Informatie

Is het mogelijk om alleen op basis van de sequentie te bepalen uit welk weefsel een DNA-monster afkomstig is?


Alle cellen hebben hetzelfde genoom en verschillen alleen door het expressiepatroon. Is het mogelijk om de weefseloorsprong van een cel te bepalen op basis van zijn DNA-sequentie met behulp van korte tandemherhalingsanalyse (STR) of kopie-aantalvariatie (CNV) -analyse?


Het antwoord staat in de vraag, maar ik neem aan dat je ervoor wilde zorgen dat je geen informatie miste.

Antwoord geven

De DNA-sequentie is hetzelfde in alle cellen van een meercellig organisme. Alleen het expressiepatroon varieert tussen weefsels. Het is daarom onmogelijk om aan de DNA-sequentie alleen te zeggen uit welk weefsel een cel afkomstig is.

Het zou mogelijk zijn door te kijken naar het transcriptoom of het proteoom of uiteindelijk door te kijken naar epigenetische modificaties.

mogelijke uitzondering

Natuurlijk, als je het over CNV hebt, als je bedenkt dat het aantal chromosomen deel uitmaakt van de informatie die aanwezig is in een DNA-sequentie, dan zijn haploïde cellen (spermatozoïden en eitjes) een uitzondering en kun je ze van elkaar onderscheiden. Evenzo zouden anucleaire cellen een uitzondering zijn omdat ze geen nucleair DNA bevatten.

Verdere mogelijke uitzonderingen worden uitgelegd door @tsttst in zijn commentaar.


Er was een artikel in Science, augustus van dit jaar (excuses aan de auteur voor het niet herinneren van hun naam). Ze werkten een protocol uit voor eencellige bisulfietsequencing en door het gebruik van bekende markergenen slaagden ze erin om meerdere neuronale subtypes te identificeren op basis van niet-CpG-methylatie over genlichamen.

Niet-CpG-methylatie over genlichamen wordt vaak omgekeerd gecorreleerd met genexpressie, hierdoor kun je een expressieprofiel van bekende markergenen afleiden, waardoor je een stevige por hebt in een celtype met alleen een DNA-sequentie.

(Bewerken: ervan uitgaande dat dit geldt voor weefsels buiten de cortex)


ik zou liever beginnen met een veronderstelling dat Nee twee cellen in het menselijk lichaam hebben hetzelfde genoom. Mutaties komen vaak voor; de meeste van hen zijn gerepareerd, maar sommige blijven niet gerepareerd. Het menselijk lichaam is een genetisch mozaïek.

Abyzov et al. (Genoomonderzoek, 2017):

We schatten dat een fibroblastcel bij kinderen gemiddeld 1035 meestal goedaardige mozaïek-SNV's heeft. (…) Deze bevindingen onthullen een grote mate van somatisch mozaïcisme in gezonde menselijke weefsels, koppelen de novo- en kankermutaties aan somatisch mozaïcisme en koppelen somatisch mozaïcisme aan celproliferatie.


https://www.ncbi.nlm.nih.gov/pubmed/28235832


DNA SEQUENTIE

Invoering

DNA-sequencing is zeer big business. In 2003 werd ongeveer US$ 3 miljard uitgegeven aan sequencing-reagentia en enzymen, en aan de analyseapparatuur en software voor geautomatiseerde sequentie-acquisitie. Het grootste deel van deze sequentie-output werd bepaald met behulp van capillaire elektroforese (CE) -technologie, die zich de afgelopen 10 jaar evenredig snel heeft ontwikkeld. CE biedt een hoge resolutie en hoge doorvoer, automatische werking en data-acquisitie, met online detectie van kleurstoffen die zijn gebonden aan DNA-verlengingsproducten. Operationele vooruitgang zoals pulsed-field en gegradueerde elektrische velden en geautomatiseerde thermische ramping-programma's naarmate de run vordert, resulteren in een hogere basisresolutie en langere sequentielezingen. Geavanceerde base-calling-algoritmen en DNA-markeradditieven die gebruikmaken van bekende oriëntatiepunten voor fragmentgrootte, kunnen ook helpen om de base-calling van fragmenten te verbeteren, de oproepnauwkeurigheid te vergroten en de leeslengte met 20-30% te vergroten. Ondanks de hoge efficiëntie van CE-sequencers, stimuleert de volledige afbakening van het menselijk genoom en de implicatie ervan voor genoombrede analyse voor gepersonaliseerde geneeskunde de ontwikkeling van apparaten en chemie die in staat zijn tot een enorm verhoogde sequentie-doorvoer in vergelijking met de conventionele CE-sequencers. Miniaturisatie van CE op chip-gebaseerde apparaten biedt alle bovengenoemde faciliteiten - een aanzienlijke verbetering van de snelheid en verbeterde automatisering van analyse. Nieuwe array-gebaseerde sequencing-apparaten beloven ook een kwantumverhoging in efficiëntie. Elk van deze nieuwe apparaten biedt een extreem hoge doorvoer, hoogwaardige gegevens en lage proceskosten. Dit artikel onderzoekt ook de automatisering en verbetering van sequencingprocessen, DNA-amplificatieprocessen en alternatieve benaderingen voor sequencing.


Het risico op besmetting van een plaats delict kan worden verkleind door incidentele activiteiten te beperken. Het is belangrijk dat alle wetshandhavers op de plaats delict zich bewust inspannen om te onthouden van roken, eten, drinken, zwerfvuil of andere handelingen die de plaats delict in gevaar kunnen brengen. Omdat DNA-bewijs gevoeliger is dan andere soorten bewijs, moet wetshandhavingspersoneel zich vooral bewust zijn van hun acties ter plaatse om onbedoelde besmetting van bewijsmateriaal te voorkomen.

De Chain of Custody van bewijs is een record van personen die fysiek bezit van het bewijs hebben gehad. Documentatie is van cruciaal belang voor het handhaven van de integriteit van de chain of custody. Het handhaven van de chain of custody is van vitaal belang voor elk type bewijs. Als uit laboratoriumanalyse blijkt dat DNA-bewijs besmet is, kan het bovendien nodig zijn om de personen te identificeren die dat bewijs hebben behandeld.

Bij het verwerken van het bewijs geldt: hoe minder mensen het bewijs verwerken, hoe beter. Er is minder kans op besmetting en een kortere keten van bewaring voor ontvankelijkheidszittingen.


Materialen en methodes

Exemplaren

Alle mottenspecimens behoren tot de soort Euxoa messoria. Ze werden verzameld over een periode van 45 jaar (tabel 1) en werden vastgemaakt zonder extra conserveermiddel. Exemplaren van drie verschillende kikkersoorten (tabel 2) werden verzameld als onderdeel van lopend onderzoek dat geen verband houdt met deze studie en bewaard met behulp van standaardmethoden (bijv. Lit. [25]). Kikkers werden gedood met behulp van een waterige oplossing van chloreton en voor volwassen kikkers werd een monster leverweefsel bewaard in 95% ethanol. Volwassen exemplaren werden vervolgens een nacht gefixeerd in 3,7% neutraal gebufferd formaldehyde en vervolgens overgebracht naar 70% ethanol voor langdurige opslag. Bij grote exemplaren (bijv. Astylosternus), een klein deel (

1 milliliter) werd tijdens de fixatie in de lichaamsholte geïnjecteerd. Voor kikkervisjes werd een klein stukje staart (meestal spieren) uitgesneden en bewaard in 95% ethanol volgens de gebruikelijke praktijk, het resterende exemplaar werd gefixeerd en bewaard in 3,7% formaldehyde. Dierverzorgingsprocedures zijn goedgekeurd door de Harvard University/Faculty of Arts and Sciences Permanent Committee on the use of Animals in Research and Teaching. Een verklaring Dierenwelzijnszorg is in het bezit van het Bureau Laboratoriumwelzijn (OLAW) van de universiteit.

Na terugkeer van het veld werden weefselmonsters in 95% ethanol bewaard bij -80°C. Voor deze studie werd een ander stuk van hetzelfde weefsel (d.w.z. lever of staart) uitgesneden uit de hele geconserveerde monsters. Deze weefselmonsters werden overgebracht naar 95% ethanol. Om het effect van bewaartijd kwalitatief te evalueren en het effect van soort of ontwikkelingsstadium op onze resultaten te verminderen, analyseerden we weefsels van volwassenen die in twee verschillende jaren waren verzameld, evenals kikkervisjes van dezelfde soort. De monsters die zijn opgeslagen of gefixeerd met formaldehyde worden aangeduid als: blootgesteld tot formaldehyde.

DNA-extractie

Kleine hoeveelheden kikkerweefsel (1-3 mg) werden in maart 2007 verkregen uit de geconserveerde monsters. Het weefsel werd gelyseerd en DNA werd gezuiverd met behulp van de DNeasy-kit (Qiagen) volgens het protocol van de fabrikant. Geëxtraheerd DNA werd bij 4°C in TE-buffer bewaard.

Een poot van elk mottenmonster werd gebruikt voor DNA-extractie, met behulp van de NucleoSpin96-kit (Macherey-Nagel). Elutie werd uitgevoerd met 40 ul water. Het eluaat werd bewaard bij -20°C.

Fragmentanalyse door capillaire elektroforese

Een aliquot van 1-5 l geëxtraheerd DNA werd gelabeld met Fluorescein-12-ddATP (PerkinElmer, Boston, MA) met behulp van Terminal Transferase (NEB, Ipswich, MA) volgens het bijbehorende protocol, resulterend in een reactievolume van 10 μL. De reactie werd 1 uur bij 37°C geïncubeerd en vervolgens aangebracht op een Centri-Sep-kolom (Princeton Separations) [26].

Voor de verwijdering van terminale fosfaten op de DNA-fragmenten werden aliquots van 3 l DNA behandeld met 5U Antarctic Phosphatase (NEB) in een totaal reactievolume van 10 μl. De reactie werd 1 uur bij 37°C geïncubeerd, gevolgd door inactivering van de fosfatase gedurende 5 minuten bij 65°C. Dit werd gevolgd door labeling met TdT zoals hierboven beschreven.

Een aliquot van 1-2 l van het eluaat werd gemengd met 9 μl Hi-Di (Applied Biosystems) en 0, 5 ml GENESCAN LIZ1200-maatstandaard (Applied Biosystems). Monsters werden geanalyseerd op een 3130xl Genetic Analyzer (Applied Biosystems), met behulp van een 36 cm array, POP7-polymeer, een injectietijd van 10 s en een totale looptijd van 6200 s. Een voorbeeld van de onbewerkte gegevens die worden gebruikt voor de bepaling van de fragmentgrootte wordt getoond in figuur 1c voor mottenmonster 3.

Paneel A toont de grootteverdeling van DNA geëxtraheerd uit mottenmonsters. Zie methoden voor details over maatbepaling. Paneel B toont de ruwe gegevens van de FAM-gelabelde DNA-fragmenten, gemiddeld voor elk jaar. De gegevens werden ter vergelijking op dezelfde hoogte geschaald. Let op de afname van de piekbreedte met de leeftijd van de steekproef. Paneel C toont de onbewerkte gegevens die zijn verkregen voor mottenmonster 3 van een capillaire elektroforese-run. Het labelen van het DNA zonder enige voorafgaande behandeling resulteert in de fragmentverdeling die hier in rood wordt weergegeven. Een aliquot van hetzelfde monster werd behandeld met Antarctic Phosphatase vóór de TdT-labelingsreactie, weergegeven in blauw. De grootteverdeling van de fragmenten verandert niet, terwijl de intensiteit voor verschillende monsters met een factor 2-15 wordt verhoogd. De LIZ1200-maatstandaard wordt in oranje weergegeven, cijfers geven de fragmentgrootte in basen aan.

Ruwe gegevens werden geïmporteerd in Origin7.5 (Microcal) voor gedetailleerde analyse. Voor de bepaling van de meest voorkomende fragmentgrootte van een monster, werd de gegevenscurve voor de FAM-fluorescentie onderworpen aan afvlakking, met behulp van de aangrenzende gemiddelde methode over 500 punten. De afgevlakte curve werd aangepast aan een piekfunctie, vergelijking 1, om de positie van het maximum (in scanaantallen) te bepalen.

w: breedte, xc: midden, y 0 : offset, A: Amplitude

Om dit om te zetten in basenparen, werden de elutietijden van de groottestandaardfragmenten (in scanaantallen) uitgezet tegen de bekende grootte van elk fragment van de LIZ1200-standaard en aangepast aan een sigmoïdale groeicurve, vergelijking 2.

EEN 1 : beginwaarde, A 2 : eindwaarde, x 0 : centrum, dx: tijdconstante

Het passende resultaat voor de maatstandaard samen met de piek van de FAM-fluorescentie werden gebruikt om de meest voorkomende grootte van DNA-fragmenten in een bepaald monster te bepalen. Voor de verdeling van fragmentgroottes werd de piekbreedte (volledige breedte op halve hoogte) gebruikt, zoals bepaald uit de pasvorm van vergelijking 1.

Voor kwantificering van het totale DNA-gehalte werd een basislijn aangepast aan het totale FAM-signaal, het signaal werd vervolgens geïntegreerd met behulp van deze basislijn. Als een test voor de lineariteit van detectie in onze CE, gebruikten we de Φ X174 DNA-ladder (NEB) in een seriële verdunning. We vonden een lineaire correlatie tussen gegevensintegraal en monsterconcentratie in het bereik van 2-20 ng / μl (R = 0,997, gegevens niet getoond).

DNA-vertering

Geëxtraheerd DNA werd verteerd met behulp van een gepubliceerde methode [27] met modificaties. Porties van 1-10 l geëxtraheerd DNA werden geïncubeerd met 1 l DNase I (2U/μl, NEB), 10 l Snake Venom Phosphodiesterase (0,26 mU/μl, Sigma-Aldrich) en 2 μl Antarctic Phosphatase (5U/μl, NEB ) 's nachts bij 37°C. Met behulp van deze procedure werd niet-gemodificeerd DNA volledig gedigereerd tot het mononucleoside-niveau zoals beoordeeld door HPLC (gegevens niet getoond).

HPLC-scheiding:

Gedigereerde DNA-monsters werden geanalyseerd op een Agilent 1100 HPLC-systeem uitgerust met een Develosil RP-Aqueous C30-kolom (Nomura Chemical Co.). Oplosmiddel A was MilliQ-water dat 1% (v/v) mierenzuur bevat en oplosmiddel B was methanol van gradiëntkwaliteit dat 0,25% (v/v) mierenzuur bevatte. Er werd een elutieprofiel gebruikt van 2-20% B gedurende 30 minuten, oplopend tot 98% gedurende nog eens 20 minuten, vervolgens 98% B gedurende 10 minuten en uiteindelijk terugkerend naar 2% B gedurende 20 minuten. De stroomsnelheid werd ingesteld op 20 l/min en het eluaat werd gecontroleerd bij 254 nm. Meestal werd 4 l van elk monster geïnjecteerd met behulp van de well-plate sampler.

Massaspectrometrische analyse

Voor massaspectrometrische analyse werd het hierboven beschreven HPLC-systeem rechtstreeks aangesloten op de monsterinlaat van een Agilent ESI-TOF-massaspectrometer. Massaspectrale gegevens werden opgenomen in positieve ionenmodus gedurende de gehele duur van de HPLC-run. Gegevens werden geanalyseerd met Analyst QS (Agilent).

Gepulseerd veld agarosegelelektroforese

Voor de detectie van grote DNA-fragmenten werden aliquots van het kikker-DNA op een 1% agarosegel geladen en gedurende 15 uur gescheiden met een schakeltijd van 1-12 s en een spanning van 6 V/cm. De marker was PFG-marker N0350 (NEB).

Een stuk van 500 bp van de Euxoa messoa barcodesequentie werd geamplificeerd met behulp van primers pJZ-moth1-se TTAGGTAATCCAGGATCTTTAATTG en pJZ-moth1-as ATGATAATAATAATAAAAATGCAGT. Amplificatie werd uitgevoerd met Taq DNA-polymerase (NEB), met een initiële denaturatie bij 95°C gedurende 2 min., daarna 30 cycli van 95°C gedurende 15 s, 55°C gedurende 10 s, 72°C gedurende 30 s, en een laatste verlenging bij 72 °C gedurende 5 minuten.

Primersequenties voor de PCR van mitochondriaal 16S ribosomaal RNA van kikkers komen overeen met die van Darst en Cannatella [28]. De primers voor het eerste exon van het nucleaire gen voor rodopsine zijn ACGGAACAGAAGGTCCCAAC (5'-primer) en AGCGAAGAAGCCTTCAAAGT (3'-primer). PCR-reacties werden uitgevoerd met Phusion DNA-polymerase (NEB), met initiële denaturatie bij 98°C gedurende 30 s, daarna 30 cycli van 98°C gedurende 10 s, 60°C gedurende 10 s, 72°C gedurende 45 s, en een laatste verlenging bij 72 °C gedurende 10 minuten.

Modellering van DNA-nicking

Er is een algoritme geschreven in C om fragmentatie van dubbelstrengs DNA te simuleren door herhaalde inkepingen. De simulatie vereiste vier invoerparameters: gesimuleerde tijdsperiode lengte (t) in jaren, DNA-grootte (L) in megabases, nick-rate (N) in nicks per megabase per dag, en de nabijheid van nicks van tegenoverliggende strengen (P) die resulteren in een dubbelstrengige break gegeven in basen. Het programma start de C-bibliotheek voor het genereren van willekeurige getallen, zodat herhaalde oproepen naar de generator uniform verdeelde willekeurige gehele getallen tussen 1 en 2* opleveren.L*10 6 . Willekeurig getal r vertegenwoordigt een nick op de rde positie van de voorwaartse streng als R <L*l0 6 , anders wijst het programma de nick toe op positie rc = R - L*l0 6 op de omgekeerde streng. De denkbeeldige reeks is "gepikt" N*L*365*ja keer op posities die worden aangegeven door de willekeurige nummers die zijn geretourneerd van opeenvolgende oproepen naar de generator voor willekeurige nummers. Vervolgens identificeert het programma waar inkepingen van tegenovergestelde strengen voorkomen binnen P basen, en registreert dubbelstrengige pauzes. Afstanden tussen opeenvolgende breuken, gemeten op de voorwaartse streng van DNA, geven fragmentlengtes. Deze worden getabelleerd en gerapporteerd in een op grootte gesorteerde lijst. De simulatie wordt uitgevoerd met verschillende combinaties van invoerparameters.


DNA-technologie in de forensische wetenschap (1992)

"DNA-typering" is een verzamelnaam voor een breed scala aan methoden voor het bestuderen van genetische variaties. Elke methode heeft zijn eigen voordelen en beperkingen, en elke methode bevindt zich in een andere staat van technische ontwikkeling. Elke DNA-typeringsmethode omvat drie stappen:

Laboratoriumanalyse van monsters om hun genetische markertypes te bepalen op meerdere locaties met mogelijke variatie.

Vergelijking van de genetische markertypes van de monsters om te bepalen of de typen overeenkomen en dus of de monsters uit dezelfde bron kunnen komen.

Als de typen overeenkomen, statistische analyse van de populatiefrequentie van de typen om de waarschijnlijkheid te bepalen dat een dergelijke overeenkomst bij toeval is waargenomen in een vergelijking van steekproeven van verschillende personen.

Voordat een bepaalde DNA-typeringsmethode voor forensische doeleinden wordt gebruikt, is het essentieel dat er nauwkeurige en wetenschappelijk betrouwbare procedures worden vastgesteld voor het uitvoeren van alle drie de stappen. Dit hoofdstuk bespreekt de eerste twee&mdashlaboratoriumanalyse en patroonvergelijking&mdashand Hoofdstuk 3 richt zich op statistische analyse.

Er is geen wetenschappelijk geschil over de geldigheid van de algemene principes die ten grondslag liggen aan DNA-typering: wetenschappers zijn het erover eens dat DNA aanzienlijk varieert tussen mensen, dat variatie in het laboratorium kan worden gedetecteerd en dat DNA-vergelijking een basis kan bieden om monsters van verschillende personen te onderscheiden. Een bepaalde DNA-typeringsmethode kan echter wel of niet wetenschappelijk geschikt zijn voor forensisch gebruik. Voordat een methode kan worden

Omdat het als geldig wordt beschouwd voor forensisch gebruik, moet het strikt worden gekarakteriseerd in zowel onderzoeks- als forensische omgevingen om te bepalen onder welke omstandigheden het wel en geen betrouwbare resultaten zal opleveren. Het is zinloos om te spreken over de betrouwbaarheid van DNA-typering in het algemeen&mdashi.e., zonder een bepaalde methode te specificeren. Sommige staten hebben vaag geformuleerde statuten aangenomen met betrekking tot de toelaatbaarheid van DNA-typeringsresultaten zonder de methoden te specificeren die bedoeld zijn om te worden gedekt. Dergelijke wetten waren duidelijk bedoeld om alleen conventionele RFLP-analyse van single-locus-sondes op Southern blots te dekken en dit was de enige methode die algemeen werd gebruikt op het moment dat de wetgeving werd aangenomen. We vertrouwen erop dat rechtbanken de beperkingen die inherent zijn aan dergelijke statuten zullen erkennen.

Forensische DNA-analyse moet worden beheerst door de hoogste normen van wetenschappelijke nauwkeurigheid in analyse en interpretatie. Dergelijke hoge normen zijn om twee redenen passend: de bewijskracht van DNA-typering kan zo groot zijn dat het opweegt tegen al het andere bewijs in een proces en de procedures voor DNA-typering zijn complex, en rechters en jury's kunnen conclusies niet goed afwegen en evalueren op basis van verschillende striktheidsnormen.

De commissie kan in dit rapport geen uitgebreide technische beschrijvingen voor DNA-typering geven: er bestaan ​​of zijn te veel methoden gepland, en er moeten te veel problemen voor elke methode in detail worden behandeld. In plaats daarvan is ons belangrijkste doel om een ​​algemeen kader te bieden voor de evaluatie van elke DNA-typeringsmethode.

ESSENTIALS VAN EEN FORENSISCH DNA-TYPEPROCEDURE

Wetenschappelijke grondslagen

Het forensische gebruik van DNA-typering is een uitvloeisel van het medisch diagnostisch gebruik en de analyse van ziekteverwekkende genen op basis van vergelijking van het DNA van een patiënt met dat van familieleden om erfelijkheidspatronen van genen te bestuderen of met referentiestandaarden om mutaties te detecteren. Om de uitdagingen van dergelijke technologieoverdracht te begrijpen, is het leerzaam om forensische DNA-typering te vergelijken met DNA-diagnostiek.

Bij DNA-diagnostiek gaat het meestal om schone weefselmonsters uit bekende bronnen. Het kan meestal worden herhaald om onduidelijkheden op te lossen. Het omvat een vergelijking van discrete alternatieven (bijvoorbeeld welke van de twee allelen heeft een kind geërfd van een ouder?) en omvat dus ingebouwde consistentiecontroles tegen artefacten. Het vereist geen kennis van de verdeling van patronen in de algemene bevolking.

Bij forensische DNA-typering zijn vaak monsters betrokken die zijn aangetast, besmet of afkomstig zijn van meerdere onbekende bronnen. Het kan soms niet worden herhaald, omdat er te weinig steekproef is. Het gaat vaak om het matchen van steekproeven van een breed scala aan alternatieven die in de populatie aanwezig zijn en dus ontbreken ingebouwde consistentiecontroles. Behalve in gevallen waarin het DNA-bewijs

een verdachte uitsluit, vereist het beoordelen van de significantie van een resultaat statistische analyse van populatiefrequenties.

Ondanks de uitdagingen van forensische DNA-typering, zijn wij van mening dat het mogelijk is om betrouwbare forensische DNA-typeringssystemen te ontwikkelen, op voorwaarde dat voldoende wetenschappelijke zorg wordt besteed aan het definiëren en karakteriseren van de methoden. We schetsen hieronder de belangrijkste problemen die moeten worden aangepakt voor elke DNA-typeringsprocedure.

Schriftelijk laboratoriumprotocol

Een essentieel onderdeel van elke klinische of forensische DNA-typeringsmethode is een gedetailleerd schriftelijk laboratoriumprotocol. Een dergelijk protocol moet niet alleen stappen en reagentia specificeren, maar ook nauwkeurige instructies geven voor het interpreteren van resultaten, wat cruciaal is voor het evalueren van de betrouwbaarheid van een methode. Bovendien moet het volledige protocol vrij beschikbaar worden gesteld, zodat het aan wetenschappelijk onderzoek kan worden onderworpen.

Procedure voor het identificeren van patronen

Er moet een objectieve en kwantitatieve procedure zijn om het patroon van een monster te identificeren. Hoewel de populaire pers soms DNA-patronen vergelijkt met streepjescodes, zijn laboratoriumresultaten van de meeste DNA-testmethoden geen discrete gegevens, maar eerder continue gegevens. Dergelijke resultaten bestaan ​​doorgaans uit een afbeelding, zoals een autoradiogram, een foto, vlekken op een strook of de fluorometrische traceringen van een DNA-sequentie, en de afbeelding moet kwantitatief worden geanalyseerd om het genotype of de genotypen te bepalen die in het monster worden vertegenwoordigd. Kwantificering is vooral belangrijk in forensische toepassingen, vanwege de altijd aanwezige mogelijkheid van mengmonsters.

Patronen moeten afzonderlijk en onafhankelijk worden geïdentificeerd in verdachte- en bewijsmonsters. Het is niet toegestaan ​​om op basis van een vergelijking met een verdachte steekproef te beslissen welke kenmerken van een evidence-steekproef worden meegeteld en welke worden verdisconteerd, omdat dit de interpretatie kan vertekenen.

Procedure voor het declareren van een match

Wanneer individuele patronen van DNA in bewijsmonster en verdacht monster zijn geïdentificeerd, is het tijd om vergelijkingen te maken om te bepalen of ze overeenkomen. Of deze stap gemakkelijk of moeilijk is, hangt af van het oplossend vermogen van het systeem om allelen te onderscheiden. Sommige DNA-typeringsmethoden omvatten kleine verzamelingen allelen die perfect van elkaar kunnen worden onderscheiden, bijvoorbeeld een RFLP-systeem met twee allelen op basis van een polymorfisme op een enkele locus. Andere methoden omvatten grote verzamelingen van vergelijkbare allelen die onvolmaakt van elkaar worden onderscheiden & mdash., de hypervariabele VNTR

systemen in algemeen forensisch gebruik, waarbij een enkel monster bij herhaalde metingen enigszins verschillende allelgroottes kan opleveren. 1 Het is gemakkelijk om te bepalen of twee steekproeven overeenkomen in het eerste geval (ervan uitgaande dat de patronen correct zijn geïdentificeerd), maar het laatste geval vereist een overeenkomstcriterium&mdashi.d.w.z. een objectieve en kwantitatieve regel om te beslissen of twee steekproeven overeenkomen. Een overeenkomstcriterium voor VNTR-systemen kan bijvoorbeeld een overeenkomst tussen twee steekproeven verklaren als de grootte van de restrictiefragmenten binnen 3% van elkaar ligt.

Het overeenstemmingscriterium moet gebaseerd zijn op de werkelijke variabiliteit in meting die is waargenomen in geschikte testexperimenten die in elk testlaboratorium worden uitgevoerd. Het criterium moet objectief, nauwkeurig en uniform worden toegepast. Als twee steekproeven buiten de vergelijkingsregel vallen, moeten ze ofwel "niet-overeenkomend" of "niet-overeenkomend" worden verklaard. zich houden aan een vastgestelde matchingsregel.

Identificatie van potentiële artefacten

Alle laboratoriumprocedures zijn onderhevig aan mogelijke artefacten, die kunnen leiden tot onjuiste interpretaties als ze niet worden herkend. Dienovereenkomstig moet elke DNA-typeringsmethode strikt worden gekarakteriseerd met betrekking tot de soorten mogelijke artefacten, de omstandigheden waaronder ze waarschijnlijk zullen voorkomen, de wetenschappelijke controles voor het detecteren van hun optreden en de stappen die moeten worden genomen wanneer ze optreden, die kunnen variëren van het herinterpreteren van resultaten tot het corrigeren voor de aanwezigheid van artefacten, het herhalen van een deel van het experiment of het beslissen dat monsters betrouwbaar kunnen worden gebruikt.

Ongeacht de specifieke DNA-typeringsmethode, kunnen artefacten een patroon op drie manieren veranderen: patroon A kan worden omgezet in patroon B, patroon A kan worden omgezet in patroon A + B en patroon A + B kan worden omgezet in patroon B. belangrijk om de omstandigheden te identificeren waaronder elke transformatie kan plaatsvinden, omdat alleen dan controles en correcties kunnen worden bedacht. RFLP-analyse is bijvoorbeeld onderhevig aan artefacten als bandverschuiving, waarbij DNA-monsters met verschillende snelheden migreren en verschoven patronen (A&rarrB) opleveren, en onvolledige vertering, waarbij het falen van een restrictie-enzym om op alle restrictieplaatsen te splitsen resulteert in extra banden (A&rarrA + B).

Sommige potentiële problemen kunnen worden geïdentificeerd op basis van de chemie van DNA en het detectiemechanisme in het genetische typeringssysteem. Door te anticiperen op mogelijke bronnen van DNA-typefouten kan systematisch empirisch onderzoek worden gedaan om vast te stellen of er in de praktijk sprake is van een probleem. Als dat het geval is, moet het bereik van omstandigheden waarin een test onderhevig is aan artefacten worden gekarakteriseerd. In beide gevallen moeten de resultaten van het testen op artefacten worden gedocumenteerd. Empirisch testen is noodzakelijk, of men nu een nieuwe methode, een nieuwe locus, een nieuwe set reagentia (sonde of enzym) voor een

bestaande locus of een nieuw apparaat. Onder bepaalde omstandigheden kunnen zelfs kleine veranderingen in de procedure het patroon van artefacten veranderen.

Zodra potentiële artefacten zijn geïdentificeerd, is het noodzakelijk om wetenschappelijke controles te ontwerpen die dienen als interne controles in elk experiment om te testen of de artefacten zijn opgetreden. Zodra de juiste controles zijn geïdentificeerd, moeten analisten deze consequent gebruiken bij het interpreteren van testresultaten. Als de juiste controle niet is uitgevoerd, mag er geen resultaat worden gerapporteerd. Wanneer een controle onregelmatigheden in een experiment aangeeft, moeten de betreffende resultaten zo mogelijk als niet-overtuigend worden beschouwd, het experiment moet worden herhaald. Een goed ontworpen DNA-typeringstest moet een kwestie zijn van gestandaardiseerde, objectieve analyse.

Gevoeligheid voor hoeveelheid, mengsel en verontreiniging

Bewijsmonsters kunnen heel weinig DNA bevatten, kunnen een mengsel van DNA uit meerdere bronnen bevatten en kunnen besmet zijn met chemicaliën die de analyse kunnen verstoren. Het is essentieel om de grenzen van elke DNA-typeringsmethode onder dergelijke omstandigheden te begrijpen.

Ervaringsgerichte Stichting

Voordat een nieuwe DNA-typeringsmethode kan worden gebruikt, vereist deze niet alleen een solide wetenschappelijke basis, maar ook een solide basis van ervaring in forensische toepassing. Traditioneel hebben forensische wetenschappers vijf stappen toegepast op de implementatie van genetische markersystemen:

Vertrouwd raken met een systeem door gebruik te maken van verse monsters.

Overleving van testmarkers in gedroogde vlekken (bijv. Bloedvlekken).

Test het systeem op gesimuleerde bewijsmonsters die zijn blootgesteld aan verschillende omgevingsomstandigheden.

Stel basiscompetentie vast in het gebruik van het systeem door middel van blinde proeven.

Test het systeem op niet-bewijzende bewijsstukken waarvan de herkomst bekend is, ter controle van de betrouwbaarheid.

Wanneer een techniek in eerste instantie wordt ontwikkeld, moeten alle vijf de stappen zorgvuldig worden gevolgd. Aangezien laboratoria de techniek toepassen, is het niet altijd nodig dat ze alle stappen herhalen, maar ze moeten bekendheid en competentie aantonen door stap 1, 4 en 5 te volgen. 4

Het belangrijkste is dat er geen vervanging is voor rigoureuze externe bekwaamheidstests via blinde proeven. Dergelijke bekwaamheidstests vormen een wetenschappelijke bevestiging dat de implementatie van een methode door een laboratorium niet alleen in theorie geldig is, maar ook in de praktijk. Geen enkel laboratorium mag zijn resultaten met een nieuwe DNA-typeringsmethode in de rechtbank laten gebruiken, tenzij het dergelijke bekwaamheidstests heeft ondergaan via blinde proeven. (Zie hoofdstuk 4 voor de bespreking van ringonderzoeken.)

Publicatie en wetenschappelijk onderzoek

Als een nieuwe DNA-typeringsmethode (of een substantiële variatie op een bestaande) in de rechtbank moet worden gebruikt, zijn publicatie en wetenschappelijk onderzoek van groot belang. Er moet een uitgebreide empirische karakterisering worden uitgevoerd. Resultaten moeten worden gepubliceerd in geschikte wetenschappelijke tijdschriften. Publicatie is het mechanisme dat het proces van wetenschappelijke bevestiging en uiteindelijke acceptatie of afwijzing van een methode in gang zet.

Een deel van de controverse over het forensisch gebruik van DNA-typering kan worden herleid tot het niet publiceren van een gedetailleerde uitleg en rechtvaardiging van methoden. Zonder het voordeel van open wetenschappelijke controle, gebruikten sommige testlaboratoria aanvankelijk methoden (voor fundamentele stappen als het identificeren van patronen, het verklaren van overeenkomsten, het maken van vergelijking met een databank en het corrigeren voor bandverschuiving) waarvan ze later instemden dat ze niet experimenteel werden ondersteund. In sommige gevallen leidden die fouten tot uitsluiting van DNA-bewijs of ontslag van aanklacht.

TECHNISCHE KWESTIES BIJ RFLP-ANALYSE

Keuze van sondes

Een DNA-sonde die in forensische toepassingen wordt gebruikt, moet de volgende eigenschappen hebben:

Het moet een enkele menselijke locus (of plaats) herkennen, bij voorkeur een waarvan de chromosomale locatie is bepaald.

Het zou bij de meeste mensen een constant aantal banden per allel moeten detecteren.

Het moet worden gekarakteriseerd in de gepubliceerde literatuur, inclusief het typische scala aan allelen en de neiging om DNA van andere soorten te herkennen.

Het moet gemakkelijk beschikbaar zijn voor wetenschappelijk onderzoek door elke geïnteresseerde persoon.

De commissie raadt forensisch gebruik af van multilocus-sondes, die veel fragmenten per persoon detecteren. Omdat dergelijke sondes fragmenten met heel verschillende intensiteiten kunnen detecteren, is het moeilijk om te weten of men alle fragmenten in een monster heeft gedetecteerd, vooral bij kleine en gedegradeerde forensische monsters, en het is moeilijk om artefacten en mengsels te herkennen. Dergelijke problemen vergroten de moeilijkheid van patrooninterpretatie. Multilocus-sondes verhogen het risico op onjuiste interpretatie en er zijn talrijke single-locus-sondes beschikbaar die dergelijke problemen niet opleveren. Het gebruik van voldoende sondes met een enkele locus verkrijgt de voordelen van de sondes met een enkele multilocus zonder de problemen van interpretatie.

Southern Blot-voorbereiding

Het basisprotocol voor het bereiden van Southern-blots is vrij standaard, maar testlaboratoria variëren in zaken als keuze van restrictie-enzym, gellengte en samenstelling en elektroforese-omstandigheden. Dergelijke verschillen hebben geen fundamentele invloed op de betrouwbaarheid van de algemene methode, maar voor sommige enzymen kan karakterisering nodig zijn (elk restrictie-enzym moet bijvoorbeeld worden gekarakteriseerd op gevoeligheid voor remmers, op neiging om te snijden op afwijkende herkenningsplaatsen onder bepaalde omstandigheden&mdashoften genaamd "steractiviteit"&mdashand voor de neiging om gedeeltelijke digesties te produceren), en verschillen in gels en elektroforese-omstandigheden zullen de resolutie van fragmenten en retentie van kleine fragmenten beïnvloeden.

Er zijn vragen gerezen over het gebruik van ethidiumbromide, een fluorescerende kleurstof die zich aan DNA bindt en zo zichtbaar maakt. Sommige laboratoria nemen ethidiumbromide op in analytische gels vóór elektroforese, andere kleuren gels met ethidiumbromide na elektroforese. De commissie beveelt dit laatste ten zeerste aan, om twee redenen:

Ethidiumbromide bindt zich op een concentratieafhankelijke manier aan DNA en er is aangetoond dat het de mobiliteit van fragmenten verandert bij hoge DNA-concentraties, waardoor de betrouwbaarheid van metingen van de fragmentgrootte afneemt.

Kleuring na elektroforese vereist kleinere hoeveelheden ethidiumbromide, en dat heeft de voorkeur, omdat de kleurstof een bekend carcinogeen is en dus problemen oplevert bij blootstelling en verwijdering.

Omdat er verschillende voordelen en geen nadelen zijn aan kleuring na elektroforese, concluderen we dat er geen huidige rechtvaardiging is voor het gebruik van ethidiumbromide in analytische gels.

Identificatie van DNA-patronen

Identification of the DNA pattern of each sample should be carried out very carefully. When analyzed with a single-locus probe, each lane will ideally show at the most fragments derived from two alleles and nothing else. However, complications can arise. To interpret such complications properly, an examiner requires considerable knowledge and skill and might need to examine control experiments.

Examination of a Control Pattern

Every Southern blot procedure should be applied to a known DNA sample (in addition to the evidence samples in question), to verify that the hybridization was performed correctly. If this control sample does not yield

a clean result that shows the correct pattern for a particular hybridization, the result of the test hybridization should be discounted.

Single-Band Patterns

Sometimes, only a single band will be detected when two distinct alleles are present. That might occur because the second allele is so small that it has migrated off the end of the gel, because the second allele is similar in size to the first allele and thus is not resolved, or because the second allele is much larger, and larger fragments are preferentially lost in partially degraded samples.

When only a single band is found, the interpretation should always include the possibility that a second band has been missed&mdashi.e., that the pattern is actually of a heterozygote, not a homozygote. (For statistical interpretation, the frequency of a single-band pattern should be taken to be the sum of the frequencies of all patterns containing this band. This is approximately twice the allele frequency of the band.) In some cases, it could be important to interpret the absence of a second larger fragment&mdashe.g., when two samples match in a smaller band, but the questioned sample lacks a second larger band. That could arise either because the samples are from different persons or because the samples come from the same person but the questioned sample is partially degraded. Ideally, to distinguish these alternatives, one should determine whether a second larger band kon have been detected in the questioned sample by hybridizing the membrane with a single-copy probe that detects an even larger monomorphic fragment&mdashi.e., one that is constant in all humans. In contrast, it would not be sufficient simply to estimate the degree of degradation from the ethidium bromide staining pattern of the sample.

Anomalous Bands

A sample might show more than two bands for various reasons. E.g., the hybridization conditions were improper and caused the probe to hybridize to incorrect fragments the probe was contaminated with another sequence, which caused it to recognize other fragments the membrane was incompletely stripped after a previous use, so a pattern seen on the previous hybridization is still being detected the restriction digestion did not proceed to completion, so the region recognized by the probe is present in incompletely cut fragments of multiple sizes or the sample actually contains a mixture of multiple DNAs. The last example is extremely important to recognize, because it can bear importantly on a case. Whenever extra bands are observed, their origin should be determined.

The following clues provide a partial decision tree:

If the hybridization conditions were improper or the probe contaminated, the pattern in the control DNA should be seen to be incorrect the hybridization should be repeated.

If the membrane was improperly stripped, the extra bands will be in the same location as in the previous hybridization and might be present in the control sample the hybridization should be repeated.

If the restriction digestion was incomplete, one should see additional bands, even with the use of monomorphic probes that typically give only a single constant band. To ascribe extra bands to incomplete digestion, one should therefore perform such a hybridization. If incomplete digestion has occurred, the sample ideally should be re-extracted and redigested, and a new Southern blot should be prepared. If that is not possible, because there is too little sample, it will usually be difficult to get a reliable result.

If the samples are mixtures from more than one person, one should see additional bands for all or most polymorphic probes, but not for a single-copy monomorphic probe. Mixed samples can be very difficult to interpret, because the components can be present in different quantities and states of degradation. It is important to examine the results of multiple RFLPs, as a consistency check. Typically, it will be impossible to distinguish the individual genotypes of each contributor. If a suspect's pattern is found within the mixed pattern, the appropriate frequency to assign such a "match" is the sum of the frequencies of all genotypes that are contained within (i.e., that are a subset of) the mixed pattern.

Another possible cause of extra bands is leakage between adjacent sample lanes or misloading of two samples in a single lane. Such an occurrence can be exceedingly difficult to detect and could result in an incorrect conclusion. It is therefore important to leave a blank lane between a suspect sample and an evidence sample, so that leakage can be detected and will not lead to false-positive results.

Reporting of Anomalies

Examiners should document their interpretations of samples thoroughly in writing. They should note all observed bands and any questionable densities that they do not consider to be bands. Anomalous bands should be explained on the basis of appropriate control experiments of the sorts described above.

Measurement of Fragments

Molecular-weight measurements of fragments should initially be made by comparing band positions with known molecular-weight standards run in separate lanes on the same gel (so-called external molecular-weight stan-

dards). Measurements should be performed with a computer-assisted or computer-automated system, in which the operator identifies the positions of the bands with a digitizing pen or similar device that directly records them, visually inspects them, or both. Computer-based procedures ensure appropriate documentation of the measurement and promote objectivity.

External molecular-weight standards alone, however, are not sufficient, because anomalies in electrophoresis can lead to errors in RFLP typing caused by band shifting. 5 Such anomalies can be due to differences in salt or DNA concentrations among samples (which could be corrected by repeated extraction) or to covalent or noncovalent modifications of the DNA (which might be irreversible). Band shifting could cause two DNA samples from one person to show different patterns or DNA samples from two different persons to show the same pattern. Band shifting also makes it impossible to measure fragment sizes relative to external molecular-weight standards, because the standards have migrated at a different speed.

Band shifting is easy to detect by hybridizing the Southern blot with monomorphic probes&mdashthat is, probes that detect constant-length fragments that are always in the same position in all people. If several monomorphic fragments are in the same position in both lanes, it is safe to assume that no band shifting has occurred. If the monomorphic fragments are in different positions, band shifting is present. The committee considers it desirable for all samples to be tested for band shifting by hybridization with monomorphic probes that cover a wide range of fragment sizes in the gel. That approach will eliminate the rare production of a match by shifting of bands in an evidence sample to the same positions as in a suspect sample. Testing laboratories now investigate the possibility of band shifting only when they find two samples with patterns that appear to be similar but shifted relative to one another. (Multiple monomorphic probes might not be available for some systems and might need to be developed.)

Testing for band shifting is easy, but correcting it is harder. The best approach is to clean the samples (by re-extraction, dialysis, or other measures) and repeat the experiment in the hope of avoiding band shifting. When that is impossible because too little sample is available or it fails (perhaps because of covalent modification of the DNA), it is possible in principle to determine the molecular weights of polymorphic fragments in a sample by comparing them with monomorphic human bands in the same lane&mdashso-called internal molecular-weight standards. These monomorphic fragments are expected to have undergone the same band shift, so they should provide an accurate internal ruler for measurement. (Note that the polymorphic fragments and the internal molecular-weight standards are visualized on separate hybridizations, but can be superimposed on one another, if the external molecular-weight standards are used to align the gels.)

In practice, however, the use of internal standards presents serious dif-

ficulties. Accurate size determination requires a number of internal standards. If band shifting caused all fragments to change their mobility by the same percentage, one would need only a single monomorphic fragment to determine the extent of shift. But band shifting appears to be more complex than that. Different regions of the gel shift by different amounts.

Little has been published on the nature of band shifting, on the number of monomorphic internal control bands needed for reliable correction, and on the accuracy and reproducibility of measurements made with such correction. For the present, several laboratories have decided against attempting quantitative corrections samples that lie outside the match criterion because of apparent band shifting are declared to be "inconclusive." The committee urges further study of the problems associated with band shifting. Until testing laboratories have published adequate studies on the accuracy and reliability of such corrections, we recommend that they adopt the policy of declaring samples that show apparent band shifting to be "inconclusive." The committee recommends that all measurement data be made readily available, including the computer-based images and records. Any analytical software for image processing or molecular-weight determination should also be readily available. All fragment sizes for both known and questioned samples should be clearly listed on the formal report of the testing laboratory.

Match Criteria

Current RFLP-based tests use VNTR probes that have dozens of closely spaced alleles. On the one hand, the high degree of polymorphism increases the power of the test to detect differences among persons. On the other hand, the large number of alleles increases the complexity of matching samples, because gels have little ability to resolve nearby alleles (which can differ by as little as 9 basepairs, so that, for practical purposes, the distribution of alleles can appear to be continuous).

Because of the limited resolution, two samples from a single person will often lead to slightly different measurements&mdashe.g., 3.00 and 2.45 kilo-bases (kb) in one case, 3.03 and 2.40 kb in another. To decide whether two samples match, each laboratory must have a match criterion. 6 The match criterion should provide an objective and quantitative rule for deciding whether two patterns match&mdashe.g., all fragments must lie within 2% of one another. When samples fall outside the match criterion, they should be declared to be "inconclusive" or "nonmatching."

The match criterion must be based on reproducibility studies that show the actual degree of variability observed when multiple samples from the same person are separately prepared and analyzed under typical forensic


Materialen en methodes

Definition of DNAm age using a penalized regression model

Using the training data sets, I used a penalized regression model (implemented in the R package glmnet [45]) to regress a calibrated version of chronological age on 21,369 CpG probes that a) were present both on the Illumina 450K and 27K platform and b) had fewer than 10 missing values. The alpha parameter of glmnet was chosen to 0.5 (elastic net regression) and the lambda value was chosen using cross-validation on the training data (lambda = 0.0226). DNAm age was defined as predicted age. Mathematical details are provided in Additional file 2.

Short description of the healthy tissue data sets

All data are publicly available (Additional file 1). Many data sets involve normal adjacent tissue from TCGA. Details on the individual data sets can be found in Additional file 2. To give credit to the many researchers who generated the data, I briefly mention relevant citations. Data sets 1 and 2 (whole blood samples from a Dutch population) were generated by Roel Ophoff and colleagues [14]. Data set 3 (whole blood) consists of whole blood samples from a recent large scale study of healthy individuals [24]. The authors used these and other data to estimate human aging rates and developed a highly accurate predictor of age based on blood data. Data set 4 consists of leukocyte samples from healthy male children from Children’s Hospital Boston [46]. Data set 5 consists of peripheral blood leukocyte samples [47]. Data set 6 consists of cord blood samples from newborns [30]. Data set 7 consists of cerebellum samples, which were provided by C Liu and C Chen (Gene Expression Omnibus (GEO) identifier GSE38873). Data sets 8, 9, 10, and 13 consist of cerebellum, frontal cortex, pons, and temporal cortex samples, respectively, obtained from the same subjects [48]. Data set 11 consists of prefrontal cortex samples from healthy controls [22]. Data set 12 consists of neuron and glial cell samples from [49]. Data set 14 consists of normal breast tissue samples [50]. Data set 15 consists of buccal cells from 109 15-year-old adolescents from a longitudinal study of child development [51]. Data set 16 consists of buccal cells from eight different subjects [15]. Data set 17 consists of buccal cells from monozygotic (MZ) and dizygotic (DZ) twin pairs from the Peri/postnatal Epigenetic Twins Study (PETS) cohort [52]. Data set 18 consists of cartilage (chondrocyte) samples from [53]. Data set 19 normal consists of adjacent colon tissue from TCGA. Data set 20 consists of colon mucosa samples from [54]. Data set 21 consists of dermal fibroblast samples from [21]. Data set 22 consists of epidermis samples from [55]. Data set 23 consists of gastric tissue samples from [56]. Data set 24 consists of head/neck normal adjacent tissue samples from TCGA (HNSC data). Data set 25 consists of heart tissue samples from [57]. Data set 26 consists of normal adjacent renal papillary tissue from TCGA (KIRP data). Data sets 27 consists of normal adjacent tissue from TCGA (KIRC data). Data set 28 consists of normal adjacent liver samples from [58]. Data set 29 consists of normal adjacent lung tissue from TCGA (LUSC data). Data set 30 consists of normal adjacent lung tissue samples from TCGA (LUAD data). Data set 31 is from TCGA (LUSC). Data set 32 consists of mesenchymal stromal cells isolated from bone marrow [59]. Data set 33 consists of placenta samples from mothers of monozygotic and dizygotic twins [60]. Data set 34 consists of prostate samples from [61]. Data set 35 consists of normal adjacent prostate tissue from TCGA (PRAD data). Data set 36 consists of male saliva samples from [62]. Data set 37 consists of male saliva samples from [23]. Data set 38 consists of stomach from TCGA (STAD data). Data set 39 consists of thyroid TCGA (THCA data). Data set 40 consists of whole blood from type 1 diabetics [10, 63]. Data set 41 consists of whole blood from [15]. Data sets 42 and 43 consist of involve whole blood samples from women with ovarian cancer and healthy controls, respectively these are the samples from the United Kingdom Ovarian Cancer Population Study [10, 63]. Data set 44 consists of whole blood from [64]. Data set 45 consists of leukocytes from healthy children of the Simons Simple Collection [46]. Data set 46 consists of peripheral blood mononuclear cells from [65]. Data set 47 consists of peripheral blood mononuclear cells from [66]. Data set 48 consists of cord blood samples from newborns provided by N Turan and C Sapienza (GEO GSE36812). Data set 49 consists of cord blood mononuclear cells from [67]. Data set 50 consists of cord blood mononuclear cells from [60]. Data set 51 consists of CD4 T cells from infants [68]. Data set 52 consists of CD4+ T cells and CD14+ monocytes from [15]. Data set 53 consists of immortalized B cells and other cells from progeria, Werner syndrome patients, and controls [69]. Data sets 54 and 55 are brain samples from [70]. Data sets 56 and 57 consist of breast tissue from TCGA (27K and 450K platforms, respectively). Data set 58 consists of buccal cells from [71]. Data set 59 consists of colon from TCGA (COAD data). Data set 60 consists of fat (adipose) tissue from [72]. Data set 61 consists of human heart tissue from [27]. Data set 62 consists of kidney (normal adjacent) tissue from TCGA (KIRC). Data set 63 consists of liver (normal adjacent tissue) from TCGA (LIHC data). Data set 64 consists of lung from TCGA. Data set 65 consists of muscle tissue from [72]. Data set 66 consists of muscle tissue from [73]. Data set 67 consists of placenta samples from [74]. Data set 68 consists of female saliva samples [62]. Data set 69 consists of uterine cervix samples from [50, 75]. Data set 70 consists of uterine endometrium (normal adjacent) tissue from TCGA (UCEC data). Data set 71 consists of various human tissues from the ENCODE/HAIB Project (GEO GSE40700). Data set 72 consists of chimpanzee and human tissues from [27]. Data set 73 consists of great ape blood samples from [28]. Data set 74 consists of sperm samples from [76]. Data set 75 consists of sperm samples from [77]. Data set 76 consists of vascular endothelial cells from human umbilical cords from [60]. Data sets 77 and 78 (special cell types) involve human embryonic stem cells, iPS cells, and somatic cell samples measured on the Illumina 27K array and Illumina 450K array, respectively [78]. Data set 79 consists of reprogrammed mesenchymal stromal cells from human bone marrow (iP-MSC), initial mesenchymal stromal cells, and embryonic stem cells [79]. Data set 80 consists of human ES cells and normal primary tissue from [80]. Data set 81 consists of human ES cells from [81]. Data set 82 consists of blood cell type data from [82].

Description of the cancer data sets

An overview of the cancer tissue and cancer cell line data sets is provided in Additional file 12. More details can be found in Additional file 2.

All data are publicly available as can be seen from the column that reports GSE identifiers from the GEO database and other online resources. Most cancer data sets came from TCGA. Data set 3, GBM from [44] data set 4, breast cancer from [83] data set 5, breast cancer from [84] data set 6, breast cancer from [50] data set 10, colorectal cancer from [39] data set 23, prostate cancer from [61] data set 30, urothelial carcinoma from [85].

DNA methylation profiling and normalization steps

All of the public Illumina DNA data were generated by following the standard protocol of Illumina methylation assays, which quantifies DNA methylation levels by the β value. A detailed description of the pre-processing and data normalization steps is provided in Additional file 2.

Meta analysis for measuring pure age effects (irrespective of tissue type)

I used the metaAnalysis R function in the WGCNA R package [86] to measure pure age effects (Additional file 9) as detailed in Additional file 2.

Analysis of variance for measuring tissue variation

To measure tissue effects in the training data (Additional file 8), I used analysis of variance (ANOVA) to calculate an F statistic as follows. First, a multivariate regression model was used to regress each CpG (dependent variable) on age and tissue type. The analysis adjusted for age since the different data sets have very different mean ages (Additional file 1). Next, ANOVA based on the multivariate regression model was used to calculate an F statistic, F.tissueTraining, for measuring the tissue effect in the training data. This F statistic measures the tissue effect after adjusting for age in the training data sets. I did not translate the F statistic into a corresponding P-value since the latter turned out to be extremely significant for most CpGs. Additional file 8D shows that F.tissueTraining is highly correlated with an independent measure of tissue variance (defined using adult somatic tissues from data set 77).

Characterizing the CpGs using sequence properties

I studied occupancy counts for Polycomb-group target (PCGT) genes since they have an increased chance of becoming methylated with age compared to non-targets [10]. Toward this end, I used the occupancy counts of Suz12, Eed, and H3K27me3 published in [87]. To obtain the protein binding site occupancy throughout the entire nonrepeat portion of the human genome, Lee et al. [87] isolated DNA sequences bound to a particular protein of interest (for example, Polycomb-group protein SUZ12) by immunoprecipitating that protein (chromatin immunoprecipitation) and subsequently hybridizing the resulting fragments to a DNA microarray. More details on the chromatin state data from [29] can be found in Additional file 2.


For more information about genetic testing procedures:

The National Society of Genetic Counselors offers an overview of the genetic testing process.

A brief overview of how genetic testing is done is also available from The National Cancer Institute.

The Genetic Science Learning Center at the University of Utah provides an interactive animation of DNA extraction techniques.


Sleutelbegrippen en samenvatting

Functionele groepen are structural units within organic compounds that are defined by specific bonding arrangements between specific atoms. Organic chemist learn to correlate functional groups to the chemistry that they do. For example, any molecule that contains a carboxylic acid, will be able to do an acid-base reaction when mixed with a base. This allows the organic chemist to have a sense of the various chemistry a compound can or cannot do based on the functional groups that are present in the structure.

Werkzaamheid

Make yourself a stack of small sized Qcards. On one side have the name of the functional group (e.g. alcohol) and on the other side have its structure (see Table 1). Make a complete set of all the functional groups you should know (see Table 1). You can even include some compounds like those below in exercise 1 – on one side of the card have the compound, on the other the names of the functional groups. Then use these Qcards to quiz yourself. This will help you recognize the functional groups in larger compounds.

Exercises

1. Answer the following questions for each of these compounds.

a) Name the circled functional groups: A = ?, B =?, C = ?

b) What is the chemical formula of the compound?

c) How many lone pairs are there in the compound?

Phenylpropanolamine is a psychoactive drug which is used as a stimulant and decongestant in prescription and over-the-counter cough and cold medicines.

Triiodothyronine is a thyroid hormone which affects many physiological processes in the body, such as growth, metabolism and heart rate.

aldosteron is a hormone which is involved in the function of the kidneys.

efedrine is a drug commonly used as a stimulant, decongestant and also as a concentration aid.

Clomifene is mainly used for ovarian stimulation in female infertility which is due to anomulation.

2. Among the five compounds listed in question 1, which would do an acid-base reaction when mixed with sodium hydroxide (which is a base).

Phenylpropanolamine:

a) A = Primary Amine, B = Secondary Alcohol, C = Arene

c) 3 lone pairs – one on the nitrogen and two on the oxygen

Triiodothyronine:

a) A = Carboxylic Acid, B = Ether, C = Primary Amine

c) 18 lone pairs – one on each nitrogen, two on each oxygen, and three on each iodine

Aldosterone:

a) A = Secondary Alcohol, B = Aldehyde, C = Ketone

c) 10 lone pairs – two on each oxygen

a) A = Secondary Amine, B = Secondary Alcohol, C = Arene

c) 3 lone pairs – one on the nitrogen and two on the oxygen

a) A = Arene, B = Ether, C = Tertiary Amine

c) 6 lone pairs – one on the nitrogen, two on the oxygen, and three on the chlorine

2. Any molecule that contains a carboxylic acid, will be able to do an acid-base reaction when mixed with a base. Therefore among the five compounds in question 1, the only one that has a carboxylic acid is Triiodothyronine.


Applications of DNA fingerprinting:

Using the DNA fingerprinting method, the biological identity of a person can be revealed. For validating one’s identity, there is no other better option than DNA fingerprinting.

Badly damaged dead bodies can be identified.

It is used to detect maternal cell contamination.

One of the major drawbacks of prenatal diagnosis is maternal cell contamination. The amniotic fluid or CVS sample contains the maternal DNA or maternal tissue, sometimes.

Contamination increases the chance of false-positive results, especially in the case of carrier identification.

Using VNTRs and STRs markers with PCR-gel electrophoresis, maternal cell contamination can be identified during pregnancy genetic testing.

The image represents the VNTR profile for a family to know the maternal cell contamination.

One of the most important applications of the present technique is in the crime scene investigation and criminal verification.

The sample is collected from the crime site which could be saliva, blood, hair follicle, or semen. DNA is extracted and analyzed against the suspect, using the two markers we explained above. By matching DNA band patterns criminal’s link to crime can be established.

Different countries have different criteria to use STRs. 13, 11 and 12 STRs are commonly used in criminal verification in the USA, UK, and India, respectively. As the number of STR markers increases the accuracy of the result also increases.

Identification of blood relatives:

No two individuals are genetically identical. To establish or to know blood relation between two unrelated individuals, the present method is adopted.

Besides these, the present method is often employed for checking graft rejection in case of organ transplantation. Known as HLA typing, different markers of HLA region genes are amplified and matched between donor and recipient.

The exact match score indicates graft acceptance. This means an organ can be transplanted.

Moreover, scientists use the present method to screen inherited & non-inherited disease, to find genetic abnormalities, to detect any genetic disorders or mutations, and to create phylogeny between various organisms.


Identification of linked traits

It is often possible to correlate, or link, an allele of a molecular marker with a particular disease or other trait of interest. One way to make this correlation is to obtain genomic DNA samples from hundreds of individuals with a particular disease, as well as samples from a control population of healthy individuals. The genotype of each individual is scored at hundreds or thousands of molecular marker loci (e.g. SNPs), to find alleles that are usually present in persons with the disease, but not in healthy subjects. The molecular marker is presumed to be tightly linked to the gene that causes the disease, although this protein-coding gene may itself be as yet unknown. The presence of a particular molecular polymorphism may therefore be used to diagnose a disease, or to advise an individual of susceptibility to a disease.

Molecular markers may also be used in a similar way in agriculture to track desired traits. For example, markers can be identified by screening both the traits and molecular marker genotypes of hundreds of individuals. Markers that are linked to desirable traits can then be used during breeding to select varieties with economically useful combinations of traits, even when the genes underlying the traits are not known.


Bekijk de video: Jade twerkt op gio (December 2021).