donald Kohn, een vooraanstaand professor in microbiologie, immunologie en moleculaire genetica, kindergeneeskunde en moleculaire en medische farmacologie aan de David Geffen School of Medicine aan de UCLA en lid van het UCLA Broad Stem Cell Research Center, is betrokken bij verschillende gentherapieproeven voor ziekten zoals SCID en sikkelcelziekte. (Foto met dank aan UCLA)

Walters, die ook de Jordan Family Director is van het Blood and Marrow Transplantation Program bij het UCSF Benioff Children's Hospital Oakland, zal samenwerken met UCLA-arts-wetenschapper Dr. Donald Kohn, die gentherapieën heeft ontwikkeld voor verschillende genetische bloedaandoeningen, waaronder een remedie voor een vorm van ernstige gecombineerde immunodeficiëntie (SCID). Kohn leidt ook een klinische proef van een ander type gentherapie voor sikkelcelziekte, waarbij een nieuw gen aan de stamcellen van patiënten wordt toegevoegd om de sikkelcelmutatie te overwinnen.

"Gentherapie en genbewerking stellen elke patiënt in staat om als hun eigen stamceldonor te dienen", zegt Kohn, een vooraanstaand hoogleraar microbiologie, immunologie en moleculaire genetica, kindergeneeskunde en moleculaire en medische farmacologie aan de David Geffen School of Medicine aan de UCLA en een lid van het UCLA Broad Stem Cell Research Center. "In theorie zouden deze benaderingen veel veiliger moeten zijn dan een transplantatie van een andere persoon en zouden ze universeel beschikbaar kunnen worden omdat ze de noodzaak elimineren om de naald in een hooiberg te vinden die een gematchte stamceldonor is."

Kohn zal de laboratorium- en klinische proefactiviteiten aan de UCLA leiden en toezicht houden op alle productie van het geneesmiddel, CRISPR_SCD001 genaamd, voor de klinische proef. Het preklinische werk om deze therapie te ontwikkelen werd gefinancierd door het California Institute for Regenerative Medicine, het door het National Heart, Lung, and Blood Institute geleide Cure Sickle Cell Initiative en de Doris Duke Charitable Foundation.

Fyodor Urnov, IGI-directeur technologie en vertaling en een UC Berkeley-hoogleraar moleculaire en celbiologie, zal toezicht houden op de bio-informatica en genomica-activiteiten voor het onderzoek.

"Het is opmerkelijk dat deze nieuwe proef afkomstig is van een consortium van academische instellingen zonder winstoogmerk die worden gestimuleerd met een langetermijnvisie om de ziekte te genezen met een betaalbare oplossing die wereldwijd ten goede kan komen aan iedereen die het nodig heeft", zei Urnov.

Fyodor Urnov, IGI-directeur technologie en vertaling, zal toezicht houden op de bio-informatica en genomica-activiteiten voor de klinische proef. (Foto door Keegan Houser)

Sikkelcelziekte wordt veroorzaakt door een enkele verandering in de DNA-code van het bètaglobinegen. De nieuwe proef maakt gebruik van de CRISPR-Cas9-nuclease - een volledig geassembleerd Cas9-eiwit en begeleidende RNA-sequentie die zich richt op het defecte gebied van het bètaglobine-gen, vergezeld van een kort DNA-segment dat codeert voor de juiste sequentie - om reparatie van de sikkelmutatie te stimuleren door vervanging het normale DNA-segment voor het abnormale. Bij deze benadering worden de bloedstamcellen van de patiënt eerst behandeld met elektrische pulsen die poriën in hun membranen creëren. Door deze poriën kan het CRISPR-Cas9-platform de stamcellen binnendringen en naar hun kernen reizen om de sikkelcelmutatie te corrigeren.

"Het doel van deze vorm van genoombewerkingstherapie is om de mutatie in voldoende stamcellen te corrigeren, zodat het resulterende bloed in de circulatie de rode bloedcellen heeft gecorrigeerd," zei Walters. "Op basis van onze ervaring met beenmergtransplantaties, voorspellen we dat het corrigeren van 20% van de genen voldoende zou moeten zijn om de inheemse sikkelcellen te overtreffen en een sterk klinisch voordeel te hebben."

Het definitieve fabricageprotocol maakt gebruik van een virusvrije methode om bloedstamcellen te bewerken en is gevalideerd in preklinische veiligheids-/toxicologische onderzoeken die zijn uitgevoerd na overleg met de FDA.

Toekomstige CRISPR-therapieën

Terwijl UC-artsen de huidige CRISPR-therapie in klinische onderzoeken gebruiken, werken IGI-wetenschappers aan het verbeteren van de techniek, zodat uiteindelijk de correctie van de sikkelcelmutatie in het lichaam kan worden gedaan, zonder stamcellen te verwijderen of het beenmerg te vernietigen. Omdat het beenmerg ook witte bloedcellen produceert die ons beschermen tegen ziekten, dempt het vernietigen ervan het immuunsysteem en geeft patiënten een verhoogd risico op infectie of zelfs kanker totdat de geïnfuseerde, gecorrigeerde stamcellen zich kunnen vermenigvuldigen en aanvullen.

Sikkelcelziekte wordt veroorzaakt door een mutatie in het bètaglobine-gen waardoor rode bloedcellen in een sikkelvorm (voorgrond) vervormen in vergelijking met de normale cirkelvorm op de achtergrond. De sikkelcellen verstoppen de slagaders, wat leidt tot hevige pijn en orgaanschade. (Afbeelding met dank aan Innovative Genomics Institute, UC Berkeley)

"Momenteel doen we ex vivo therapie, waarbij je cellen uit het beenmerg haalt om de mutatie buiten het lichaam te corrigeren," zei Ross Wilson, IGI's directeur therapeutische toediening. 'Maar gedurende deze tijd - het kan maanden zijn - vult het beenmerg zich weer. Dientengevolge, wanneer het tijd is om de gecorrigeerde cellen te infuseren, moet de patiënt worden onderworpen aan agressieve chemotherapie die het beenmerg opruimt en die gecorrigeerde cellen in staat stelt een thuis te vinden.”

Wilson is optimistisch dat hij en IGI-wetenschappers een manier kunnen vinden om de CRISPR-therapie rechtstreeks naar het beenmerg in het lichaam te sturen, met behulp van antilichamen om het CRISPR-enzym op de juiste stamcellen te richten. Andere wetenschappers, die gemanipuleerde virussen of vetdruppels - lipidenanodeeltjes - gebruiken om het CRISPR-enzym in het lichaam te brengen, hebben tot nu toe gefaald.

"Het molecuul dat we proberen af ​​te leveren is fysiek kleiner - een achtste van de diameter van de nanodeeltjes die andere mensen in het beenmerg proberen af ​​te leveren - en dit zou grote voordelen kunnen opleveren," zei hij. “Our self-delivering enzyme should be able to reach the bone marrow.”

Graphic representation of CRISPR-Cas9 repairing the mutation in the gene that causes sickle cell disease (shown in light blue). (UC Berkeley image courtesy of Innovative Genomics Institute)

Whatever the successful strategy, either ex vivo or in vivo, the CRISPR platform developed for sickle cell disease could transform gene therapy for other diseases.

“That is the IGI vision: first sickle cell, but our efforts will have a ripple effect to enable cures for blood disorders in general, like beta thalassemia, as well as diseases of the immune system,” he said. “The hematopoietic stem cell is the seed for the entire immune system, so all blood disorders can theoretically be cured by a stem cell therapy like this.”


Achtergrond

The domain of chicken beta-globin genes is located on chromosome 1 and has a length of approximately 33 kb. It includes a cluster of four beta-globin genes: ρ (HBG1), β H (HBE1), β EEN (HBG2) and Ε (HBE) and several distant regulatory regions, which are marked with sites of hypersensitivity to DNase I (HS) and are necessary for the regulation of transcription, replication and chromatin status of the domain[1, 2]. The locus control region of the domain (LCR) is located upstream of the embryonic β-globin gene ρ and is composed of three blocks co-localizing with the erythroid cell-specific HSs 1 to 3[3, 4]. A constitutive HS4 located upstream of the LCR marks the position of the well-studied CTCF-dependent (CTCF ‐ СССTC-binding protein factor) insulator[5–9]. The CTCF-dependent enhancer-blocking element is also located at the downstream end of the domain in the area marked by the so-called 3′ constitutive HS[10, 11]. In addition to the LCR, the domain also possesses an internal enhancer (β/Ε-enhancer), which is located between the genes β EEN en Ε and is believed to contribute to the control of the activity of both genes[12–14]. The partitioning of tasks between the LCR and the β/Ε-enhancer is not quite clear. The results of experiments with transgenic mice carrying the chicken β-globin gene domain[4] suggested that the expression of one of the embryonic genes (ρ) is controlled by the LCR, while the expression of the other embryonic gene (Ε) is controlled by the β/Ε-enhancer. In addition, both regulatory elements appeared to be necessary for the correct developmental expression of the adult β-globin genes[3]. The domain of the chicken β-globin gene represents one of the best-studied genomic areas in higher eukaryotes[15]. This domain possesses all of the characteristic features of the so-called closed or strong chromatin domains[16, 17], which change the pattern of sensitivity to DNase I in a cell lineage-specific fashion. Detailed studies of the distribution of different histone modifications along the domain have contributed much to the present knowledge about the histone code[18, 19]. Nevertheless, the mechanisms of transcriptional switching of chicken β-globin gene expression remain poorly understood[15]. The developmental switching of globin gene transcription is typical for all vertebrate organisms[2]. In chickens, the first molecules of hemaglobin appear in embryonic erythroblasts 32 h after fertilization[20]. The beta-chains of the hemaglobin represent the products of genes ρ en Ε, which are transcribed from the 2 nd to the 5 th day of the embryonic development. After the 5 th day a new population of erythroid cells expressing the genes of fetal and adult globins β Н en β EEN verschijnt. These cells gradually replace the embryonic-type erythroblasts that express genes 1ρ en Ε[21]. In erythroblasts of adult lineage, the transcription of embryonic β-type globin genes is repressed.

Analysis of β-globin mRNA levels in chicken 3-day and 9-day embryonic red blood cells. The vertical axis shows the relative amounts of β-globin gene primary transcripts, as determined by RT-qPCR analysis of RNA samples prepared from the blood of 3- and 9-day old chicken embryos. (EEN) Normalization of data to the level of β-actin mRNA. (B) Normalization of data to the amount of cells used for RNA preparation. The amounts of β-globin gene transcripts detected in different RNA samples were normalized to the number of cells used for preparation of these RNA samples. The amount of the most abundant transcript (ρ-transcript in 3-day RBCs) was set as 100 relative units and the other data were normalized to this value. The error bars represent the S.E.M. for two independent experiments.

Recent studies of the spatial configuration of the mouse and human β-globin gene domain suggest that in erythroid cells, all regulatory elements of the domain become assembled into a common activation complex (the ACH) where the promoters of different globin genes are recruited in a developmental stage-specific fashion[22–24].

In the present work, we have analyzed the spatial configuration of the chicken β-globin gene domain in circulating red blood cells (RBCs) both before (3-day RBCs) and after (9-day RBCs) the β-globin switching. Using the quantitative chromosome conformation capture assay (3C-qPCR)[25, 26], we have demonstrated that the switching of chicken β-globin gene expression correlates with prominent changes in the spatial configuration of the domain. However, the observed spectrum of changes does not perfectly fit the simplistic model that postulates that only the transcriptionally active genes are recruited to the ACH.


Materialen en methodes

Production of ivt mRNA

PCR DNA fragments with a modified T7 promoter sequence (TAA TAC GAC TCA CTA TAA GG) and an eiF4G aptamer (ACT CAC TAT TTG TTT TCG CGC CCA GTT GCA AAA AGT GTC G) followed by a codon- optimized firefly luciferase-coding gene (a synthetic gene purchased from Blue Heron Bio) or ZsGreen gene (Clontech) and terminated by either the sequence TAA or 5’ GAGAGCTCGCTTTCTTGCTG 3’ or a tandem repeat of the beta-globin 3’ UTR 14 were used as matrices for mRNA production with a HiScribe™ T7 mRNA Kit (New England Biolabs). The nucleotide mixture consisted of 8 mM CleanCapTM (a newly available CAP1 analogue), ATP, GTP, either CTP or 5mCTP and either UTP or N1-methyl pseudouridine (1) triphosphate (all from TriLink) at a final volume of 20 microlitres.

After incubation for 3 hours at 37°C, 80 microlitres of a solution containing 10 microlitres of 10x buffer, 3 microlitres of poly (A) polymerase, 1 microlitre of DNase and 1 microlitre of RNasin (all from New England Biolabs) were added. The reaction was incubated for 3 hours before the addition of 50 microlitres of 8M LiCl, cooling at -20°C for 30 minutes and centrifugation at 15000 rpm for 15 minutes. Supernatants were removed, and 200 microlitres of 75% ethanol was added. After a 10 minute centrifugation at 15000 rpm, the supernatants were discarded, and the RNA pellets were dried in a “Speed-Vac”. RNAs were then resuspended in water, and the concentration measured using a Nanodrop was adjusted to 1 microgram per microlitre. Quality and integrity of ivt mRNAs were checked using agarose gel electrophoresis. The RNAs were stored at -20°C.

Cells and Transfection

Human embryonic kidney (HEK) cells and CT26 mouse colon carcinoma cells were maintained in RPMI medium (Thermo Fisher Scientific) containing 10% foetal calf serum (FCS) and 0.2% antimicrobial reagent Normocin (InvivoGen). Human peripheral mononuclear blood cells (PBMCs) and mouse splenocytes were obtained from peripheral blood from healthy donors and wild type C57Bl/6 or BALB/c mice, respectively, using centrifugation with Ficoll. For Luciferase experiments, transfection of tumour cells (CT26 or HEK) was performed with 100 000 tumour cells per well in 100 microlitres of RPMI medium supplemented with 10% FCS and 0.2% antimicrobial reagent Normocin (Invivogen) by adding a mixture of 20 ng of mRNA in 0.5 microlitres of Opti- MEM (Thermo Fisher Scientific) and 40 ng of the lipofectamine transfection reagent MessengerMAX (Thermo Fisher Scientific) in 0.5 microlitres of Opti-MEM to each well.

Transfection of non-transformed cells (PBMCs or splenocytes) was performed with 1 million cells per well in 100 microlitres of RPMI medium supplemented with 10% FCS and 0.2% antimicrobial reagent Normocin (Invivogen) by adding a mixture of 200 ng of mRNA in 5 microlitres of Opti-MEM and 400 ng of MessengerMAX in 5 microlitres of Opti-MEM to each well. Luciferase activity was recorded one day after transfection by adding 25 microlitres of Bright-Glo luciferase assay solution (Promega) and measuring activity using GloMax luminometer equipment (Promega). For ZsGreen experiments, transfection of tumour cells (CT26 or HEK) was performed with 100 000 tumour cells per well in 200 microlitres of RPMI medium supplemented with 10% FCS and 0.2% antimicrobial reagent Normocin (Invivogen) by adding a mixture of 100 ng of mRNA in 2.5 microlitres of Opti-MEM (Thermo Fisher Scientific) and 200 ng of the lipofectamine transfection reagent MessengerMAX (Thermo Fisher Scientific) in 2.5 microlitres of Opti-MEM to each well. Fluorescence (Excitation: 485nm Emission: 528nm) was recorded in real time at 37°C using Cytation™ 3 Cell Imaging Multi-Mode Reader (BioTek). Immunostimulation experiments were performed by forming protamine-RNA nanoparticles as previously described 15 (mixing RNA at 0.5 mg/ ml in water with protamine at 0.5 mg/ml in water) and incubating them with PBMCs for 20 hours at a final RNA concentration of 5 microgram/ml. Then, the interferon-alpha and tumour necrosis factor (TNF)-alpha contents in the cell culture supernatants were recorded using ELISAs (from Mabtech and eBioscience, respectively).

Animals and in vivo Imaging

Our study “Anti-cancer therapies based on RNA” was approved by the Veterinary Office of the University of Zurich (Kanton Zürich, Health Direction, Veterinary Office, Zollstrasse 20 8090 Zurich license number ZH215/17). The Veterinary Office of the University of Zurich has a research ethics review committee that granted approval. All efforts were made to minimize suffering. Animals were purchased from Envigo (Netherlands). Mice of 4 to 8 weeks of age were injected intra-venously with 1 microgram of mRNA formulated with a TransIT-mRNA transfection kit following the manufacturer’s suggestions (Mirus). Briefly, per mouse, 1 microgram of mRNA was diluted in 38 microlitres of Opti-MEM (Gibco) before the addition of 0.72 microlitres of “mRNA Boost Reagent”. After mixing, 1.12 microlitres of TransIT reagent was added. The solution was thoroughly homogenated and injected immediately. Five hours later, bioluminescence in vivo imaging was performed on an IVIS Lumina instrument (PerkinElmer). Immediately before the measurements, D-luciferin (Synchem) dissolved in PBS (15 mg/ml stock) and sterile filtered was injected (150 μg/g intraperitoneally). Emitted photons from live animals were quantified 10-20 minutes post luciferin injections, with an exposure time of 1 min. Regions of interest (ROI) were quantified for average radiance (photons s−1 cm−2 sr−1) (IVIS Living Image 3.2).


Referenties

1. Vinjamur DS, Bauer DE, Orkin SH. Recent progress in understanding and manipulating haemoglobin switching for theopathies. Br J Haematol. (2018) 180:630�. doi: 10.1111/bjh.15038

2. Wienert B, Martyn GE, Funnell APW, Quinlan KGR, Crossley M. Wake-up sleepy gene: reactivating fetal globin for β-hemoglobinopathies. Trends Genet. (2018) 34:927�. doi: 10.1016/j.tig.2018.09.004

3. Steinberg MH, Rodgers GP. HbA2: biology, clinical relevance and a possible target for ameliorating sickle cell disease. Br J Haematol. (2015) 170:781𠄷. doi: 10.1111/bjh.13570

4. Manchinu MF, Marongiu MF, Poddie D, Casu C, Latini V, Simbula M, et al. In vivo activation of the human δ-globin gene: the therapeutic potential in β-thalassemic mice. Haematologica. (2014) 99:76�. doi: 10.3324/haematol.2012.082768

5. Danjou F, Zoledziewska M, Sidore C, Steri M, Busonero F, Maschio A, et al. Genome-wide association analyses based on whole-genome sequencing in Sardinia provide insights into regulation of hemoglobin levels. Nat Genet. (2015) 47:1264�. doi: 10.1038/ng.3307

6. Borg J, Papadopoulos P, Georgitsi M, Gutiérrez L, Grech G, Fanis P, et al. Haploinsufficiency for the erythroid transcription factor KLF1 causes hereditary persistence of fetal hemoglobin. Nat Genet. (2010) 42:801𠄵. doi: 10.1038/ng.630

7. Tallack MR, Perkins AC. Three fingers on the switch: krüppel-like factor 1 regulation of γ-globin to β-globin gene switching. Curr Opin Hematol. (2013) 20:193�. doi: 10.1097/MOH.0b013e32835f59ba

8. Wienert B, Martyn GE, Kurita R, Nakamura Y, Quinlan KGR, Crossley M. KLF1 drives the expression of fetal hemoglobin in British HPFH. Bloed. (2017) 130:803𠄷. doi: 10.1182/blood-2017-02-767400

9. Perseu L, Satta S, Moi P, Demartis FR, Manunza L, Sollaino MC, et al. KLF1 gene mutations cause borderline HbA(2). Bloed. (2011) 118:4454𠄸. doi: 10.1182/blood-2011-04-345736

10. Porcu S, Manchinu MF, Marongiu MF, Sogos V, Poddie D, Asunis I, et al. Klf1 affects DNase II-alpha expression in the central macrophage of a fetal liver erythroblastic island: a non-cell-autonomous role in definitive erythropoiesis. Mol Cell Biol. (2011) 31:4144�. doi: 10.1128/MCB.05532-11

11. Keyel PA. Dnases in health and disease. Dev Biol. (2017) 429:1�. doi: 10.1016/j.ydbio.2017.06.028

12. Yoshida H, Okabe Y, Kawane K, Fukuyama H, Nagata S. Lethal anemia caused by interferon-beta produced in mouse embryos carrying undigested DNA. Nat Immunol. (2005) 6:49�.

13. Strouboulis J, Dillon N, Grosveld F. Developmental regulation of a complete 70-kb human beta-globin locus in transgenic mice. Genen Dev. (1992) 6:1857�. doi: 10.1101/gad.6.10.1857

14. Weatherall DJ. The inherited diseases of hemoglobin are an emerging global health burden. Bloed. (2010) 115:4331𠄶. doi: 10.1182/blood-2010-01-251348

15. Thompson AA, Walters MC, Kwiatkowski J, Rasko JEJ, Ribeil JA, Hongeng S, et al. Gene therapy in patients with transfusion-dependent β-thalassemia. N Engl J Med. (2018) 378:1479�. doi: 10.1056/NEJMoa1705342

16. Cavazzana M, Mavilio F. Gene therapy for hemoglobinopathies. Hum Gene Ther. (2018) 29:1106�. doi: 10.1089/hum.2018.122

17. Modell B, Darlison M. Global epidemiology of haemoglobin disorders and derived services indicators. Bull World Health Organ. (2008) 86:480𠄷. doi: 10.2471/blt.06.036673

18. Piel FB, Hay SI, Gupta S, Weatherall DJ, Williams TN. Global burden of sickle cell anaemia in children under five, 2010-2050: modelling based on demographics, excess mortality, and interventions. PLoS Med. (2013) 10:e1001484. doi: 10.1371/journal.pmed.1001484

19. Origa R. β-Thalassemia. Genet Med. (2017) 19:609�. doi: 10.1038/gim.2016.173

20. Fibach E, Manor D, Oppenheim A, Rachmilewitz EA. Proliferation and maturation of human erythroid progenitors in liquid culture. Bloed. (1989) 73:100𠄳.

21. Pope SH, Fibach E, Sun J, Chin K, Rodgers GP. Two-phase liquid culture system models normal human adult erythropoiesis at the molecular level. Eur J Haematol. (2000) 64:292�. doi: 10.1034/j.16000609.2000.90032.x

22. Menzel S, Garner C, Rooks H, Spector TD, Thein SL. HbA2 Levels in normal adults are influenced by two distinct mechanisms. Br J Haematol. (2013) 160:101𠄵. doi: 10.1111/bjh.12084

23. Socolovsky M, Murrell M, Liu Y, Pop R, Porpiglia E, Levchenko A. Negative autoregulation by FAS mediates robust fetal erythropoiesis. PLoS Biol. (2007) 5:e252. doi: 10.1371/journal.pbio.0050252

24. Ribeil JA, Arlet JB, Dussiot M, Moura IC, Courtois G, Hermine O. Ineffective erythropoiesis in β-thalassemia. Sci World J. (2013) 2013:394295. doi: 10.1155/2013/394295

25. Gupta R, Musallam KM, Taher AT, Rivella S. Ineffective erythropoiesis: anemia and iron overload. Hematol Oncol Clin North Am. (2018) 32:213�. doi: 10.1016/j.hoc.2017.11.009

26. Ozcan ME, Ince B, Karadeli HH, Gedikbasi A, Asil T, Altinoz MA. Higher minor hemoglobin A2 levels in multiple sclerosis patients correlate with lesser disease severity. Neuropsychiatr Dis Treat. (2016) 1612:2033𠄸. doi: 10.2147/NDT.S109954

27. Palstra RJ, de Laat W, Grosveld F. Beta-globin regulation and long-range interactions. Adv Genet. (2008) 61:107�. doi: 10.1016/S0065-2660(07)00004-1

28. Ross J, Pizarro A. Human beta and delta globin messenger rnas turn over at different rates. J Mol Biol. (1983) 167:607�.

29. Runkel L, Meier W, Pepinsky RB, Karpusas M, Whitty A, Kimball K, et al. Structural and functional differences between glycosylated and non-glycosylated forms of human interferon-beta (IFN-beta). Pharm Res. (1998) 15:641𠄹.

30. Durelli L, Verdun E, Barbero P, Bergui M, Versino E, Ghezzi A, et al. Every-other-day interferon beta-1b versus once-weekly interferon beta-1a for multiple sclerosis: results of a 2-year prospective randomised multicentre study (INCOMIN). Lancet. (2002) 359:1453�. doi: 10.1016/s0140-6736(02)08430-1

31. Rodero MP, Tesser A, Bartok E, Rice GI, Della Mina E, Depp M, et al. Type I interferon-mediated autoinflammation due to DNase II deficiency. Nat Comm. (2017) 8:2176. doi: 10.1038/s41467-017-01932-3

32. Paikari A, Sheehan VA. Fetal haemoglobin induction in sickle cell disease. Br J Haematol. (2018) 180:189�. doi: 10.1111/bjh.15021

33. Ristaldi MS, Casula S, Porcu S, Marongiu MF, Pirastu M, Cao A. Activation of the delta-globin gene by the beta-globin gene CACCC motif. Blood Cells Mol Dis. (1999) 25:193�.

34. Powars DR, Weiss JN, Chan LS, Schroeder WA. Is there a threshold level of fetal hemoglobin that ameliorates morbidity in sickle cell anemia?. Bloed. (1984) 63:921𠄶.

35. Estepp JH, Smeltzer MP, Kang G, Mstats CL, Wang WC, Abrams C, et al. A clinically meaningful fetal hemoglobin threshold for children with sickle cell anemia during hydroxyurea therapy. Am J Hematol. (2017) 92:1333𠄹. doi: 10.1002/ajh.24906

36. Testa U. Apoptotic mechanisms in the control of erythropoiesis. Leukemia. (2004) 18:1176-99. doi: 10.1038/sj.leu.2403383

37. Sarvothaman S, Undi RB, Pasupuleti SR, Gutti U, Gutti RK. Apoptosis: role in myeloid cell development. Blood Res. (2015) 50:73𠄹. doi: 10.5045/br.2015.50.2.73

38. Manchinu MF, Brancia C, Caria CA, Musu E, Porcu S, Simbula M, et al. Deficiency in interferon type 1 receptor improves definitive erythropoiesis in Klf1 null mice. Cell Death Differ. (2018) 25:589�. doi: 10.1038/s41418-017-0003-5

39. Means RT Jr, Krantz SB. Inhibition of human erythroid colony-forming units by tumor necrosis factor requires beta interferon. J Clin Invest. (1993) 91:416𠄹.

40. Means RT Jr, Krantz SB. Inhibition of human erythroid colony-forming units by interferons alpha and beta: differing mechanisms despite shared receptor. Exp Hematol. (1996) 24:204𠄸.

41. Sankaran VG, Ludwig LS, Sicinska E, Xu J, Bauer DE, Eng JC, et al. Cyclin D3 coordinates the cell cycle during differentiation to regulate erythrocyte size and number. Genen Dev. (2012) 26:2075�. doi: 10.1101/gad.197020

Keywords: erythropoiesis, δ-globine gene, interferon type 1, beta thalassemia, sickle cell anemia

Citation: Manchinu MF, Simbula M, Caria CA, Musu E, Perseu L, Porcu S, Steri M, Poddie D, Frau J, Cocco E, Manunza L, Barella S and Ristaldi MS (2020) Delta-Globin Gene Expression Is Enhanced in vivo by Interferon Type I. Voorkant. Med. 7:163. doi: 10.3389/fmed.2020.00163

Received: 28 January 2020 Accepted: 09 April 2020
Published: 22 May 2020.

Richard Van Wijk, Utrecht University, Netherlands

Cornelis Harteveld, Leiden University Medical Center, Netherlands
Emile Van Den Akker, Sanquin Diagnostic Services, Netherlands

Copyright © 2020 Manchinu, Simbula, Caria, Musu, Perseu, Porcu, Steri, Poddie, Frau, Cocco, Manunza, Barella and Ristaldi. Dit is een open-access artikel dat wordt verspreid onder de voorwaarden van de Creative Commons Attribution License (CC BY). Gebruik, verspreiding of reproductie in andere fora is toegestaan, op voorwaarde dat de oorspronkelijke auteur(s) en de auteursrechthebbende(n) worden vermeld en dat de oorspronkelijke publicatie in dit tijdschrift wordt geciteerd, in overeenstemming met de aanvaarde academische praktijk. Geen enkel gebruik, verspreiding of reproductie is toegestaan ​​die niet in overeenstemming is met deze voorwaarden.


Bekijk de video: Пристрої введення. Computer Mouse. (December 2021).