Informatie

Wolbachia - cytoplasmatische incompatibiliteit


Ik las dat cytoplasmatische incompatibiliteit in Wolbachia optreedt wanneer met wolbachia geïnfecteerde mannelijke insecten paren met wolbachia-vrije vrouwelijke insecten en niet-levensvatbare nakomelingen produceren. Daarentegen produceren met wolbachia geïnfecteerde vrouwelijke gastheren succesvolle nakomelingen, ongeacht de infectiestatus van hun partner.

Ik vroeg me af: wat zijn de langetermijneffecten hiervan op de grootte/structuur van een insectenpopulatie? Hoe zal dit anders zijn dan een niet-geïnfecteerde populatie?


Wolbachia diversiteit en cytoplasmatische incompatibiliteitspatronen in Culex pipiens populaties in Turkije

Wolbachia zijn van de moeder overdraagbare bacteriën die de reproductie van hun gastheren kunnen manipuleren en cytoplasmatische incompatibiliteit (CI) veroorzaken. CI is een incompatibiliteit tussen sperma en ei, resulterend in embryonale dood. Door dit steriliserende effect op muggen, Wolbachia worden overwogen voor vectorbestrijdingsstrategieën. Belangrijke vectoren voor arbovirussen, filariale nematoden en aviaire malaria, muggen van Culex pipiens complex zijn geschikt voor: Wolbachia-gebaseerde vectorcontrole. Ze zijn besmet met Wolbachia metPip-stammen die behoren tot vijf genetisch verschillende groepen (met wiePip-I tot V) binnen de Wolbachia B supergroep. CI-eigenschappen van met wiePip correleert sterk met deze genetische diversiteit: muggen besmet met met wiePip-soorten van een andere met wiePip-groep zijn meer kans om onverenigbaar met elkaar te zijn. Turkije is een kritieke plek voor door vectoren overgedragen ziekten vanwege zijn unieke geografische ligging als natuurlijke brug tussen Azië, Europa en Afrika. Echter, algemeen met wiePip-diversiteit, distributie en CI-patronen in natuurlijk Cx. pipiens (s.ik.) populaties in de regio zijn onbekend. In deze studie identificeerden we voor het eerst met wiePip diversiteit in het Turks Cx. pipiens (s.ik.) populaties, door ze toe te wijzen aan een van de vijf groepen binnen met wiepip (met wiePip-Ito V). We hebben CI-eigenschappen tussen verschillende met wiePip-soorten uit deze regio.

Resultaten

We toonden een met wiePip fixatie in Cx. pipiens (s.ik.) populaties in Turkije door 753 monsters van 59 monsterlocaties te analyseren. Drie met wiePip-groepen werden gedetecteerd in de regio: met wiePip-I, metPip-II en met wiePip-IV. De meest dominante groep was met wiePip-II. Terwijl met wiePip-IV was beperkt tot slechts twee locaties, met wiePip-I en met wiePip-II had bredere distributies. Personen besmet met met wiePip-II bleek samen te bestaan ​​met individuen die besmet waren met met wiePip-I of met wiePip-IV op sommige bemonsteringslocaties. Twee isofemale muggenlijnen die ofwel een met wiePip-I of a met wiePip-II-stam werd vastgesteld uit een populatie in het noordwesten van Turkije. Wederzijdse kruisingen tussen deze lijnen toonden aan dat ze volledig compatibel waren met elkaar, maar bidirectioneel onverenigbaar met met wiePip-IV Istanbul besmette lijn.

Conclusie

Onze bevindingen laten een grote diversiteit aan met wiePip- en CI-eigenschappen in Cx. pipiens (s.ik.) bevolking in Turkije. Kennis over natuurlijk voorkomende CI-patronen veroorzaakt door: met wiePip-diversiteit in Turkije kan nuttig zijn voor Cx. pipiens (s.ik.) controle in de regio.


Wolbachia-infectie en cytoplasmatische incompatibiliteit bij Drosophila-soorten

Eenenveertig voorraden van 30 Drosophila-soorten werden onderzocht op Wolbachia-infectie met behulp van PCR-technologie. D. sechellia en twee stammen van D. auraria bleken geïnfecteerd te zijn en werden getest op de expressie van cytoplasmatische incompatibiliteit, samen met de stammen D. ananassae en D. melanogaster, waarvan al bekend is dat ze geïnfecteerd zijn. D. ananassae en D. melanogaster vertonen niveaus van onverenigbaarheid tot 25%, terwijl D. auraria en D. sechellia niveaus van eiersterfte vertonen van ongeveer 60%. Een dot-blot-assay met behulp van de dnaA-sequentie als sonde werd ontwikkeld om de infectieniveaus bij individuele mannetjes te beoordelen die werden gebruikt bij incompatibiliteitskruisen. Er werd een positieve correlatie tussen bacteriële dichtheid en cytoplasmatische incompatibiliteit waargenomen. De onderzochte voorraden kunnen worden geclusterd in ten minste twee groepen, afhankelijk van de infectieniveaus in verhouding tot de mate van cytoplasmatische incompatibiliteit die wordt vertoond. Eén groep, die D. simulans Hawaii, D. sechellia en D. auraria bevat, vertoont hoge niveaus van cytoplasmatische incompatibiliteit ten opzichte van infectieniveaus, alle andere soorten en D. simulans Riverside vertonen significant lagere niveaus van cytoplasmatische incompatibiliteit ten opzichte van infectieniveaus . Deze gegevens tonen aan dat, naast bacteriële dichtheid, bacteriële en/of gastheerfactoren ook de expressie van cytoplasmatische incompatibiliteit beïnvloeden.


Op het mechanisme van Wolbachia-geïnduceerde cytoplasmatische incompatibiliteit: de modellen confronteren met de feiten

De endocellulaire bacterie Wolbachia manipuleert de reproductie van zijn geleedpotige gastheren voor zijn eigen voordeel op verschillende manieren, de meest voorkomende is cytoplasmatische incompatibiliteit (CI). Tot op heden is het moleculaire mechanisme dat betrokken is bij CI niet opgehelderd. We onderzoeken hier drie verschillende CI-modellen die in eerdere literatuur zijn beschreven, namelijk de "lock-and-key", "titratie-restitutie" en "slow-motion" modellen. We confronteren ze met het volledige scala aan CI-patronen die tot nu toe zijn ontdekt, inclusief de meest complexe zoals meerdere infecties, asymmetrische en gedeeltelijke compatibiliteitsrelaties en het bestaan ​​van Wolbachia varianten die de host van CI kunnen redden, maar niet induceren. We concluderen dat het lock-and-key-model het meest spaarzame model is en het beste past bij de waarnemingen. De twee andere modellen kunnen niet categorisch ongeldig worden verklaard, maar ze stuiten op enkele moeilijkheden die aanvullende hypothesen noodzakelijk maken. BioEssays 25:259–265, 2003. © 2003 Wiley Periodicals, Inc.


Materialen en methodes

Soorten bestuderen

De impact van mannelijke leeftijd en paringssnelheid op CI-inductie en spermaoverdracht werd onderzocht in D. simulans. Vliegen besmet met de Rivieroever van Wolbachia deformatie (wRi) werden oorspronkelijk verzameld in Riverside, Californië (VS), en sinds 2003 in grote laboratoriumpopulaties gehouden (verkregen van G. Hurst, UCL, die afkomstig zijn van de Riverside '89-stam zoals beschreven in Hoffmann et al., 1990 ). Niet-geïnfecteerde vliegen werden verkregen door behandeling met antibiotica (tetracyclinehydrochloride) van grote aantallen geïnfecteerde vliegen, ten minste 2 jaar vóór het experiment. Het grote aantal individuen dat betrokken is bij het infectie-eliminatieproces betekent dat het onwaarschijnlijk is dat de niet-geïnfecteerde populatie lijdt aan inteeltdepressie of in genetische achtergrond verschilt van de geïnfecteerde populatie. Eventuele verschillen tussen de geïnfecteerde en niet-geïnfecteerde populaties zijn dus waarschijnlijk te wijten aan de aanwezigheid/afwezigheid van Wolbachia. Zowel geïnfecteerde als niet-geïnfecteerde populaties werden onder dezelfde omstandigheden bij 25°C gehouden in een licht/donkercyclus van 12:12 uur met een constante toevoer van voedsel en medium om eieren te leggen.

De infectiestatus van vliegen van zowel geïnfecteerde als niet-geïnfecteerde populaties werd bevestigd door polymerasekettingreactie (PCR). Universeel Wolbachia-specifieke primers (Wsp 81F en Wsp 691R) werden gebruikt. De infectiestatus werd voor en na het experiment bevestigd met behulp van de procedure zoals beschreven in Champion De Crespigny et al. (2006). De verwachte infectiestatus werd in alle gevallen bevestigd.

Verzameling van eieren en larven

Eieren werden verzameld uit voorraadpopulaties door kleine petrischalen met een standaard eierlegmedium (12,5 g agarose, 275 ml gedeïoniseerd water, 150 ml druivensap en 0,5 g Nipagin) en 0,5 g gistpasta in de populatiekooien te plaatsen. De hoeveelheid gist werd gecontroleerd voor het geval dit de mannelijke spermatogenese beïnvloedde. Eieren werden gedurende 8 opeenvolgende dagen elke 24 uur verzameld. De larven werden 's morgens verzameld met een metalen aanwijzer en in flesjes gedaan met 15 ml Drosophila medium. Ze werden gekweekt op standaard lage gist Drosophila medium (10 g agarose, 20 g gist, 85 g kristalsuiker, 60 g maïs, 1000 ml gedeïoniseerd water en 1 g Nipagin). Er werden slechts 25 individuele larven in elk flesje gedaan om de dichtheid van de larven te controleren en ervoor te zorgen dat de larven ad libitum voedsel tijdens het opfokproces. De vliegen werden gekweekt in een licht/donkercyclus van 12:12 uur. Dagelijks werden ongeveer 500 larven van elke infectiestatus verzameld.

Verzamelen en seksen voor volwassenen

Ongeveer 8-9 dagen nadat de eieren waren gelegd, begonnen de volwassenen te sluiten. De flesjes werden elke 6 uur (drie keer tijdens de lichtcyclus) geïnspecteerd op nieuw afgesloten vliegen. Nieuwe volwassenen werden op ijs gekoeld, gesekst en de geslachten werden in afzonderlijke flesjes met Drosophila medium met 40 individuen per injectieflacon. Dit proces zorgde ervoor dat alle volwassen vliegen aan het begin van het experiment maagd waren. Zowel mannelijke als vrouwelijke vliegen werden bij 25°C gehouden in een licht/donkercyclus van 12:12 uur.

CI CI Inductie-experiment

Om de impact van paringsgeschiedenis en mannelijke leeftijd op CI-inductie te onderzoeken, werden de paringssnelheid van de man en de paringsgeschiedenis zorgvuldig gemanipuleerd. Om de impact van paringssnelheid op CI te onderzoeken en om de impact van paringssnelheid te onderscheiden van de impact van veroudering, werden drie verschillende behandelingen gebruikt. Ten eerste werden, om het effect van mannelijke leeftijd op CI-inductie te controleren, maagdelijke geïnfecteerde mannen van 5, 6, 7, 8 of 11 dagen oud gepaard met maagdelijke niet-geïnfecteerde vrouwtjes en CI/uitkomensucces gescoord (zie hieronder voor procedure en ook Tabel 1 ) (slechts één paring voor elk mannetje op een bepaalde leeftijd). Deze behandeling wordt ‘senescentiecontrole – SC’ genoemd. Bij de tweede behandeling - lage paringssnelheid (LMR), paren mannetjes met een enkele maagdelijke niet-geïnfecteerde vrouw toen ze respectievelijk 4, 5, 6, 7, 8 en 11 dagen oud waren (6 paringen in totaal voor elke individuele man), en CI/uitkomensucces gescoord voor elk van deze paringen (zie hieronder). In de laatste behandeling - hoge paringssnelheid (HMR), werden mannetjes gedekt door drie maagdelijke niet-geïnfecteerde vrouwtjes toen ze 4, 5, 6, 7, 8 waren en één paring toen ze 11 dagen oud waren (16 paringen in totaal voor elk individueel mannetje ). Alleen het eerste vrouwtje waarmee een HMR-mannetje elke dag parde, werd gebruikt om CI/uitkomstsucces te scoren.

behandelingen mannen Steekproefgrootte: Paringsgeschiedenis van mannen
Senescentie mannen Besmet 15 per leeftijd Maagdelijke reu en een enkele dekking per dag
niet geïnfecteerd 15 per leeftijd Maagdelijke reu en een enkele dekking per dag
Lage paringssnelheid Besmet 20 6 paringen in totaal per man
niet geïnfecteerd 20 6 paringen in totaal per man
Hoge paringssnelheid Besmet 25 16 paringen in totaal per man
niet geïnfecteerd 25 16 paringen in totaal per mannetje

Aan het begin van het experiment werden 3 dagen oude mannelijke vliegen in paringsflesjes van 7, 5 x 2, 5 cm (één mannetje / flesje) gedaan. Ze werden willekeurig verdeeld in SC-, LMR- en HMR-behandelingen met een steekproefomvang van respectievelijk 15, 20 en 25 vliegen. Voor de SC-behandeling was de steekproefomvang 15 mannen van elke individuele leeftijd. Enkele maagdelijke niet-geïnfecteerde vrouwelijke vliegen (4-5 dagen oud) werden aan elk flesje toegevoegd aan het begin van de paringen van elke dag (volgens de behandeling) en werden verwijderd nadat de copulatie was voltooid. We registreerden de tijd dat mannetjes begonnen te paren (TSM) en de tijd dat mannetjes klaar waren met paren (TFM). Zodra de paring klaar was, werden vrouwelijke vliegen overgebracht naar een gekleurde lage gist Drosophila medium tot oviposit. Eieren werden 24 uur bij 25°C geïncubeerd in een licht/donkercyclus van 12:12 uur. 24 uur later werden TFM-vrouwtjes verwijderd, ingevroren en de infectiestatus van de vrouwtjes werd later bevestigd door PCR. De eieren die de vrouwtjes in de 24 uur na de paring legden, werden twee keer geteld: 48 en 72 uur na TFM. Na 72 uur werden echter alleen de niet-uitgekomen eieren geteld.

Het percentage van alle eieren dat door elk individueel vrouwtje in de periode van 24 uur na de paring is gelegd en dat vervolgens is uitgekomen, wordt broedsucces genoemd. Het succespercentage van het uitkomen werd gebruikt als een meting van de CI-expressie. Volledige CI-expressie zou resulteren in 0% arceringssucces. Een toename van het percentage eieren dat uitkwam, betekent een afname van de CI-expressie en een herstel van reproductieve compatibiliteit. CI is dus negatief gerelateerd aan broedsucces.

Sperma overdracht experiment

Behandelingen en paringsprocedure

Drie geïnfecteerde en drie niet-geïnfecteerde behandelingen (tabel 1) werden gebruikt om de effecten van infectiestatus, mannelijke leeftijd en paringssnelheid op het aantal sperma dat bij copulatie op een vrouw werd overgedragen, te onderzoeken. In alle gevallen waren de vrouwtjes niet besmet met Wolbachia. Geïnfecteerde en niet-geïnfecteerde mannen werden willekeurig toegewezen aan SC-, LMR- en HMR-behandelingen (volgens het eerder beschreven CI-inductie-experiment) (Tabel 1) met steekproefgroottes van respectievelijk 15, 20 en 25 vliegen voor elke behandeling. Net als bij het CI-inductie-experiment werden mannetjes van 4, 5, 6, 7, 8 en 11 dagen oud en niet-geïnfecteerde vrouwtjes van 4-5 dagen gebruikt. Aan het begin van elke dag van het experiment werden enkele vrouwelijke vliegen toegevoegd aan het flesje van elk mannetje. TSM en TFM werden opgenomen. Zodra de paring was voltooid, werden de vrouwelijke vliegen overgebracht naar Eppendorf-buizen en 40 minuten na TFM in vloeibare stikstof ingevroren. De vrouwtjes werden vervolgens overgebracht naar een vriezer van -80 ° C voor latere dissectie.

Sperma wordt opgeslagen in de zaadopvangbak (SR) van de vrouw en haar gepaarde spermathecae (Gillott, 2005). Het exacte tijdstip waarop de spermaopslag begint, was niet bekend D. simulans. In een afzonderlijke studie voorafgaand aan dit experiment hebben we de optimale tijd bepaald om sperma in de baarmoeder van de vrouwtjes te tellen voorafgaand aan opslag in de SR en spermathecae van de vrouwtjes (gegevens niet weergegeven). Het tellen van sperma in de baarmoeder verdient de voorkeur vanwege de moeilijkheden die gepaard gaan met het ontleden van de SR en spermathecae. De baarmoeder bevatte de grootste aantallen sperma 40 minuten na het einde van de paring. Daarom werden vrouwtjes 40 minuten na TFM in dit experiment in vloeibare stikstof ingevroren.

Dissectie en procedure voor het tellen van sperma

Bevroren vrouwelijke vliegen werden gedurende ten minste 10 minuten bij kamertemperatuur ontdooid vóór dissectie, omdat rehydratatie hielp om spermabundels beter te dissociëren in individueel sperma. Het vrouwelijke voortplantingssysteem bevindt zich aan de ventrale achterkant van de buik en de baarmoeder aan het achterste uiteinde van het voortplantingssysteem (Wilt & Hake, 2003). Een fosfaatbufferoplossing (PBS) werd gebruikt als basismedium om sperma te bewaren. 50 L PBS werd op een microscopisch glaasje gepipetteerd. De vrouwelijke vlieg werd naast de PBS onder een dissectiemicroscoop geplaatst. Het lichaam werd voorzichtig met een pincet samengeknepen om uit de koker van de legboor te steken die met een fijn pincet was uitgetrokken. De baarmoeder werd onmiddellijk in PBS geplaatst. Fijne dissectienaalden werden gebruikt om de cirkelvormige organen aan het voorste uiteinde van de baarmoeder af te snijden. Een naald werd gebruikt om het andere uiteinde van de snede vast te houden en met een andere naald werd het sperma eruit geperst. De vrouwelijke delen werden verwijderd en het sperma werd gemengd met PBS. Een extra hoeveelheid van 50 L PBS werd toegevoegd en gemengd. De objectglaasjes werden 24 uur gelaten om te drogen voordat ze gedurende 10 seconden tweemaal in gedeïoniseerd water werden ondergedompeld. De objectglaasjes werden nog 24 uur afgedekt onder een hoek van ongeveer 45° gelaten. Het sperma werd geteld onder een donker veld bij een vergroting van 100 x. Zowel zaadbundels als individuele zaadcellen werden geteld. Elke bundel bevat 64 zaadcellen (Snook et al., 2000 ).

Statistieken

Anova met herhaalde metingen werd gebruikt om de effecten van mannelijke leeftijd en paringsgeschiedenis op CI-inductie en de effecten van infectiestatus, mannelijke leeftijd en paringsgeschiedenis op het aantal sperma dat tijdens copulatie werd overgedragen te onderzoeken (zie tabel 1). Bonferroni-correcties werden toegepast op alle anova met herhaalde metingen om te controleren voor meerdere vergelijkingen. Daarnaast is er een aanpassing gedaan aan het aantal vrijheidsgraden van de leeftijden in het CI-inductie-experiment van Greenhouse-Giesser vanwege geschonden sfericiteit (Greenhouse & Geisser, 1959). Homogeniteit van hellingen tussen paringsgeschiedenisbehandelingen werd vergeleken door ancova in het CI-inductie-experiment. De gegevens worden weergegeven als gemiddelde ± SE. SPSS versie 20 werd gebruikt om de gegevens te analyseren.


Toegangsopties

Krijg volledige toegang tot tijdschriften voor 1 jaar

Alle prijzen zijn NET prijzen.
De btw wordt later bij het afrekenen toegevoegd.
De belastingberekening wordt definitief tijdens het afrekenen.

Krijg beperkte of volledige toegang tot artikelen op ReadCube.

Alle prijzen zijn NET prijzen.


Mannelijke leeftijd en Wolbachia dynamica: bepalen hoe snel en waarom bacteriële dichtheden en cytoplasmatische incompatibiliteitssterkten variëren

Endosymbiotisch Wolbachia bacteriën infecteren uiteenlopende gastheren van geleedpotigen en nematoden. Veel stammen veroorzaken cytoplasmatische incompatibiliteit (CI) die niet-geïnfecteerde embryo's doodt die zijn bevrucht door Wolbachia-gemodificeerd sperma. Geïnfecteerde embryo's worden beschermd tegen CI, waardoor Wolbachia verspreid naar hoge evenwichtsfrequenties in evenwicht gehouden door onvolmaakte maternale transmissie. CI-sterkte varieert sterk van aard en heeft de neiging af te nemen naarmate mannen ouder worden. Het begrijpen van de oorzaken van CI-sterktevariatie is cruciaal om uit te leggen Wolbachia prevalentie in gastpopulaties. Hier onderzoeken we hoe snel en waarom de CI-sterkte afneemt met de leeftijd van de man in twee modelsystemen: met wieMel in Drosophila melanogaster en met wieRi in D. simulans. Gemiddeld met wieMel CI-sterkte neemt snel af (19%/dag), en met wieRi CI-sterkte neemt langzaam af (6%/dag) naarmate mannen ouder worden, dus binnen drie dagen, met wieMel-geïnfecteerde mannen veroorzaken geen CI, terwijl twaalf dagen oude met wieRi-geïnfecteerde mannen veroorzaken nog steeds een kleine, maar significante, CI. We hebben getest of verlagingen in Wolbachia dichtheden of CI-genexpressie naarmate mannen ouder worden, zou dit patroon kunnen verklaren. Inderdaad, met wieRi-dichtheden en CI-genexpressie nemen af ​​in teelballen naarmate mannen ouder worden, maar met wieMel-dichtheden en CI-genexpressie nemen verrassend genoeg toe met de leeftijd van de man naarmate de CI-sterkte afneemt. Faag WO lytische activiteit en met wieMel Octomom-kopienummer - een ampliconisch gengebied dat van invloed is op met wieMel-proliferatie - verklaar niet leeftijdsafhankelijk Wolbachia dichtheden. De expressie van Relish, een essentieel gen in de Drosophila immuundeficiëntieroute, correleert sterk met met wieMel dichtheden. Samen suggereren deze resultaten dat testikels in de hele Wolbachia dichtheid en CI-genexpressie zijn onvoldoende om leeftijdsafhankelijke CI-sterkte tussen stammen te verklaren en dat: Wolbachia dichtheid wordt variabel beïnvloed door de mannelijke leeftijd over Wolbachia-gastverenigingen. We veronderstellen dat gastheerimmuniteit ten grondslag kan liggen aan variatie in leeftijdsafhankelijke dichtheidsdynamiek. Meer in het algemeen, de snelle daling van met wieMel CI sterkte tijdens de eerste week van D. melanogaster het leven draagt ​​er waarschijnlijk toe bij met wieMel-frequentievariatie waargenomen op verschillende continenten.


Deze experimenten tonen aan dat, na behandeling met antibiotica om te verwijderen Wolbachia, N. giraulti en N. longicornis kunnen kruisen om gezonde nakomelingen te produceren zonder bewijs van F1/F2 letaliteit, onvruchtbaarheid of hybride ziekte. Wolbachia-geïnduceerde cytoplasmatische incompatibiliteit lijkt dus vooraf te zijn gegaan aan andere isolerende mechanismen. Hoewel deze experimenten een zekere mate van gedeeltelijke isolatie vóór de paring in één richting laten zien, is de bijdrage van Wolbachia lijkt de belangrijkste biologische barrière voor kruisingen te zijn.

Microbiële isolatie zou mogelijk een snelle evolutionaire kracht kunnen bieden die de klassieke elementen van mutatie en genetische drift inhaalt. Door hun aard zijn evolutietheorieën echter bijna onmogelijk te bewijzen, en tot nu toe is er weinig bewijs voor infectieuze soortvorming in het wild. In plaats daarvan zullen kenmerken zoals geografische isolatie waarschijnlijk een grote rol spelen. Andere kwalificerende factoren die werken op het niveau van: Wolbachia parasieten zelf omvatten natuurlijke variaties in de penetrantie en overdracht van infectie, die beide een zekere mate van genenstroom tussen gastheerpopulaties mogelijk zouden maken. Horizontale transmissie van Wolbachia tussen gastheren zou ook werken om de effecten van cytoplasmatische incompatibiliteit om te keren. Maar de bevindingen van deze studie en de alomtegenwoordigheid van Wolbachia infectie in de natuur geeft aan dat CI de soortvorming zou kunnen versterken in plaats van deze rechtstreeks aan te drijven. Lopende studies hebben al andere bacteriën geïdentificeerd die CI kunnen induceren en de mogelijke biologische invloeden van dergelijke infecties zouden binnenkort veel duidelijker moeten worden.


Invoering

Voortplantingsparasieten zoals intracellulaire bacteriën Wolbachia manipuleren het voortplantingssysteem van hun gastheren in hun eigen voordeel. Meestal, Wolbachia incompatibiliteit tussen sperma en ei veroorzaken, bekend als cytoplasmatische incompatibiliteit (zie [1], [2] voor beoordelingen). In combinatie met geografische of genetische barrières voor de genenstroom, zou een dergelijke cytoplasmatische incompatibiliteit (CI) de evolutie van reproductieve isolatie kunnen bevorderen, een cruciale component in soortvorming [3]-[6]. Wolbachia zijn wijdverspreid in geleedpotigen, met naar schatting 20% ​​tot 70% insectensoorten geïnfecteerd met de bacteriën [7]-[9]. Vandaar het aanpakken van de vraag of Wolbachia de soortvormingsprocessen van zijn gastheren beïnvloedt, is een belangrijke vraag. Hier onderzoeken we theoretisch het effect van unidirectionele CI op soortvorming. Onze modelleringsaanpak is in overeenstemming met de theoretische literatuur over zowel soortvorming door versterking als de invasie van modifiers van paring (bijv. [10]-[13]).

Cytoplasmatische incompatibiliteit (CI) is een paringsincompatibiliteit die wordt veroorzaakt door: Wolbachia (zie [14] voor een recensie). Het wordt cytoplasmatisch genoemd omdat: Wolbachia wordt overgedragen van de moeder via het cytoplasma van het ei op de nakomelingen. Er zijn twee basisvormen. Unidirectionele CI omvat één Wolbachia deformatie. Als de vader besmet is met Wolbachia dan hebben paringen met niet-geïnfecteerde vrouwtjes (of vrouwtjes die met een andere stam zijn geïnfecteerd) een verminderd aantal overlevende nakomelingen in vergelijking met andere mogelijke paringen. Dit komt door een incompatibiliteit tussen ei en sperma [15]. Bidirectionele CI wordt veroorzaakt door twee Wolbachia stammen en kunnen optreden wanneer parende partners zijn geïnfecteerd met verschillende stammen.

Cytoplasmatische incompatibiliteit heeft de aandacht getrokken als een mogelijk mechanisme voor snelle soortvorming [1], [3], [4], [6], [16]–[18]. Het basisidee is dat CI de genenstroom tussen populaties vermindert, waardoor genetische divergentie mogelijk wordt en selectie wordt gemaakt voor isolatie voorafgaand aan de paring. In het geval van bidirectionele CI is er zowel empirisch als theoretisch bewijs dat deze opvatting ondersteunt. Veldstudies tonen aan dat veel insectensoorten verschillende stammen van Wolbachia, vaak in verschillende geografische regio's [19]–[22]. Verder suggereren kruisingsexperimenten dat bidirectionele CI een belangrijke isolatiefactor is tussen sommige stammen en nauw verwante soorten [4], [5], [17], [23]-[25]. Theoretisch is aangetoond dat twee Wolbachia stammen stabiel naast elkaar kunnen bestaan ​​in parapatrische gastheerpopulaties in het licht van substantiële migratie [26], en dat bidirectionele CI de genenstroom van lokaal aangepaste allelen vermindert en selecteert voor voorafgaande isolatie, zelfs als de overdracht van Wolbachia en het niveau van incompatibiliteit is onvolledig [6], [27], [28].

Echter, de opvatting dat Wolbachia zijn significante factoren in de soortvorming van geleedpotigen is controversieel [3], [18], [29]-[32]. Veelgehoorde kritiek is dat bidirectionele CI (de modus die het duidelijkst wederzijdse reducties in gene flow kan bevorderen) ongebruikelijk van aard zal zijn, dat niveaus van CI onvoldoende zijn om genetische divergentie mogelijk te maken, en dat CI niet effectief is in het bevorderen van de evolutie van premating van isolatie .

Unidirectionele CI komt waarschijnlijk vaker voor in de natuur, omdat het vereist dat slechts één populatie wordt geïnfecteerd met Wolbachia. Er wordt echter over het algemeen niet aangenomen dat unidirectionele CI soortvorming in gastheren bevordert, omdat verwacht wordt dat het in stand houden van geïnfecteerde en niet-geïnfecteerde populaties onstabiel is in aanwezigheid van migratie. Daarom zouden CI-verschillen niet blijven bestaan ​​en zou genstroom verschillen tussen uiteenlopende populaties elimineren. Een prominent voorbeeld van de instabiliteit van unidirectionele CI is de snelle verspreiding van Wolbachia in Drosophila simulans van Californië [33]. In andere veldstudies zijn echter gemengde infecties waargenomen tussen populaties van een soort [5], [34], [35]. Een voorbeeld is de afwezigheid van Wolbachia in invasieve populaties vuurmieren in Noord-Amerika, maar aanwezigheid van infecties in bronpopulaties in Zuid-Amerika [5]. Het omgekeerde patroon wordt ook gevonden, aanwezigheid van Wolbachia in wereldwijd gedistribueerd Culex pipiens maar de afwezigheid ervan in een kleinere potentiële bronpopulatie in Zuid-Afrika [35]. Verder in paddenstoelenvoeding Drosophila unidirectionele CI tussen een nauw verwante geïnfecteerde en niet-geïnfecteerde soort kan een belangrijke factor zijn voor genetische isolatie [5], [36]. Versterking van reproductieve isolatie lijkt op te treden in de contactzone. Deze experimentele studies geven aan dat verdere modellering van de dynamiek van unidirectionele CI en de mogelijke rol ervan bij het bevorderen van reproductieve isolatie nodig is. De fundamentele vraag is of er voorwaarden zijn waaronder unidirectionele CI een stabiel infectiepatroon kan creëren en of dit selecteert voor genetische divergentie en premating-isolatie. Tot nu toe is er één theoretische studie die deze vraag beantwoordt. Flor et al. [37] heeft analytisch aangetoond dat geïnfecteerde en niet-geïnfecteerde parapatrische gastheerpopulaties stabiel naast elkaar kunnen bestaan ​​als de migratie onder een kritische migratiesnelheid ligt. De kritische migratiesnelheid bleek positief te zijn als Wolbachia veroorzaakt ofwel een vermindering van de vruchtbaarheid in de gastheer of de overdracht ervan is onvolledig.

In de huidige studie onderzoeken we de rol van Wolbachia-geïnduceerde unidirectionele CI op gastheerspeciatie meer in het algemeen. We beschouwen eerst de omstandigheden die het mogelijk maken om infectieverschillen tussen een geïnfecteerd vasteland en een aanvankelijk niet-geïnfecteerde eilandpopulatie in stand te houden in aanwezigheid van unidirectionele migratie en lokale aanpassing. We volgen dan Telschow et al. [6] en combineer modellen voor de Wolbachia dynamics [27], [38] met een goed bestudeerd versterkingsmodel [13]. Met dit nieuwe model kunnen we het effect van unidirectionele CI op genetische divergentie van de gastheer onderzoeken. We beschouwen selectie als handelend op een kleine (aanvankelijk niet-geïnfecteerde) eilandpopulatie die migratie ervaart van een grote (geïnfecteerde) vastelandpopulatie. Het model omvat een partnervoorkeurlocus, een mannelijke eigenschaplocus die uiteenlopende selectie ondergaat in de twee populaties, en cytoplasmatische incompatibiliteit. In de huidige studie laten we zien dat eilandpopulaties met een lage Wolbachia infectiefrequenties kunnen de lokale adaptatie in het licht van migratie beter handhaven dan eilandpopulaties met een infectie. Wanneer ze worden gecombineerd, zijn lokaal aangepaste allelen en verschillen in infectie beide stabiel bij hogere migratiesnelheden dan elk afzonderlijk zou zijn. Bovendien zorgt het infectieverschil tussen het vasteland en het eiland ervoor dat premating-isolatie gemakkelijker kan evolueren. De resultaten suggereren dat, als zich terugkerende perifere populaties voordoen, het degenen zijn die hun Wolbachia die meer kans hebben om te divergeren naar nieuwe soorten, en die unidirectionele CI kan selecteren voor isolatie voorafgaand aan de paring door versterking van partnerdiscriminatie.


Materialen en methodes

Sequentie-uitlijning en structuurvoorspelling.

Meerdere sequentie-uitlijningen van CinB-orthologen van verschillende Wolbachia stammen en bekende PD-(D/E)xK-nucleasen werden gegenereerd met behulp van het Cluster Omega Multiple Sequence Alignment-programma van EMBL-EBI, gevolgd door handmatige aanpassing (33). Secundaire structuurvoorspellingen en uitlijningen van de eiwitsequenties werden uitgevoerd met behulp van het PSIPRED Protein Sequence Analysis Workbench-programma (34). Structuurvoorspelling van CinB met wiePip is gedaan met behulp van de RaptorX Structure Prediction-server met een paar ongestructureerde regio's verwijderd in SI-bijlage, Afb. S1 (35).

Westerse immunoblotting.

De volgende antilichamen werden gebruikt: muis anti-FLAG M2 (Sigma 1:10.000), muis 16B12 anti-HA (Covance 1:1.000), muis anti-PGK (Molecular Probes 1:20.000), en mierikswortelperoxidase (HRP)-geconjugeerd schapen-anti-muis NA931V (GE Healthcare 1: 10.000). Eiwitmonsters werden gescheiden door SDS/PAGE en overgebracht naar PVDF-membranen (Millipore) voor immunoblotting. Eiwitten werden zichtbaar gemaakt door op HRP gebaseerde chemiluminescentie (36).

Zuivering van eiwitten voor in vitro nuclease-assays en ITC.

CinB van volledige lengte, katalytisch inactieve CinB-mutanten (K279A, K636A en KK279/636AA), CidB1–761(V686E/R688K) en CinA werden uitgedrukt als GST-fusies van de pGEX6P1-vector in Rosetta DE3 (Novagen) E coli zoals eerder beschreven (9). Om de kans op co-purificatie van CinB met DNA te verkleinen, hebben we een protocol gebruikt om DNA-vrij eiwit te isoleren dat is beschreven door Epling et al. (25) (SI-bijlage, Materialen en methodes).

Isotherme titratiecalorimetrie.

ITC-experimenten werden uitgevoerd bij 25 ° C met behulp van een NanoITC (TA Instruments). Ten eerste, CinA met wiePip en CinB met wiePip werd uitgebreid gedialyseerd tegen een buffer van 50 mM Hepes (pH 7,4) in de loop van 2 dagen met 3 of 4 bufferuitwisselingen. Om de bindingsaffiniteit van CinB voor CinA te bepalen, werd 500 M CinA in een spuit geladen en getitreerd in een 50 M-oplossing van CinB. In de loop van het experiment werden in totaal 22 injecties (2 L per injectie) uitgevoerd met een tussenruimte van 300 s tussen injecties om een ​​terugkeer naar de basislijn vóór de volgende injectie te garanderen. De gegevens werden op basislijn gecorrigeerd met behulp van NITPIC en geanalyseerd in SEDPHAT met behulp van het 1-site (A + B → AB) bindingsmodel. Figuur 3 is opgesteld in GUSSI, dat is gedownload van de MBR-softwarepagina (//biophysics.swmed.edu/MBR/software.html) (37 -39).

Nuclease-assays.

Alle in vitro nuclease-activiteitstesten werden uitgevoerd met CinB . van volledige lengte met wiePip (resten 1 tot 733) met of zonder CinA met wiePip (resten 1 tot 446). Voor DNase- en RNase-activiteitsassays werden 1 μM CinB- of CinB-mutante eiwitten geïncubeerd in een reactiebuffer met 20 mM Hepes (pH 8,0), 5 mM MgCl2, 2,5% sucrose, 150 mM NaCl, 0,001% Triton X-100 en 2 mM DTT met 15 nM gelineariseerd of supercoiled pBluescript SK+, 500 nM enkelstrengs of dubbelstrengs Cy5-gelabeld DNA [70-meer: ​​Cy5- GCAATTCGATCGTTGACATCTCGCGTGCTCGGTCAATCGGCAGATGCGGAGTGAAGTTCCAACGTTCGGC-3′, eerder gebruikt voor ssDNA-splitsingsanalyse (40, 41) 45-meer: ​​Cy5-GGGTCAACGTGGGCAAAGATGTCCTAGCAAGCCAGAATTCGGCAG-3′, die de respectievelijke vorm van de haar- en complementaire vorm zou moeten bevestigen met de online rekenmachine om dsDNA te genereren], of 500 ng van ofwel gist-tRNA (Thermo Fisher) of D. melanogaster totaal RNA (40, 41). In reacties waarbij CinA aanwezig was, werd 10 μM CinA gebruikt. Alle reacties werden gedurende 90 minuten bij 25°C uitgevoerd en geblust door toevoeging van EDTA tot een eindconcentratie van 10 mM, tenzij anders vermeld. Voor reacties waarbij gebruik werd gemaakt van een lineaire of circulaire pBluescript SK+ vector of RNA, werden monsters gelopen in agarosegels met een bereik van concentraties tussen 0,8 en 2,0% die 0,4 g/ml ethidiumbromide bevatten in 1 x TAE-buffer bij 100 V gedurende 40 tot 60 minuten en afgebeeld op een Syngene G:box met GeneTools-software. Voor reacties met Cy5-gelabelde oligodeoxynucleotiden werden monsters gedurende 45 tot 60 minuten in 9% TBE-polyacrylamide-natieve gels bij 100 V gelopen en afgebeeld op een Typhoon FLA 7000 met Typhoon FLA 7000-besturingssoftware.

Gist methoden.

De getoonde gistgroeiassays werden uitgevoerd in de BY4741-stam (42). Het 2-μm plasmide pYES2 (URA3) maakt gebruik van a GAL1 promotor en a CYC1 terminator en werd gebruikt voor galactose-induceerbare CinB-expressie in gist. Gistgroeiassays en immunoblotting werden uitgevoerd zoals eerder beschreven (9) (SI-bijlage, Materialen en methodes).

Drosophila Hatch-rate en cytologie-analyses.

Elk CI-kandidaat-gen (cinA, cinB, cinB-K636A, en cinA-T2A-cinB) werd in de pUASp-attB-vector ingevoegd met standaard kloneringstechnieken zonder codonoptimalisatie. In het kort, de ORF's van de genen werden geamplificeerd door PCR en gekloneerd in de pBluescript SK+-vector gevolgd door restrictiedigestie en herligatie van de genen in de pUASp-attB-vector. Alle plasmiden werden geverifieerd door de ingevoegde genen volledig te sequencen voordat ze naar BestGene werden gestuurd voor micro-injectie van D. melanogaster embryo's (9). Fly-achtergrond 9744 werd gekozen voor alle genconstructen voor plaatsgerichte attP/B-integratie op het derde chromosoom door PhiC31-integrase (26) met uitzondering dat achtergrond 9723 werd gekozen voor plaatsspecifieke integratie van cinA op het tweede chromosoom. Integraties werden onafhankelijk bevestigd door PCR-amplificatie van de kandidaatgenen (43, 44). D. melanogaster voorraden zijn geverifieerd als niet-geïnfecteerd met native Wolbachia isolaten door PCR-amplificatie van de cidA met wieMel-gen (SI-bijlage, Afb. S6). The MTD-Gal4 line from the Bloomington Stock Center was found to be infected by met wieMel and was treated by addition of 20 μg/mL tetracycline to the growth medium for 3 generations. Once the infection was confirmed to be cleared by PCR amplification of the cidA met wieMel gene, flies were reared on untreated media for at least 3 additional generations to allow for mitochondrial recovery (45). Both uninfected and met wieNo-infected D. simulans were also verified by PCR amplification of the cinB met wieNo gene (SI Appendix, Fig. S6). Flies were reared on standard cornmeal-based solid media and maintained at room temperature. During virgin female collection, stocks were maintained at 18 °C overnight and room temperature the following day. All transgenic flies were maintained as homozygous lines.

Parental flies were generated by crossing either NGT-Gal4 or MTD-Gal4 virgin females with cin transgenic males (27, 29). Only the males emerging between 0 and 30 h from these crosses were collected and used in CI analyses (46). All flies used in both hatch-rate and cytological analyses were aged for 2 to 4 d. Hatch-rate analysis was performed and embryos for cytological analyses were prepared similarly as previously described (9, 10) (SI Appendix, Materialen en methodes). The samples were stained with either Hoechst 33342 at 1:1,000 in PBTA or 1 μg/mL propidium iodide (9, 10). Stained embryos were mounted on glass slides and sealed under coverslips by nail polish. Imaging was done either on a Zeiss Axioskop microscope with AxioCam MRm camera using 10× and 40× objective lenses or a Zeiss LSM 880 Airyscan/NLO confocal microscope with internal PMT using a 20× objective lens. Software used to capture and analyze the images were AxioVision Rel. 4.8 or Zen (blue edition), respectively.

Statistical Analyses.

All statistical analyses were done in GraphPad Prism 7. Hatch-rate analyses were performed by either using 1-way ANOVA with pairwise comparison after removal of outliers identified by the ROUT method with Q = 1% (Fig. 5 C en NS) or unpaired 2-tailed Mann–Whitney u test (Fig. 5E en SI Appendix, Fig. S4). Pairwise χ 2 test was used in cytological analyses to compare normal and defect cytological phenotypes.

Data Availability.

Quantitative analyses for this study are provided in Dataset S1.


Bekijk de video: What is Wolbachia? (December 2021).