Informatie

Hoe zorgen myosines ervoor dat myofibrillen worden verkort?


Ik weet dat het de binding en kanteling van myosinen op actines is die ervoor zorgen dat het sarcomeer wordt verkort. Maar ik ben een beetje in de war over de details. De structuur van een sarcomeer is gemaakt van alternatieve banden van actine- en myosinefilamenten. Dus als de actine wordt ingekort door de myosinefilamenten aan beide kanten ervan, zou het dan geen krachten in verschillende richtingen ervaren? Zo ja, waarom kan het sarcomeer dan worden ingekort in plaats van verscheurd? Ik ben een beetje in de war over hoe precies de beweging van myosines ervoor zorgt dat de spier samentrekt.


Polarisatie-opgeloste microscopie onthult een spier-myosine motoronafhankelijk mechanisme van moleculaire actine-ordening tijdens sarcomeerrijping

Affiliations Institute of Neurobiology and Cells-in-Motion Cluster of Excellence (EXC 1003 – CiM), University of Münster, Münster, Duitsland, Department of Zoology, University of British Columbia, Vancouver, Canada

Rollen Gegevensbeheer, Onderzoek, Methodologie

Aansluiting Max Planck Instituut voor Biochemie, Muscle Dynamics Group, Martinsried, Duitsland

Rollen Financiering acquisitie, Toezicht

Affiliation Institute of Neurobiology and Cells-in-Motion Cluster of Excellence (EXC 1003 – CiM), Universiteit van Münster, Münster, Duitsland

Rollen Conceptualisering, Financiering acquisitie, Methodologie, Supervisie, Schrijven – origineel concept, Schrijven – review & redactie

Aansluiting Aix Marseille Université, CNRS, Centrale Marseille, Institut Fresnel, Marseille, Frankrijk

Rollen Conceptualisering, Financiering acquisitie, Supervisie, Schrijven – origineel concept, Schrijven – review & redactie

Aansluiting Aix Marseille Université, CNRS, IBDM, Marseille, Frankrijk

Rollen Conceptualisering, Formele analyse, Financieringsacquisitie, Supervisie, Visualisatie, Schrijven - origineel concept, Schrijven - review & redactie

Aansluitingen Aix Marseille Université, CNRS, IBDM, Marseille, Frankrijk, Max Planck Institute of Biochemistry, Muscle Dynamics Group, Martinsried, Duitsland


Abstract

Skeletspieren bestaan ​​uit bundels myovezels die miljoenen myofibrillen bevatten, die elk zijn gevormd uit longitudinaal uitgelijnde sarcomeerstructuren. Sarcomeren zijn de minimale contractiele eenheid, die voornamelijk uit vier componenten bestaat: Z-banden, dunne filamenten, dikke filamenten en connectine/titine. De grootte en vorm van de sarcomeercomponent wordt strikt gecontroleerd. Verrassend genoeg synthetiseren skeletspiercellen niet alleen een reeks myofibrillaire eiwitten, maar reguleren ze ook de assemblage van die eiwitten in de sarcomeerstructuren. Authentieke sarcomeerstructuren kunnen echter niet worden gereconstitueerd door in vitro gezuiverde myofibrillaire eiwitten te combineren, daarom moet er een uitgebreid mechanisme zijn dat zorgt voor de juiste vorming van myofibrillaire structuur in skeletspiercellen. Deze review bespreekt de rol van myosine, een hoofdbestanddeel van het dikke filament, bij de vorming van dikke filamenten en de dynamiek van myosine in skeletspiercellen. Veranderingen in het aantal myofibrillen in myovezels kunnen spierhypertrofie of -atrofie veroorzaken. Daarom is het belangrijk om de fundamentele mechanismen te begrijpen waarmee myovezels de vorming van myofibril op moleculair niveau beheersen om benaderingen te ontwikkelen die de spiergroei bij dieren effectief verbeteren.


Spierfysiologie en de myosine SRX-toestand

Myosine RLC reguleert de myosine SRX-status

Het is al lang bekend dat fosforylering-defosforylering van RLC werkt als een binaire 'aan'-'uit'-schakelaar om myosine-activiteit van gladde spieren te activeren (besproken in Trivedi et al., 2018). Er is een sterke neiging van niet-gefosforyleerd myosine van gladde spieren om te vouwen tot de IHM-toestand. Gestreepte spiermyosinen worden op deze manier niet 'aan' en 'uit' geschakeld. Het is echter bekend dat RLC-fosforylering de gestreepte myosinefunctie op verschillende manieren verfijnt (Yu et al., 2016). Vroege studies hebben aangetoond dat fosforylering de rangschikking van myosinekoppen in skeletspierfilamenten beïnvloedt (Levine et al., 1996). Er zijn ook aanwijzingen voor ontregeling van RLC-fosforylering in verschillende hartfalenmodellen en gedilateerde cardiomyopathieharten (Huang et al., 2008 van der Velden et al., 2003 Toepfer et al., 2013). Op moleculair niveau hebben meerdere bevindingen geleid tot de hypothese dat in de ontspannen toestand van het dwarsgestreepte spiersarcomeer, wanneer een subpopulatie van RLC's niet wordt gefosforyleerd, een fractie van de myosinekoppen wordt vastgehouden op de filamentruggengraat waarin de myosine wordt beschouwd als in de IHM-staat (beoordeeld door Craig en Woodhead, 2006 en Alamo et al., 2018). Fosforylering van de RLC's zorgt er vervolgens voor dat deze myosinen losser worden geassocieerd met de filamentruggengraat die cross-bridge-interacties met actine mogelijk maakt (besproken in McNamara et al., 2015 en Trivedi et al., 2018), wat suggereert dat de functionele 'on ' en 'uit' staat van myosine. Wat betekent dit in termen van het myosine DRX-SRX toestandsevenwicht? De eerste studie die het vermogen van RLC-fosforylering om de myosine SRX-toestand te ontvolken rapporteerde, was in skeletspiervezels van konijnen (Stewart et al., 2010) en vervolgens gereproduceerd in tarantula-skeletspier (Naber et al., 2011). Een vergelijkbare waarneming werd gedaan waarbij een fosfomimetische versie van de RLC, S15D, in HCM-veroorzakende R58Q RLC-mutante achtergrond, de SRX-toestand in gevilde papillaire spiervezels van varkens depopte (Yadav et al., 2019). Dit rapport wordt verder besproken onder de sectie 'Ziektetoestand en therapeutische modulatoren van myosine SRX-toestand'. In gereconstitueerde cardiale myosine-dikke filamenten van volledige lengte, is onlangs ook gemeld dat fosforylering van de RLC met MLCK of uitputting van RLC de myosinepopulatie in de SRX-toestand vermindert (Gollapudi et al., 2020a). Al deze waarnemingen samen suggereren een door RLC-fosforylering gemedieerde verschuiving in het DRX-SRX-toestandsevenwicht naar de DRX-toestand van myosine. Deze verschuiving naar de DRX-toestand is gecorreleerd met de ontvolking van de structurele IHM-toestand na RLC-fosforylering (Alamo et al., 2016). De observatie dat factoren die de RLC beïnvloeden ook de populatie van de SRX-staat beïnvloeden, is niet verwonderlijk als men aanneemt dat de IHM-staat een belangrijke bron van de SRX-staat is, aangezien de twee RLC's aan elkaar binden en een van de belangrijkste interfaces vormen die stabiliseren. de IHM-staat (Alamo et al., 2016).

Myosine essentiële lichte keten kan essentieel zijn voor de myosine SRX-toestand

De rol van essentiële lichte keten (ELC) en hoe Ca2+-binding aan ELC (in het regulerende domein van de sint-jakobsschelp dat twee lichte ketens samen met een kort fragment van de zware keten bevat) de contractie van de spiercontractie van weekdieren reguleert, is de focus geweest van onderzoek in de laboratoria. van Andrew Szent-Gyorgyi en anderen (Szent-Györgyi, 1975 Fromherz en Szent-Györgyi, 1995 Chantler, 2006 Trybus, 1994). Van Ca2+-binding aan ELC is aangetoond dat het de myosine enzymatisch en structureel aanzet vanuit zijn IHM-achtige 'uit'-toestand (Woodhead et al., 2013). De rol van ELC in hart-, skelet- of gladde spieren is echter niet goed begrepen. Verschillende laboratoria hebben aangetoond dat een specifieke N-terminale verlenging van de ELC een essentiële rol kan spelen bij het reguleren van de motorfunctie van myosine en de productie van kracht in dwarsgestreepte spieren (Kazmierczak et al., 2009 Muthu et al., 2011 Guhathakurta et al., 2015) . Onlangs werd de hypothese getest dat dit N-terminale domein van de cardiale ELC werkt als een moleculaire linker-schakelaar van de actine-myosine-interactie door het DRX-SRX-toestandsevenwicht te reguleren, getest in de papillaire spier van muizen die zijn ontworpen om een ​​ELC tot expressie te brengen zonder zijn N. -terminale 43 aminozuren (Tg-Δ43). Het ontbreken van de N-terminus van de ELC bij muizen resulteerde in een significante toename van de populatie van myosine in de SRX-staat, waardoor het aandeel myosinekoppen dat beschikbaar is om te interageren met actine afnam (Sitbon et al., 2020). In overeenstemming vertoonde myosine gezuiverd uit Tg-Δ43-harten significant verminderd ATP-gebruik en lage actine-geactiveerde myosine-ATPase vergeleken met die van wildtype (WT) harten. Hoewel de studies beperkt zijn, postuleert deze observatie de rol van ELC bij het reguleren van de myosine SRX-toestand en vereist meer studies in de toekomst om de hypothese te verstevigen. Al met al lijken beide lichte ketens die geassocieerd zijn met gestreepte myosines een bepalende rol te spelen bij het beheersen van de populatie van myosine in de SRX-staat, en functioneren daardoor als regulerende schakelaars van spiercontractiliteit.

Leeftijd, geslacht en hormonale regulatie van de myosine SRX-toestand

In ontspannen skeletspieren is geschat dat:

50% van de myosinen blijft in de SRX-staat en de rest bevindt zich in de DRX-staat (Stewart et al., 2010 Cooke, 2011). Het is ook bekend dat er, onafhankelijk van de spieromvang of de aanwezigheid van neurologische of spierziekten, een progressief verlies van spierkracht optreedt bij het ouder worden, dynapenie genaamd. Een dergelijke leeftijdsgebonden verslechtering van de contractiliteit van de skeletspieren is prominenter aanwezig bij postmenopauzale vrouwen dan bij mannen van dezelfde leeftijdsgroep. Daarom is het essentieel om te begrijpen of veroudering en seks het myosine DRX-SRX-toestandsevenwicht kunnen verschuiven of de eigenschappen van de SRX-toestand kunnen veranderen. Deze hypothese werd getest in de psoas-spier van jonge (3-4 maanden oud) en oude (26-28 maanden oud) C57BL/6 mannelijke en vrouwelijke muizen, en er waren geen significante effecten op de SRX-populatie als functie van leeftijd of geslacht ( Phung et al., 2018) werden waargenomen. Alleen voor vrouwelijke muizen was de ATPase-cyclustijd van myosine in zowel de DRX- als SRX-toestanden echter significant sneller met de leeftijd. Het is bekend dat het ovariumhormoon estradiol het belangrijkste hormonale signaal is voor de skeletspieren bij vrouwen, en het tekort ervan is schadelijk voor myosine en spierfunctie. In een eerdere studie (Colson et al., 2015) door hetzelfde laboratorium, onthulden experimenten met een enkele omzet in de C57BL/6-muizen waarbij de eierstokken waren verwijderd, twee verschillende populaties van myosine in de SRX- en DRX-staten in een vergelijkbare verhouding als de populaties die werden gezien in de controle muizen. De ATP-turnoversnelheid van de SRX-populatie was echter significant verhoogd in vergelijking met de niet-operatieve controles. Dit effect werd teruggedraaid naar de WT-controle door een chronische behandeling van 60 dagen van de ovariëctomiemuizen met estradiol, maar niet door behandeling van de geïsoleerde psoas-spier met estradiol, wat suggereert dat door estradiol gemedieerde signalering de langzame ATP-turnover door myosine omkeerbaar reguleert. Over het algemeen beweren de auteurs van deze studies dat de veroudering van vrouwen, wat leidt tot een uitputting van het hormoon estradiol, de spiermyosine meer verschuift naar een DRX-achtige toestand met snellere ATP-cycli. De auteurs veronderstellen dat dit zou kunnen resulteren in een opeenhoping van zwak gebonden actomyosinecomplexen, mogelijk concurrerend met de bestaande sterk gebonden complexen, wat leidt tot vertraagde cross-bridge kinetiek en toenemende zwakte met de leeftijd. Een alternatieve mogelijkheid zou kunnen zijn dat de verschuiving naar meer DRX-koppen het verlies van spiervezels kan compenseren in plaats van de oorzaak van het verlies van contractiliteit. Deze studies kunnen wijzen op de moleculaire verschillen in spierkenmerken tussen geslachten en leeftijdsgroepen, en er zou nog veel meer onderzoek in deze richting nodig zijn om beide hypothesen te bewijzen.

De rol van calcium bij het reguleren van de myosine SRX-toestand

Ca2+ speelt een belangrijke rol in verschillende biologische processen in het lichaam. Eén zo'n goed bestudeerd proces is de activering van contractie van de skelet- en hartspier, gemedieerd door directe binding van Ca2+ aan het door actine-tropomyosine-troponine gereguleerde dunne-filamentcomplex (beoordeeld door Ebashi en Endo, 1968, en Gordon et al., 2000). Zoals eerder besproken, destabiliseert Ca2+-binding aan sint-jakobsschelp-myosine de myosine vanuit de IHM-achtige 'uit'-toestand, een mechanisme dat evolutionair niet is gepropageerd in het gewervelde systeem. Sommige vroege onderzoeken door de laboratoria van Richard Moss en anderen hebben aangetoond dat de Ca2+-gevoeligheid van de snelheid van krachtontwikkeling in skeletspieren van gewervelde dieren gedeeltelijk wordt gemedieerd door de RLC-subeenheid van de myosine-kruisbrug (Metzger et al., 1989 Metzger en Moss, 1992 Metzger en Moss, 1990 Metzger en Moss, 1991). Andere studies hebben het belang van divalente kationen zoals Ca 2+ en Mg 2+ voor de stabiliteit van de myosine SRX-toestand voorgesteld (Nogara et al., 2016a). Het is pas recent dat een onderzoek heeft gemeld dat Ca2+ en niet Mg2+-binding aan gereconstitueerde cardiale myosinefilamenten van varkens de myosine SRX-toestand heeft ontvolkt, waardoor Ca2+-gemedieerde activering van het dikke filament wordt voorgesteld als een aanvullende regulatie van de gewervelde dieren. spier (Sa et al., 2019). Of dit mechanisme in alle soorten skelet- en hartsystemen werkt, wordt besproken (Irving, 2017) en blijft een actief onderzoeksgebied. Als de Ca2+-gemedieerde regulatie van de myosine SRX-populatie werkelijk enige grond heeft, zou het nog een andere evolutionaire manier zijn om spiercontractiliteit te reguleren, vooral in de context van het kloppende hart. Er zijn meer studies nodig die de rol van Ca2+ in de regulatie van myosine onderzoeken.

Spier-energetica en de rol van ADP bij het beheersen van de myosine SRX-toestand

Fenotypisch, op basis van eigenschappen zoals contractiele kracht en snelheden, kunnen skeletspiervezels worden gecategoriseerd als langzaam of snel, afhankelijk van de verschillende myosine-isovormen die ze tot expressie brengen. Daarom zijn de stofwisselingssnelheden en prestaties van de hele spier afhankelijk van de verdeling en het aandeel van deze verschillende spiertypen. Onlangs is aangetoond dat het snelle skeletspiertype een kleinere populatie myosines in de SRX-staat heeft dan het langzame spiertype (Phung et al., 2020), wat wijst op een hoger energieverbruik door de snelle spiertypes. Dit hogere energieverbruik in rust door de snelle spiervezels kan bijdragen aan verschillen in het basaal metabolisme in het hele lichaam en aanvullende inzichten verschaffen voor het begrijpen van de energie van de spieren.

Bovendien liggen energiegerelateerde disfuncties ten grondslag aan veel voorkomende ziekten, zoals mitochondriale aandoeningen, die vaak van invloed zijn op de belangrijkste energieverslindende organen van het lichaam, zoals skelet- en hartspier, hersenen, lever en nieren. In de context van cardiale contractiliteit zijn bijvoorbeeld ATP-afhankelijke enzymen vereist voor zowel systole (bijv. Myosine) als diastole (bijv. SERCA). Het is geraden dat

60-70% van de ATP die in de hartspier wordt gegenereerd, wordt verondersteld te worden gebruikt door de myosines (Barclay, 2015). Daarom zou elk verlies aan chemische energie leiden tot een falend hart dat niet kan voldoen aan de hemodynamische vereisten van het lichaam. Het is belangrijk op te merken dat de hoeveelheid ATP die per minuut wordt gemaakt en gebruikt vele malen groter is dan de omvang van de bestaande ATP-pool, waarbij wordt benadrukt dat het handhaven van een hoge ATP-toevoer van cruciaal belang is voor het behoud van de hartfunctie. Het is denkbaar dat hypercontractiliteit van het hart, hetzij als gevolg van ziektetoestanden zoals HCM of effecten van inotropen, de [ADP]/[ATP]-verhouding kan verstoren en metabolische onevenwichtigheden kan veroorzaken (Ingwall en Weiss, 2004). Een aantal studies hebben de rol van ADP in de manifestatie van de myosine SRX-toestand gerapporteerd. In snelle en langzame skeletspiervezels van konijnen hecht ADP-binding aan de myosine bijvoorbeeld de myosinemotor sterk aan actine en verdringt de regulerende eiwitten, waardoor de vezel wordt geactiveerd. Deze actie resulteert in een mogelijke door stammen gemedieerde ontvolking van de SRX-toestand van myosine en daardoor tot aanhechting van meer myosinekoppen aan actine (Stewart et al., 2010). Evenzo werden na ADP-behandeling verhoogde SRX-state-turnoversnelheden ook waargenomen in psoas-spiervezels van muizen (Phung et al., 2018). Deze studies suggereren dat het dikke filament in de skeletspier, na rigorbinding aan actine, een spanningsgemedieerde destabilisatie van de SRX-populatie kan ondergaan. Een soortgelijk mechanisme werd ook waargenomen in myosinen van langzame skeletachtige myofibrillen van rat soleus (Nelson et al., 2020). Hooijman et al., 2011 merkten echter op dat dergelijke ADP-gemedieerde destabilisatie van de SRX-populatie in hartweefsel in mindere mate wordt beïnvloed door rigor-ADP-toestanden van aangrenzende myosinekoppen dan wordt waargenomen in skeletvezels. De auteurs stellen dat dit kan worden verklaard door een veel zwakkere coöperatieve aard van de myosines in de hartspier in vergelijking met die in de skeletspier. Bovendien kunnen veel meer factoren, zoals de verschillen in isovormen en fosforyleringsniveaus van andere eiwitten zoals myosine RLC, MyBPC en titine, bijdragen aan deze verschillen in de myosine-coöperatie en dit is een open onderzoeksgebied.

Zeer interessant is dat in skeletspieren, toen de ADP-gemedieerde ontregeling van de myosine SRX-toestand werd bestudeerd bij een lange sarcomeerlengte (zonder actine-myosine-overlap), ADP het aantal myosines in de SRX-populatie niet veranderde, maar de ATP-omzet aanzienlijk verhoogde snelheden van deze myosines, wat suggereert dat binding van ADP aan sommige myosinekoppen de snelheid van afgifte van fosfaat uit aangrenzende koppen verhoogt (Stewart et al., 2010). Onlangs hebben Gollapudi et al., 2020a met behulp van varkenscardiale myosine ook een ADP-gemedieerde destabilisatie van de SRX-populatie van myosine aangetoond in gereconstitueerde dikke myosinefilamenten, maar niet in het myosine-subfragment S1 of zware meromyosine (HMM), wat een relais suggereert mechanisme van een coöperatieve destabilisatie van de SRX-populatie, via de proximale en distale staarten van myosine in het dikke filament, dat afwezig is in de kortere myosineconstructen. Deze onderzoeken komen overeen met de waarneming dat de binding van ADP een open configuratie van myosine produceert en de spiraalvormige ordening van het dikke filament in een overbelaste konijn-psoas-spiervezel verstoort (Xu et al., 2003). Al deze resultaten samen duiden op het coöperatieve mechanisme van het dikke filament, waarbij één myosine gebonden aan ADP (en daarom waarschijnlijk niet in de SRX-toestand is) de populatie van andere myosines in de SRX-toestand structureel en functioneel kan verminderen (degenen die nog zijn fosfaat niet verloren), waardoor de aangrenzende myosinekoppen mogelijk in een meer ongeordende 'aan'-toestand veranderen. Deze waarnemingen kunnen erop wijzen dat bij veel metabole spieraandoeningen, waaronder bij HCM, waar er een accumulatie van ADP in het lichaam is, myosinen meer in de actieve DRX-achtige toestand zouden zijn, waardoor ze zelfs meer energie zouden verbruiken dan normaal, waardoor het effect wordt verergerd. .

Temperatuur: het vuur hoger zetten om de myosine SRX-populatie te stabiliseren

Temperatuur speelt een vitale rol bij het dicteren van de dynamiek van bijna alle biologische processen in het lichaam, en het is niet verwonderlijk dat temperatuur het myosine DRX-SRX-toestandsevenwicht zou beïnvloeden.In skeletspieren induceert een hogere temperatuur bijvoorbeeld een groter aandeel myosinekoppen in de SRX-toestand en vertraagt ​​​​de ATP-turnovertijd voor deze myosines (Stewart et al., 2010), mogelijk door myosine te vullen in de ADP vóór de beroerte. Pi staat. Veel temperatuurafhankelijke onderzoeken die de conformatie van myosine volgen, hebben ook de vorming van meer myosinen in de structurele 'uit'-toestand en stabilisatie van de geordende spiraalvormige structuur van het dikke filament met een toename van de temperatuur onderbouwd (Xu et al., 2003 Fusi et al., 2003 Fusi et al. al., 2015 Caremani et al., 2019). Dit is niet verwonderlijk. Vanwege het hydrofobe effect zijn de meeste eiwit-eiwit-interacties sterker bij hogere temperaturen. In een gezuiverd hartmyosinesysteem van runderen merkten Rohde et al., 2018 echter op dat met toenemende temperatuur de fractie van myosine in de SRX-toestand afnam in een S1-systeem en geen effect had in het HMM-systeem, in tegenstelling tot wat werd waargenomen door de eerdere studie van Stewart et al., 2010 in skeletspiervezels. Samen suggereren deze waarnemingen dat het netwerk van moleculaire interacties die de SRX-toestand in een meer gecompliceerd spiervezelsysteem regelen, verschilt van die in een gezuiverd HMM- of S1-systeem, wat aanleiding kan geven tot verschillende temperatuurafhankelijkheden in verschillende systemen. Er is ook een mogelijkheid van een inherent verschil tussen de populatie van SRX-toestanden in skelet- en hartspiersystemen (Hooijman et al., 2011). Een studie van de veranderingen in de myosine SRX-populatie met veranderingen in temperatuur met behulp van verschillende spiertypen van verschillende koudbloedige en warmbloedige dieren zou meer licht werpen op de moleculaire interacties die de vorming van de SRX-toestand reguleren en zou ons kunnen helpen de spierdynamiek in winterslaap te begrijpen dieren.

De aanvullende MyBPC en zijn rol bij het stabiliseren van de myosine SRX-populatie

MyBPC is een multi-domein dik-filament-geassocieerd eiwit in skelet- en hartspier waarvan bekend is dat het de cross-bridge kinetiek moduleert via fosforylering van serineresiduen in het zogenaamde M-domein. Het C-uiteinde van MyBPC bindt aan het dikke filament en het N-uiteinde kan interageren met zowel de myosinekop als het actinefilament. Verschillende onderzoeken die zijn beoordeeld in McNamara et al., 2015 en Trivedi et al., 2018 hebben een rol gesuggereerd van MyBPC bij het stabiliseren van de myosinekoppen nabij het dikke myosine-filament in een IHM-achtige 'off-state' en fosforylering van de M- domein serine residuen verschuift het evenwicht meer naar een wanordelijke 'on-state'. Hoe correleert dit met het myosine DRX-SRX toestandsevenwicht? Het werd voor het eerst gemeld in een onderzoek met gevilde hartspiervezels dat homozygote maar niet heterozygote MyBPC-knockout-muizen een significante afname van de myosinepopulatie in de SRX-staat hebben in vergelijking met WT (McNamara et al., 2016). In overeenstemming met deze observatie van bovenaf heeft een bottom-upbenadering met gezuiverd humaan β-cardiaal myosine onlangs aangetoond dat de populatie van myosine in de SRX-toestand toenam in aanwezigheid van het C0-C7 MyBPC-fragment (Sarkar et al., 2020) . Beide studies suggereren dat MyBPC de populatie van de myosine in de SRX-staat verhoogt. Dit werk wordt verder besproken onder de sectie 'HCM-veroorzakende en andere mutaties in myosine die de myosine SRX-toestand ontregelen'.

In een andere muisstudie (McNamara et al., 2019) werd verder aangetoond dat in een drievoudige fosfomimetische versie van cardiale MyBPC (DDD-serine → aspartaat verandert op residuen 273, 282 en 302 van het M-domein van MyBPC), de myosine SRX-populatie nam significant af in vergelijking met WT- en drievoudig gefosfo-ableerde versies van MyBPC (AAA-serine → alanineveranderingen op residuen 273, 282 en 302). Bij verder onderzoek van de plaatsspecifieke fosforyleringen toonden de auteurs aan dat een fosfomimetische versie van de ser 282-plaats (ADA serine → aspartaatverandering op residu 282, en serine → alanineveranderingen op residu's 273 en 302) voldoende was om de DRX↔ te verschuiven. SRX-toestandsevenwicht naar de DRX-toestand van myosine. Interessant is dat de omgekeerde fosfomimetische versie (DAD-serine → aspartaatveranderingen op residuen 273 en 302 en serine → alanineverandering op residu 282-plaatsen) het myosine DRX-SRX-toestandsevenwicht niet beïnvloedde. Net als eerdere studies verminderde de behandeling van WT-preparaten met proteïnekinase A de myosine in de SRX-toestand. Daarentegen was er geen effect in de gefosfo-ableerde versie van MyBPC-preparaten, wat de hypothese versterkt dat fosforylering van MyBPC een regulerende rol speelt bij het veranderen van de myosine van een functionele 'uit' naar een meer functionele 'aan'-toestand.

Gezien de realiteit dat MyBPC zich in de C-zone in het sarcomeer lokaliseert, werd in een recent rapport gebruik gemaakt van fluorescente beeldvorming met één molecuul van skeletachtige myofibrillen van rattensoleus onder ontspannen omstandigheden om de kinetiek van ATP-hydrolyse in verschillende regio's van het sarcomeer te meten (Nelson et al. , 2020). De auteurs hebben de hydrolyse van individuele fluorescent gelabelde ATP-moleculen ruimtelijk opgelost door myosines in de C-zone, D-zone en P-zone. De D- en P-zones zijn zones van het dikke filament in de richting van respectievelijk de Z- en M-lijnen en bevatten geen MyBPC. De myosine-ATPase-levensduren binnen de C-zone waren significant langer dan die van de flankerende niet-MyBPC-bevattende regio's. Ook werden binnen de C-zone twee verschillende myosinepopulaties waargenomen die overeenkomen met de DRX- en SRX-toestanden, terwijl in de niet-MyBPC-bevattende regio's alle myosines zich voornamelijk in de DRX-toestand bevonden, wat suggereert dat de sterk geremde SRX-myosines voornamelijk binnen de C-zone van het skeletsarcomeer. Al deze waarnemingen samen vormen een verhaal waarin de binding van MyBPC aan myosines in de C-zone van het gestreepte sarcomeer de SRX-toestand bevolkt, en MyBPC-fosforylering verschuift dit evenwicht meer naar de DRX-toestand. Deze observatie komt overeen met de structurele regulatie van de dikke spierfilamenten door MyBPC (beoordeeld in McNamara et al., 2015 en Trivedi et al., 2018) en voegt MyBPC toe als een essentiële bijdrage die is geëvolueerd in dwarsgestreepte spieren om te verfijnen myosine contractiliteit indirect.

Myosine subfragment 2: de staart vertelt een verhaal over de myosine SRX toestand

Zoals hierboven beschreven, en al in 2008, werd een teruggevouwen structurele toestand van myosine, de IHM genoemd, ontdekt (besproken in Trivedi et al., 2018 en Alamo et al., 2018), waarbij de twee S1-hoofden van myosine asymmetrisch terugvouwen op de S2-staart. Bovendien is op moleculair niveau aangetoond dat de S1-kop biochemisch interageert met het proximale deel van de S2 (Nag et al., 2017). Veel andere interacties, zoals de S1-S1 en RLC-RLC van de twee myosinekoppen, worden voorgesteld om de IHM-toestand te stabiliseren. Uit elektronenmicroscopieonderzoeken blijkt echter dat de S1-S2-interacties nodig zijn om de structurele 'uit'-toestand van myosine te vormen. Verandert dit S2-subfragment van myosine ook het myosine DRX-SRX-toestandsevenwicht? Deze vraag werd onlangs beantwoord in een rapport waarin twee verschillende versies van menselijke β-cardiale HMM werden gemaakt. Eén bevatte de eerste 25 heptads van het proximale deel van het S2-subfragment (25-hep), en de andere bevatte alleen de eerste twee heptad-herhalingen van het S2-subfragment (2-hep). In ATP-experimenten met enkele omzet vertoonde de HMM van 25 hep een significante stabilisatie van de myosine SRX-populatie om

60%. Daarentegen was de SRX-populatie in de 2-hep HMM:

20%, wat suggereert dat het proximale S2-subfragment van myosine het myosine DRX-SRX-toestandsevenwicht verschuift naar de SRX-toestand. Onafhankelijk werd een vergelijkbare conclusie ook getrokken door Rohde et al., 2018 tijdens het onderzoeken van de SRX-populatie in rundercardiale S1 en HMM. Van het S2-subfragment van myosine is ook aangetoond dat het bindt aan het N-uiteinde van de MyBPC (Gruen en Gautel, 1999) (besproken in Trivedi et al., 2018). In een ander onderzoek verminderde een hoge concentratie van proximaal S2 toegevoegd aan de ventriculaire hartspiervezels van de muis het aantal myosinekoppen in de SRX-staat significant (McNamara et al., 2019). Dit effect werd ook waargenomen in de drievoudig gefosfo-ableerde versie van MyBPC (AAA-serine →alanineveranderingen op residuen 273, 282 en 302 in het M-domein van MyBPC) (McNamara et al., 2019). Deze waarnemingen suggereren dat exogene S2 het DRX-SRX-toestandsevenwicht in de richting van de DRX-toestand van myosine kan duwen, hoogstwaarschijnlijk door verstoring van MyBPC-myosine-interactie, wat verder de fysiologische rol van myosine-subfragment 2 (myosine S2) aangeeft om de SRX-toestand te bevolken . Lange tijd werd in de dwarsgestreepte spierbiologie gedacht dat het myosine S2-fragment samen met het staartdomein structurele stabiliteit en een passieve verankeringsrol voor myosine in het dikke filament zou bieden. Deze biochemische studies zijn echter begonnen te verduidelijken dat een myosinedomein zoals de S2, dat ver weg is van de enzymatische plaats van het eiwit, de spiercontractiliteit kan reguleren door de populatie van myosines in de SRX-toestand te beheersen, waardoor een extra evolutionaire schakelaar wordt verschaft. voor spiercontractiliteit.


Wat zorgt ervoor dat spieren samentrekken?

Het proces van spiercontractie vindt plaats in de eiwitfilamenten van de Sarcomeer.

Uitleg:

Meestal bewegen spieren
door een proces dat samentrekking wordt genoemd en dat ervoor zorgt dat de spierbuik korter wordt. Spieren werken in oppositie. De spier die samentrekt wordt de agonist genoemd, terwijl degene die ontspant de antagonist wordt genoemd. De spierbuik is samengesteld uit spierbundels
vezels die fascikels worden genoemd. Het zijn de spiervezels die zijn samengesteld uit myofibrillen> die daadwerkelijk samentrekken vanwege gespecialiseerde eenheden die sarcomeren worden genoemd.

Een sarcomeer loopt van z-lijn naar z-lijn. En is samengesteld uit een dik filament genaamd myosine en een dun filament genaamd actine. Wanneer energie vrijkomt in de vorm van ATP, draait het dikke filament, myosine genaamd, zeer snel en trekt het aan de twee eiwitten die op het dunne actinefilament worden gevonden. Deze twee eiwitten worden tropomyosine en troponine genoemd.

Wanneer dit gebeurt, worden de z-lijnen dichter bij elkaar getrokken en trekt het sarcomeer samen. Dit is beter bekend als de glijdende filamenttheorie.

Wanneer de sarcomeer samentrekt, trekken alle sarcomeren samen en de myofibril samen. Dan trekt de vezel samen en de fascikel en tenslotte trekt de buik samen. Wanneer de buik samentrekt, trekt deze aan de pees die op zijn beurt aan het bot trekt om het skelet te laten bewegen.


Welke stappen zijn betrokken bij de myosine powerstroke?

Elk myosine-motoreiwit bezit ATPase-activiteit en functioneert op een cyclische manier die ATP-binding en hydrolyse koppelt aan een conformationele verandering in het eiwit. Dit proces staat bekend als de &lsquopowerstroke-cyclus&rsquo (besproken in [1] [2] [3] ) en wordt in de onderstaande stappen beschreven met myosine II als voorbeeld. t

Het & ldquopower stroke & rdquo-mechanisme voor myosinebeweging langs actinefilamenten:

De richting waarin het actinefilament wordt bewogen, wordt bepaald door de structurele oriëntatie van myosine ten opzichte van het filament. Een volledige ronde van ATP-hydrolyse produceert een enkele "stap" of beweging van myosine langs het actinefilament. Dit proces wordt gereguleerd door veranderingen in de concentratie van intracellulair vrij calcium (besproken in [4]). De betrokken stappen worden hieronder beschreven:

Stap 1: Aan het einde van de vorige bewegingsronde en het begin van de volgende cyclus, mist de myosinekop een gebonden ATP en is deze bevestigd aan het actinefilament in een zeer kortstondige conformatie die bekend staat als de &lsquorigorconformatie&rsquo.

Stap 2: ATP-binding aan het myosinekopdomein induceert een kleine conformationele verschuiving in de actine-bindingsplaats die de affiniteit voor actine vermindert en ervoor zorgt dat de myosinekop het actinefilament afgeeft.

Stap 3: ATP-binding veroorzaakt ook een grote conformationele verschuiving in de &lsquolever-arm&rsquo van myosine die de myosinekop naar een positie verder langs het filament buigt. ATP wordt vervolgens gehydrolyseerd, waardoor het anorganische fosfaat en ADP aan myosine worden gebonden.

Stap 4: De myosinekop maakt zwak contact met het actinefilament en er treedt een lichte conformatieverandering op myosine op die de afgifte van het anorganische fosfaat bevordert.

Stap 5: De afgifte van anorganisch fosfaat versterkt de bindingsinteractie tussen myosine en actine en veroorzaakt vervolgens de &lsquo-power stroke&rsquo. De krachtslag is de belangrijkste krachtgenererende stap die wordt gebruikt door myosine-motoreiwitten. Er worden krachten gegenereerd op het actinefilament wanneer het myosine-eiwit terugkeert naar zijn oorspronkelijke conformatie.

Stap 6: Naarmate myosine zijn oorspronkelijke conformatie terugkrijgt, wordt de ADP vrijgegeven, maar de myosinekop blijft stevig aan het filament gebonden op een nieuwe positie van waar het begon, waardoor de cyclus terug naar het begin wordt gebracht.


Materiaal en methoden

Visvoorraad

Vissen werden gekweekt en grootgebracht zoals eerder beschreven [71]. De volgende mutante allelen werden gebruikt: unc45b sb60 [1], sop repareren [28], hsp90aa1.1 tu44c/tu44c , [9] smyd1b zf340/zf340 [13], pijn sb55 [29], en herzschlag (hel tg287 ) [72].

Klonen

unc45b regulerende sequenties werden gekloneerd in de vector beschreven in [32] die overeenkomt met het gemodificeerde pT2KXIGΔin [73], stroomopwaarts van het monomere Teal-fluorescerende eiwit 1 (mTFP1). Voor klonen gata2 gebaseerde reporterconstructies, de unc45b fragmenten werden ingevoegd voor de gata2 promotor [33] die de expressie van aanstuurt gfp door Gateway-klonen [34]. unc45b stroomopwaartse sequenties werden geamplificeerd en gekloneerd volgens standaardprocedures. Details zijn beschikbaar op aanvraag.

Een cDNA van volledige lengte dat codeert voor de zebravis hsf1 (IRBOp991H0894D, Imagene) werd geamplificeerd (primers op aanvraag verkrijgbaar). Het resulterende PCR-product werd gekloond in een vector die 3,3-kb . bevatte unc45b regulerende sequentie stroomopwaarts en in-frame van het monomere oranje fluorescerende eiwit 1 (mOrange1) [74]. TF-bindingsplaatsen werden geïdentificeerd met Genomatix.

Western blotting

Eiwit werd geëxtraheerd door homogenisatie van ontdooide embryo's en gescheiden door 10% SDS-PAGE, overgebracht op een nitrocellulosefilter en geïncubeerd met verschillende primaire antilichamen (1:100 F59 DSHB en 1:100 γ-tubuline, Sigma]) gedurende één nacht bij 4 °C. Na drie keer wassen werd een secundair antilichaam (geiten-anti-muis Alexa Fluor 680, Invitrogen) gedurende 1 uur bij kamertemperatuur aangebracht. Blots werden gevisualiseerd met behulp van een infraroodbeeldvormingssysteem (Odyssey LI-COR Biosciences).

Micro-injectie

Micro-injectie werd uitgevoerd zoals beschreven [75], in het kort werd 1,5-2 nl injectieoplossing met 20 ng / μl reporterplasmide-DNA en 15 ng / μl Tol2-transposase-mRNA, aangevuld met 0,1% fenolrood (injectiemarker), geïnjecteerd in zebravis eieren met behulp van een FemtoJet micro-injector (Eppendorf).

Morfolinos (Genetools LLC, Oregon) werden als volgt geïnjecteerd: 0,3 mM unc45b-mo (CCAATTTCTCCCATCGTCATTGAAG) [1] 0,1 mM hsp90a-mo (TCGAG TGGTTTATTCTGAGAGTTTC) [9] 0,3 mM smyd1b-mo (AAAAACTTCCAC AAACTCCATTCTG) [13] 0,3 mM hsf1-mo (CACGGAGAGTTTAGT GATGATTTCT) [51] 0,3 mM hsf1cont-mo (CACGACAGTTTACTGATCAT TTGT) 0,3 mM hsf2-Mo (GACGTTCGA GCTGTGTTTCATTTTG) [51] en 0,4 mM titin-Mo (GTGGAAGACCGG TAAGATTACATCT) [77, 76].

In situ hybridisatie en beeldvorming

Whole-mount in situ hybridisatie werd uitgevoerd zoals beschreven [77]. Gebonden antisense probe werd onthuld met anti-DIG alkalische fosfatase (Roche). De sondes voor mef2d, myoD, atf3, vgll2b, SRFl, klhl31, kbtbd10b, kelch-achtig, trim55b, mef2a, nr4a1, smyd1a, crip2, fhl2a5, sarcosine6 en trim55a werden verkregen uit [43] en voor unc45b, smyd1b, en hsp90a uit [1, 13].

Alle afbeeldingen zijn gemaakt met een Leica-microscoop (MZ16F) en Leica-camera (DFC320). GFP- en TPF-intensiteit werd gemeten met ImageJ (//imagej.nih.gov/ij/).

RNA-Seq-analyse

Pools van 20-50 zebravisembryo's met wildtype of unc45b mutant fenotype werden verzameld bij 24, 48 en 72 hpf uit twee onafhankelijke koppelingen. Totale RNA-extractie werd uitgevoerd met Trizol (Invitrogen) volgens het protocol van de fabrikant. Geëxtraheerde totaal-RNA-monsters werden getest op RNA-nanochips (Bioanalyser 2100, Agilent) en vertoonden geen tekenen van afbraak (RNA-indexnummer > 9). Sequentiebibliotheken werden gegenereerd uit 1 μg RNA-monsters met de TruSeq mRNA-kit v.2 (Illumina). Grootte en concentratie van sequencing-bibliotheken werden bepaald met DNA-chip (Bioanalyser 2100, Agilent) en de concentraties werden aangepast tot 7 pM. Gemultiplexte monsters werden op een totaal aantal van drie sequencing-lanes geladen. Gepaarde eindaflezingen (2 x 50 nucleotiden) werden verkregen op een Hiseq1000 met behulp van SBS v3-kits (Illumina).

Clusterdetectie en basecalling werden uitgevoerd met behulp van RTA v.1.13 en de kwaliteit van de uitlezingen beoordeeld met CASAVA v.1.8.1 (Illumina). De sequencing resulteerde in 302 miljoen paren van 50 nucleotiden lange reads met een gemiddelde Phred-kwaliteitsscore van >35 (aanvullend bestand 1). De reads werden in kaart gebracht tegen het zebravisgenoom (Zv9) met behulp van TopHat versie 1.4.1 [78] met de opties --butterfly-search --coverage-search --microexon-search -a 5 -p 5 --library-type fr -unstranded en met behulp van bekende exon-juncties (Ensembl release 75). De gemiddelde afstand en standaarddeviatie tussen leesparen werden verkregen van CASAVA. Genexpressie werd bepaald met HTSeq-versie 0.5.3p3 [79] door voor elk gen het aantal uitlezingen te tellen dat overlapte met de annotatielocatie verkregen uit Ensembl-release 75. Differentiële expressie werd berekend met behulp van de R pakket DESeq [79]. Genen met 1,5-voudige verandering (toename of afname) en aangepast P waarde (FDR) van minder dan 0,05 werden beschouwd als differentieel uitgedrukt. Hiërarchische clustering werd uitgevoerd in R met de gplots pakket op een set geselecteerde genen die differentieel tot expressie worden gebracht in ten minste één toestand met Pearson's correlatie en de volledige koppelingsmethode, met behulp van variantie-gestabiliseerde expressiegegevens. Fuzzy clustering werd uitgevoerd op een set van 1825 genen die in ten minste één conditie verkeerd waren gereguleerd (FDR < 0.05) met behulp van de parameters c = 6 en m = 1.25 [80].

De transcriptomics-gegevens voor de pijn en hsp90a−/− mutanten en de overeenkomstige wildtype broers en zussen bij 72 hpf werden gegenereerd zoals eerder beschreven op twee banen van 2 × 50 bp in tweevoud of drievoud (330 miljoen leesparen), en uitgelijnd met het referentiegenoom zoals eerder met TopHat (aanvullend bestand 1) . De gegevens van unc45b, pijn en hsp90a mutanten bij 72 hpf werden geanalyseerd met DESeq2, die een beter analysevermogen hebben in vergelijking met DESeq en dus meer genen die verkeerd tot expressie brengen detecteren. De robuustheid van de biologische replicaten wordt weergegeven op de heatmap van Euclidische afstanden in figuur S1a in aanvullend bestand 2 (rechterpaneel). Op mondiaal niveau is de analyse van de unc45b gegevens bij 72 hpf door DESeq en DESeq2 correleren goed, met een Pearson-correlatiecoëfficiënt van de log2-voudige verandering R = 0,82, wat de overeenkomst tussen de twee methoden laat zien.

GO-termverrijkingsstudies werden uitgevoerd op genclusters verkregen door clustering met Metacore (Thomson Reuters) of door te berekenen P waarden uit de Fisher's exact test. Voor dit doel werden menselijke orthologen verkregen van Ensembl Compara om GO-termen en procespaden te bevragen die aanzienlijk waren verrijkt in de verschillende clusters. Voor het scannen van TF-bindingsplaatsen in de genen verkregen door middel van fuzzy mean clustering, werden promotors met −1 kb ten opzichte van de transcriptionele startplaats geanalyseerd door Opossum [81] en Pscan [82]. Menselijke orthologen voor elk cluster werden verkregen van Biomart en een sequentie van −1 kb van de transcriptionele startplaats die zoals eerder werd gescand. Om te zoeken naar de Hsf1-bindingsplaats in regulerende sequenties van de 88 opgereguleerde TF's (FDR < 0.1 en fold change > 1.5), werd -1 kb tot +1 kb naar de transcriptionele startplaats gescand met Opposum v.3.0. P waarden werden berekend uit ruwe Z-scores verkregen van Opposum (P < 10 −20 en Z-score > 10 werden als significant beschouwd).

Ethische goedkeuring

Experimenten op dieren werden uitgevoerd in overeenstemming met de Duitse normen voor dierenbescherming en werden goedgekeurd door de regering van Baden-Württemberg, Regierungspräsidium Karlsruhe, Duitsland (Aktenzeichen 35-9185.81/G-137/10").


Beoordeling

Invoering

Sarcomere myosinen die aanwezig zijn in gestreepte spieren van zoogdieren zijn klasse II of conventionele myosinen, waarbij elk myosinemolecuul bestaat uit twee zware ketens (MyHC's), twee essentiële lichte ketens (MLC's) en twee regulerende MLC's. Zowel MyHC's als MLC's zijn aanwezig in verschillende isovormen die door verschillende genen worden gecodeerd. Een totaal van 11 MyHC's wordt gecodeerd door 6 zware ketens van myosine (MIJN H) genen die op grote schaal tot expressie worden gebracht in lichaamsspieren en 5 andere genen met beperkte expressie in gespecialiseerde skeletspieren. Vijf essentiële MLC's worden gecodeerd door vier myosine lichte ketens (MYL) genen, en twee regulerende MLC's door twee andere MYL genen (Tabel 1) (zie [1]). De meeste van deze genen komen ook tot expressie in de zich ontwikkelende skeletspier, waaronder twee MyHC-isovormen, embryonale en neonatale (of perinatale) myosinen genoemd, gecodeerd door MYH3 en MYH8, respectievelijk, en myosine lichte keten 1 embryonaal/atriale, gecodeerd door de MYL4 gen, die in hoge concentraties aanwezig zijn in de beginfase van spierontwikkeling, worden na de geboorte gedownreguleerd en komen opnieuw tot expressie tijdens spierregeneratie. Hier bekijken we het patroon van expressie van myosine-genen tijdens spierontwikkeling, met speciale aandacht voor embryonale en neonatale MyHC's. Daarnaast bespreken we de menselijke pathologieën als gevolg van mutatie van MYH3 en MYH8 en de onzekere vraag naar de functionele betekenis van deze myosinen.

Identificatie van ontwikkelingsmyosinen in skeletspieren van zoogdieren

Een aantal studies in de jaren zestig en zeventig rapporteerden biochemisch bewijs dat suggereert dat myosinen die zijn geïsoleerd uit embryonale of foetale skeletspieren van zoogdieren verschillen van myosinen van volwassen spieren (zie referenties in [2, 3]). Echter, Walen et al. [2] waren de eersten die ondubbelzinnig bewijs leverden voor het bestaan ​​van verschillende ontwikkelingsmyosinen. Ze identificeerden twee specifieke MyHC's, embryonale en neonatale (ook wel perinatale) MyHC's genoemd, hierna MyHC-emb en MyHC-neo genoemd, die voorafgaan aan het verschijnen van volwassen snelle myosines in de zich ontwikkelende skeletspier van ratten [2]. de overeenkomstige MIJN H genen werden geïdentificeerd [4, 5] en bevonden zich in dezelfde chromosomale locus als het gen dat codeert voor volwassen snelle myosine zware ketens op chromosoom 11 (muis) of 17 (mens) [6]. Het gen dat codeert voor MyHC-neo (MYH8) vertoont aanzienlijke sequentieovereenkomst met vasten voor volwassenen MIJN H genen, terwijl het gen dat codeert voor MyHC-emb (MYH3) is heel anders (zie [7] voor een vergelijkende sequentieanalyse van MIJN H genen). Embryonale skeletspieren bevatten ook een uniek type essentiële MLC, MLC-1emb, gecodeerd door de MYL4 gen, dat ook tot expressie wordt gebracht in het zich ontwikkelende hart en in volwassen atriale myocardium, maar niet in volwassen skeletspieren [8, 9].

Ontwikkelingsmyosines bij andere gewervelde dieren

Ontwikkelingsmyosines zijn ook aanwezig in andere gewervelde dieren, zoals vogels en vissen, hoewel de sarcomere myosinegenfamilies nog steeds onvolledig worden gekarakteriseerd in deze soorten. De identificatie van ontwikkelingsmyosinen bij vissen wordt bemoeilijkt door het grote aantal myosinegenen dat het resultaat is van duplicatie van het hele genoom [10]. In het zebravisembryo vindt diversificatie van snelle en langzame spiercellijnen zeer vroeg in de ontwikkeling plaats, onder controle van specifieke signaalroutes, wat leidt tot regionale specificatie van verschillende snelle en langzame MyHC-isovormen. Drie slow-type myosine-genen, smyhc1, smyhc2, en smyhc3, die een tandemreeks in het genoom vormen, vertonen differentiële expressiepatronen, waarbij primaire langzame vezels voornamelijk tot expressie komen smyhc1 en secundaire langzame vezels, die later in de ontwikkeling worden gevormd, smyhc2 en smyhc3 [11]. Zes fast-type myosine-genen, gerangschikt als drievoudige herhalingen in een smal gebied op tegenoverliggende strengen van chromosoom 5, vertonen ook verschillende expressiepatronen in het zebravisembryo: de genen in groep 1 (fmyhc1.1, fmyhc1.2, en fmyhc1.3) zijn uitgesloten van de staart en het grootste deel van de schedelspier, terwijl de genen in groep 2 (fmyhc2.1, fmyhc2.2, en fmyhc2.3) komen sterk tot uiting in de schedelspieren [12].

Bij vogels zijn drie embryonale en één neonatale MyHC geïdentificeerd bij de ontwikkeling van skeletspieren (beoordeeld door [13]). Bovendien bevatten het myotoom en de zich ontwikkelende spieren in kippenembryo drie langzame MyHC's, aangeduid als SM1 (of MyHC1), SM2 (of MyHC2) en SM3 (of MyHC3), waarbij SM3 ook tot expressie wordt gebracht in het atriale myocardium [ 13, 14]. Ventriculaire MyHC wordt ook tijdelijk tot expressie gebracht in de embryonale skeletspieren van kippen en wordt opnieuw tot expressie gebracht tijdens spierregeneratie [14]. De expressie van langzame MyHC's vindt plaats in specifieke skeletspieren, onafhankelijk van innervatie, als gevolg van het bestaan ​​van verschillende lijnen van myogene voorlopers (zie [15]). De omschakeling van ontwikkelings- naar volwassen isovormen varieert ook in verschillende kippenspieren: een volledige omschakeling van embryonale/neonatale naar volwassen snelle MyHC vindt plaats in de borstspier, maar de meeste andere spieren bevatten embryonale/neonatale isovormen als belangrijkste componenten gedurende de volwassen stadia [13] ].

Embryonale en neonatale myosines tijdens de spierontwikkeling van ratten en muizen

Embryonale en neonatale myosines zijn bijzonder goed gekarakteriseerd bij het ontwikkelen van skeletspieren van ratten en muizen. MyHC-emb- en MyHC-neo-transcripten zijn gedetecteerd door in situ hybridisatie in de vroege ontwikkelingsstadia: in het muizenembryo wordt MyHC-emb voor het eerst gedetecteerd op 9,5 dagen na coïtum (E9.5) en MyHC-neo op E10.5 [16]. De opregulatie van deze genen wordt blijkbaar gecontroleerd door de activiteit van de myogene regulerende factoren MyoD en Myf5, die betrokken zijn bij spierbinding en -differentiatie, aangezien de proximale promoters van ontwikkelingsmyosinegenen E-boxen bevatten die reageren op MyoD en Myf5 [17, 18]. De zich ontwikkelende skeletspieren brengen ook een myosine tot expressie dat niet te onderscheiden is van de volwassen MyHC-slow, gecodeerd door MYH7, zoals bepaald door analyses op eiwit- en transcriptniveau [19]. Op basis van het patroon van reactiviteit van een aantal anti-myosine-antilichamen werd gesuggereerd dat de MyHC-isovormen van het langzame type die aanwezig zijn in de embryonale spieren eigenlijk verschillen van die in de volwassen skeletspier [20], maar deze interpretatie heeft niet is bevestigd. Er werd ook gesuggereerd dat de slow-tonic MyHC, voor het eerst geïdentificeerd in de extraoculaire spieren en intrafusale vezels van spierspoeltjes van de volwassen spieren [21] en recentelijk werd gecodeerd door de MYH7b gen [22], is een langzaam ontwikkelende isovorm die algemeen tot expressie wordt gebracht in de meeste embryonale spieren [23]. Echter, MYH7b transcripten zijn in zeer lage niveaus aanwezig in embryonale muizenspier op E12, en MYH7b-eiwit wordt niet gedetecteerd in embryonale en foetale spieren met behulp van een polyklonaal antilichaam dat specifiek is voor het N-terminale domein van MYH7b, behalve zeldzame vezels, voor het eerst geïdentificeerd rond E20, bestemd om de zakvezels van spierspoeltjes te worden (zie [22]). Concluderend wijst het beschikbare bewijs erop dat drie MyHC's op eiwitniveau aanwezig zijn in de zich ontwikkelende skeletspier van ratten en muizen: MyHC-emb (MYH3), MyHC-neo (MYH8), en MyHC-slow (MYH7). Immunohistochemische studies toonden aan dat het patroon van expressie van ontwikkelingsmyosinen varieert in vezels gevormd in verschillende ontwikkelingsstadia. In vezels van de primaire generatie van ratten wordt MyHC-emb mede tot expressie gebracht met MyHC-slow [19, 24], terwijl vezels van de secundaire generatie embryonale en neonatale MyHC's tot expressie brengen [25]. In de latere foetale stadia hebben een aantal vezels van de primaire generatie de neiging MyHC-slow te verliezen en MyHC-neo-reactiviteit te verwerven, terwijl een aantal vezels van de secundaire generatie in langzame spieren ook MyHC-slow kleuren [25].

MyHC-genactivering tijdens embryonale myogenese gaat gepaard met parallelle opregulatie van MLC's en andere contractiele eiwitgenen. In situ hybridisatiestudies toonden aan dat de transcripten voor MLC-1emb (MYL4) worden uitgedrukt samen met MLC-1fast (het belangrijkste splitsingsproduct van de MYL1 gen) beginnend in de vroege ontwikkelingsstadia in de embryonale skeletspier van de muis, zijn hun relatieve niveaus vergelijkbaar op E12.5, maar MLC-1fast wordt overheersend op E15.5 [16]. MLC-2fast (MYL3) transcripten zijn ook vroeg in de embryogenese van muizen aanwezig, met variabele temporele en ruimtelijke patronen van expressie in verschillende spiergroepen [26]. Daarentegen transcripten voor MLC-1slow/ventriculaire (MYL4) en MLC-3fast (een ander splitsingsproduct van de MYL1 gen) zijn niet detecteerbaar in de zich ontwikkelende spieren vóór E15 [16].

Embryonale/neonatale-naar-volwassen myosine switch

Ontwikkelingsmyosines verdwijnen in de meeste skeletspieren tijdens de vroege postnatale ontwikkeling samen met de opregulatie van volwassen snelle myosines. In de skeletspieren van het rattenbeen waren de transcripten voor volwassen snelle MyHC's (MyHC-2A, MyHC-2X en MyHC-2B, gecodeerd door MYH2, MYH1, en MYH4, respectievelijk) worden enkele dagen na de geboorte voor het eerst gedetecteerd door in situ hybridisatie en worden in de daaropvolgende weken overheersend [27]. Deze omschakeling vindt eerder plaats in de skeletspieren van de muis, omdat kleine hoeveelheden volwassen snelle myosinetranscripten zelfs vóór de geboorte kunnen worden gedetecteerd met behulp van gevoelige RNAase-beschermingsassays en door in situ hybridisatie [28]. Op eiwitniveau bevatten de snelle pasgeboren muisspieren echter hoofdzakelijk MyHC-neo (ongeveer 70%) en MyHC-emb (ongeveer 30%) met sporen van MyHC-slow, zoals bepaald door gelelektroforese met hoge resolutie [29]. De timing van embryonale en neonatale myosine-downregulatie en volwassen snelle myosine-upregulatie toont significante variatie tussen lichaamsspieren, zowel op mRNA [28] als eiwitniveau [29]. De eliminatie van ontwikkelingsmyosine kan ook variëren binnen dezelfde spier, zo bleek neonatale myosine langer aan te houden in type 2A-vezels tijdens postnatale ontwikkeling [30]. Interessant is dat de timing van downregulatie van ontwikkelings-MyHC-isovormen in wezen onveranderd was in MYH4 (2B) en MYH1 (2X) nulmuizen [31].

De omschakeling van ontwikkelings- naar volwassen snelle MyHC's die wordt gezien in snelle knaagdierspieren, vindt ook plaats in gekweekte spiercellen. Er is gemeld dat C2C12-spiercellen, wanneer ze worden geïnduceerd om te differentiëren bij overdracht naar een laag serummedium, eerst MyHC-emb-, MyHC-neo- en MyHC-slow-transcripten tot expressie brengen, beginnend op dag 1 en een piek op dag 2-4 en vervolgens afnemend, terwijl MyHC-2A-, MyHC-2X- en MyHC-2B-transcripten beginnen toe te nemen op dag 2-4 en pieken op dag 8 (het laatste onderzochte tijdstip) [32]. Er zijn echter controversiële resultaten over het MyHC-expressiepatroon in satellietcelculturen van verschillende skeletspieren (zie [33, 34]), en kauwspecifieke myosine zware keten (Myh16) werd gedetecteerd in culturen van kattenkaakspieren maar niet van ledematenspieren , wat suggereert dat spiercellen van kaaksluitende spieren voorgeprogrammeerd zijn om deze isovormen tot expressie te brengen tijdens myogenese in vitro [35].

De ontwikkelingsomschakeling van ontwikkelings- naar volwassen MyHC's kan worden gemoduleerd door extrinsieke hormonale en neurale invloeden. De embryonale/neonatale-naar-volwassen snelle myosine-omschakeling staat onder controle van een schildklierhormoon, hyperthyreoïdie induceert een vroegrijpe expressie van volwassen snelle myosine-zware-keten-mRNA en hypothyreoïdie induceert een vertraging in deze omschakeling [36-38]. Daarentegen is zenuwactiviteit blijkbaar niet nodig voor de embryonale/neonatale-naar-snelle myosine-switch [39, 37], maar wel om de postnatale accumulatie van MyHC-slow en het verdwijnen van MyHC-emb in de langzame soleusspier te bevorderen [ 19].

De moleculaire mechanismen die de myosine-switch tijdens de ontwikkeling regelen, moeten nog worden vastgesteld en omvatten waarschijnlijk specifieke regulerende sequenties die verband houden met de MIJN H genencluster, waar MIJN H genen zijn gerangschikt in de volgorde: MYH3-MYH2-MYH1-MYH4-MYH8-MYH13. Er is gemeld dat schildklierhormoon de overgang regelt tussen neonatale en volwassen snelle 2B MyHC door een lang niet-coderend antisense-RNA dat transcriptioneel wordt gereguleerd tijdens postnatale ontwikkeling en als reactie op hypothyreoïdie: dit antisense-RNA wordt getranscribeerd vanaf een plaats binnen het intergene gebied tussen MYH8 (MyHC-neo) en de nauw verbonden MYH4 (MyHC-2B) gen en lijkt de transcriptionele repressie van de MYH8 gen [40]. Een centrale versterker tussen de MYH3 en MYH2 genen is onlangs geïdentificeerd [41]. Deze versterker, waarvan de functie wordt gecontroleerd door zes homeoproteïnen, werkt in cis door de expressie van snel te reguleren MIJN H genen (MYH2, MYH1, en MYH4), die zich stroomafwaarts van de versterker bevindt, en in trans via een lang intergeen niet-coderend RNA (linc-Myh) om de uitdrukking van te onderdrukken MYH7 (MyHC-langzaam) [41]. Het is echter niet bekend of deze versterker ook betrokken is bij de regulatie van ontwikkelingsmyosinegenen, MYH3 en MYH8, zich dus gedragen als een MIJN H locus control region (LCR) vergelijkbaar met dat aanwezig in de -globine locus, of andere LCR's, geassocieerd met de MIJN H gencluster, controle over de ontwikkelingsstoornissen MIJN H schakelaar.

Myosineveranderingen in de zich ontwikkelende menselijke skeletspier

Het ontwikkelingspatroon van myosine-isovormexpressie in de menselijke embryonale en foetale skeletspier is relatief minder onderzocht. In week 8 van de zwangerschap zijn primaire generatievezels met centrale kernen aanwezig in de menselijke skeletspier, terwijl secundaire generatievezels worden gevormd na week 10 en de overheersende vezelpopulatie worden in week 21 [42]. MyHC-emb-, MyHC-slow- en MyHC-neo-transcripten zijn detecteerbaar in de zich ontwikkelende skeletspier in week 9 (Fig. 1). Op eiwitniveau brengen alle primaire myovezels MyHC-emb en MyHC-slow [43, 44] tot expressie, waarbij MyHC-emb detecteerbaar is vóór MyHC-slow in de initiële myotubes [45]. Het aandeel vezels dat kleurt voor MyHC-slow neemt af van 75% in week 10 tot 3% in week 21 van de zwangerschap, vanwege de dramatische toename van secundaire vezels die aanvankelijk geen MyHC-slow bevatten [45]. Vezels van de secundaire generatie brengen alleen MyHC-emb tot expressie in week 12, MyHC-neo-eiwit wordt in latere stadia gedetecteerd [45]. Kwantitatieve RNA-analyse geeft aan dat: MYH3 transcripties zijn goed voor ongeveer 81% van alles MIJN H transcripten in de menselijke foetale skeletspier in week 15 van de zwangerschap [46]. In week 16 tot 17 werd een tertiaire vezelpopulatie geïdentificeerd, aanvankelijk samengesteld uit zeer kleine myovezels gekleurd door een anti-myosine-antilichaam dat reactief is met volwassen vasten maar niet met neonatale MyHC [44, 47]. In situ hybridisatie geeft aan dat MyHC-2A-transcripten zwak tot expressie worden gebracht in week 19 en sterker bij de geboorte, terwijl MyHC-2X-transcripten nauwelijks aanwezig zijn bij de geboorte en duidelijk tot expressie worden gebracht 30 dagen na de geboorte (Fig. 1). Na week 27 begint een deel van de secundaire vezels MyHC-slow tot expressie te brengen, en in week 30, ongeveer 50% van alle spiervezels tot expressie MyHC-slow, zoals in volwassen spieren [45, 44]. In de zich ontwikkelende menselijke spieren worden beide ontwikkelings-MyHC-isovormen tegen het einde van de zwangerschap gedownreguleerd, de corresponderende MyHC-transcripten worden bij de geboorte op lage niveaus tot expressie gebracht, en bij een 1 maand oude baby blijft MyHC-neo slechts in een paar vezels aanwezig [ 48] (afb. 1). Concluderend, de meeste menselijke skeletspiervezels, waarschijnlijk meer dan 95%, lijken voort te komen uit secundaire en tertiaire golven van myogenese en hun diversificatie in de snelle type 2A of langzame type 1 lijn vindt plaats vóór de geboorte, tijdens het derde trimester van de zwangerschap, terwijl de differentiatie van type 2X vezels vindt plaats in de eerste week na de geboorte.

MyHC-transcripten bij de ontwikkeling van menselijke skeletspieren. De transcripten werden onthuld door in situ hybridisatie met behulp van probes die specifiek zijn voor het volgende: MIJN H genen: MYH3 (Emb, eenNS), MYH8 (Neo, eH), MYH7 (Traag, lik), MYH2 (2A, mP), en MYH1 (2X, Qt). De onderzochte spieren waren quadriceps femoris van 9 en 19 weken oude foetussen en vastus lateralis van pasgeborenen van 1 dag (P1) en 1 maand oud (P30). Bar = 30 m (vanaf [48])

In de zich ontwikkelende menselijke quadriceps kunnen tussen week 7 en 12 drie MLC-eiwitten worden gedetecteerd door 2D-gelelektroforese [49]. MLC-3fast wordt duidelijk zichtbaar in week 25, wanneer MLC-1emb snel begint af te nemen. De belangrijkste verandering tijdens het derde trimester van de zwangerschap is de progressieve accumulatie van de langzame isovormen van MLC, zodat bij de geboorte het MLC-profiel vergelijkbaar is met dat van volwassen spieren [49]. MLC-1sa-transcripten zijn ook detecteerbaar in menselijke skeletspieren in week 24, hoewel op significant lagere niveaus in vergelijking met volwassen spieren [50].

Ontwikkelingsmyosines in volwassen skeletspieren

Ontwikkelings-MyHC's blijven gedurende de volwassen stadia bestaan ​​in een aantal vezels die aanwezig zijn in gespecialiseerde spieren, waaronder de extraoculaire spieren [51, 52] en spierspoeltjes [53, 54, 23], evenals de kaaksluitende spieren [55-57] en strottenhoofdspieren [58]. MLC-1emb/atrial is ook aanwezig in volwassen menselijke kauwspieren [55] en is de exclusieve of overheersende essentiële MLC die wordt geassocieerd met MyHC-M (MYH16) in de kaaksluitende spieren van carnivoren en andere zoogdiersoorten [59, 60]. Een recent proteomics-onderzoek van enkele vezels van de skeletspier van volwassen muizen onthulde dat sporen van MyHC-emb detecteerbaar zijn in alle volwassen myovezels, terwijl kleine hoeveelheden MyHC-neo aanwezig zijn in snelle spiervezels [61]. MyHC-emb is ook gedetecteerd in de volwassen menselijke skeletspier [62]. In de extraoculaire spieren zijn de vezels die MyHC-emb tot expressie brengen specifiek gelokaliseerd in de orbitale laag (Fig. 2a) en vertonen ze variaties in expressie langs de lengte van de vezels, die overvloediger zijn in de distale zones en minder overvloedig in de centrale zone ( zie [63]).In deze spieren wordt embryonale myosine meestal samen tot expressie gebracht met andere myosinetypes [63], waaronder de nieuw ontdekte MYH15 [22]. In de twee vezeltypen die aanwezig zijn in spierspoeltjes, zijn de nucleaire keten en nucleaire zakvezels, MyHC-emb en MyHC-neo meestal gelokaliseerd in nucleaire ketenvezels (figuur 2b). De embryonale en neonatale MIJN H genen kunnen worden geïnduceerd door hypothyreoïdie in specifieke volwassen spieren [64]. Spierverlamming veroorzaakt door resectie van de zenuw of door tetrodotoxine-geïnduceerde blokkering van zenuwgeleiding leidt ook tot herexpressie van ontwikkelingsmyosinen, die specifiek voorkomt in type 2A-vezels maar over het algemeen beperkt is tot korte vezelsegmenten [30].

Embryonale MyHC in volwassen skeletspieren. een Dwarsdoorsneden van de extraoculaire spier van de rat (rectus superior) reageerden met een monoklonaal antilichaam specifiek voor MyHC-emb (BF-G6, zie [76]). Merk op dat embryonale myosine tot expressie wordt gebracht in de meeste vezels van de orbitale laag (O) maar alleen in zeldzame vezels van de globale laag (G) van de spier. Bar = 100 urn. B Embryonale myosine in intrafusale vezels van spierspoeltjes. Seriële secties van de rat soleus-spier bekeken in fasecontrast of gekleurd voor MyHC-emb (MYH3), MyHC-slow-tonic (MYH7b), of MYH15 (MYH15). Embryonale myosine wordt gedetecteerd in de kernketenvezels van een spierspoel (3 en 4) maar niet in de nucleaire zakvezels (5 en 6), noch in het extracapsulaire gebied van een aangrenzende spindel (vezels 1 en 2). Extrafusale spiervezels (asterisk) zijn onbevlekt. Bar = 20 m (gewijzigd van [22])

Herexpressie van ontwikkelingsmyosinen in regenererende spieren

Skeletspieren kunnen efficiënt regenereren na verschillende soorten letsel (zie [65] voor een overzicht). Spierregeneratie wordt gemedieerd door de satellietcellen die aanwezig zijn onder de basale lamina van de spiervezels, die worden geactiveerd na verwonding en proliferatie en fusie ondergaan, waardoor nieuwe spiervezels worden gevormd. Regenererende spiervezels brengen de ontwikkelings-isovormen van myosine, troponine en andere spiereiwitten opnieuw tot expressie [66, 67, 3]. Embryonale en neonatale MyHC's worden 2-3 dagen na verwonding gedetecteerd in nieuw gevormde regenererende myovezels en blijven 2-3 weken aanhouden (figuur 3a). MLC-1emb wordt ook tijdelijk tot expressie gebracht in regenererende skeletspieren [68]. Herexpressie van ontwikkelingsmyosinen kan worden onthuld in een verscheidenheid aan aandoeningen waarbij sprake is van spierdegeneratie/regeneratie, waaronder injectie van het slangengif notexine en cardiotoxine [69, 70], chronische denervatie [71] of spierbeschadiging veroorzaakt door chronische elektrische stimulatie [72]. De aanwezigheid van ontwikkelingsmyosines vertegenwoordigt dus een bruikbare marker voor spierregeneratie in diermodellen van spierziekte, zoals de dystrofine-deficiënte mdx muismodel van spierdystrofie [73] en in menselijke myopathieën, zoals Duchenne spierdystrofie [74] of polymyositis (Fig. 3b). De aanwezigheid van embryonaal myosine kan ook een nuttige marker zijn bij de diagnose van rabdomyosarcoom [75, 76].

Embryonale MyHC in het regenereren van spiervezels. een Expressie van embryonale myosine in regenererende skeletspieren van ratten op verschillende tijdsperioden na door bupivacaïne geïnduceerde verwonding. De progressie van spierregeneratie van dag 3 tot dag 14 na blessure kan worden gevolgd in seriële secties die gekleurd zijn met hematoxyline en eosine (bovenste panelen) of immunologisch gekleurd voor embryonale myosine (onderste panelen). Let op de afwezigheid van embryonale myosine in de controlespier. Bar = 50 m (gewijzigd van [65]). B Regenererende spiervezels kleuring voor embryonale myosine in menselijke myopathieën. Sectie van menselijke spierbiopsie van een patiënt met polymyositis gekleurd voor MyHC-emb (rood) en laminine (groente). Let op het grote aantal regenererende spiervezels die reactief zijn voor embryonale myosine. Bar = 50 m (met dank aan Elena Pegoraro)

De omschakeling van embryonale/neonatale naar volwassen snelle myosinen in regenererende spieren is onafhankelijk van innervatie, terwijl de omschakeling naar langzame myosine wordt gecontroleerd door langzame zenuwactiviteit [69, 66, 70]. In een veelgebruikt model, met spierbeschadiging geïnduceerd door bupivacaïne-injectie in de trage soleus-spier van de rat, brengen regenererende myovezels alleen embryonale en neonatale myosinetranscripten tot expressie op dag 2-3 na verwonding, maar beginnen op dag 4 volwassen snelle myosine-mRNA's tot expressie te brengen. In de aanwezigheid van de zenuw wordt de langzame myosine echter snel opgereguleerd en worden snelle myosinetranscripten neerwaarts gereguleerd, terwijl in de afwezigheid van de zenuw volwassen snelle myosines zich blijven ophopen en langzame myosinetranscripten ondetecteerbaar blijven [77]. Dit proces wordt gemedieerd door het patroon van zenuwactiviteit, omdat het kan worden gereproduceerd door elektrische stimulatie van regenererende spieren met behulp van een stimulatiepatroon dat de endogene langzame activiteit van motorneuronen nabootst [78]. Het regenereren van snelle en langzame spieren reageren echter verschillend op hetzelfde stimulatiepatroon, wat de mogelijkheid ondersteunt dat de embryonale/neonatale-naar-volwassen snelle of langzame myosine-omschakeling het bestaan ​​van intrinsieke verschillen tussen satellietcelpopulaties in de verschillende vezeltypes weerspiegelt. Deze interpretatie is consistent met een aantal onderzoeken naar gekweekte spiercellen, maar deze kwestie valt buiten het bestek van deze review.

Menselijke aangeboren aandoeningen als gevolg van mutaties van embryonale en neonatale myosines

De cruciale rol van embryonale en neonatale myosine tijdens de menselijke ontwikkeling is recentelijk aangetoond door de pathologische gevolgen van MYH3 en MYH8 mutaties (zie [79]). Mutaties in de MYH3 (MyHC-emb) gen zijn verantwoordelijk voor sommige soorten distale arthrogryposis (DA) syndromen, aangeboren aandoeningen die worden gekenmerkt door contracturen van meerdere ledematen [80]. MYH3 genmutaties zijn in verband gebracht met twee belangrijke DA-syndromen, DA2A en DA2B/DA1. Freeman-Sheldon-syndroom (FSS, DA2A) wordt gekenmerkt door contracturen van het gezicht en congenitale scoliose, naast contracturen van de ledematen. Dit is de meest ernstige van de DA-syndromen en patiënten hebben voedings-, chirurgische en revalidatie-interventie nodig [81]. FSS stond ook bekend als het "fluitende gezicht-syndroom", omdat de lippen getuit of samengeknepen lijken en er slechts een kleine orale opening overblijft. In feite is tot op heden de enige geïdentificeerde oorzaak van FSS een mutatie in het MYH3-gen. DA2B (Sheldon-Hall-syndroom, SHS) en DA1, die de uitersten van dezelfde fenotypisch variabele en genetisch heterogene aandoening lijken te vertegenwoordigen, kunnen ook te wijten zijn aan MYH3 mutaties [82]. DA2B en DA1 kunnen echter ook worden veroorzaakt door mutaties in TNNI2, coderend voor snel troponine I, TNNT3, codering voor snel troponine T, en TPM2, coderend voor β-tropomyosine.

Meest MYH3 mutaties in DA2A en DA2B overlappen elkaar niet, wat suggereert dat er een verband is tussen MYH3 genotype en fenotype (Fig. 4), en ook binnen DA2A zijn verschillende aspecten van het fenotype geassocieerd met specifieke mutaties [80]. Drie MYH3 mutaties met geconserveerde residuen, T178I, R672H en R672C, zijn goed voor meer dan 90% van de MYH3 mutaties die FSS veroorzaken, waarbij T178I het ernstigst is en R672C het minst [81]. T178I is echter ook in verband gebracht met SHS. Zowel R672- als T178-residuen komen overeen met een groef naast de nucleotide-bindingsplaats, wat suggereert dat mutatie van deze residuen de actieve plaats rondom de nucleotide-bindingsplaats kan veranderen. Daarentegen lokaliseren residuen die in SHS zijn gemuteerd over het algemeen op oppervlakken die kunnen interageren met andere eiwitten van het contractiele apparaat, zoals actine en troponine: dit zou kunnen verklaren waarom een ​​vergelijkbaar SHS-fenotype kan worden veroorzaakt door TNNI2 en TNNT3 mutaties (Fig. 4).

MYH3 mutaties die distale artrogryposis veroorzaken. een Schema van het embryonale myosinemolecuul dat de plaatsen van verschillende mutaties laat zien die het Freeman-Sheldon-syndroom veroorzaken (FSS, bovenstaand) en het Sheldon-Hall-syndroom (SHS, onderstaand). Merk op dat de meeste mutaties zich lokaliseren in het hoofddomein van het myosinemolecuul, en dat mutaties die FSS veroorzaken verschillen van die welke SHS veroorzaken. B Een model van het actine-myosinecomplex. Een deel van het actinefilament dat vijf actinemonomeren omvat, wordt weergegeven als een donkergrijs lint. Myosine zware keten (Zware ketting), essentiële lichte keten (ELC), en regelgevende lichte keten (RLC) worden weergegeven als blauw, Oranje, en groene linten, respectievelijk. MYH3 mutaties die distale arthrogryposis veroorzaken, worden getoond met te grote ruimtevullende atomen, met FSS-mutaties gekleurd rood en SHS-mutaties geel (gewijzigd van [80])

MYH8 (MyHC-neo)-mutaties zijn verantwoordelijk voor een andere vorm van distale arthrogryposis (DA7), het trismus-pseudocamptodactyly-syndroom (TPS) genoemd, omdat de patiënten de mond niet volledig kunnen openen (trismus) en een ongewone camptodactylie (flexie van de vingers) ) dat alleen zichtbaar is bij dorsaalflexie van de pols (dwz pseudocamptodactylie). In tegenstelling tot het grote aantal MYH3 mutaties die FSS en SHS veroorzaken, slechts een enkele MYH8 mutatie (R674Q) is geïdentificeerd in verschillende families met het trismus-pseudocamptodactyly-syndroom [83, 84]. Het aangetaste residu R674, dat vanwege verschillende nummering overeenkomt met R672 in het hierboven beschreven MYH3-gen, is geconserveerd in verschillende gewervelde soorten en in verschillende MIJN H gen dat codeert voor sarcomere myosinen. Dit residu is gelokaliseerd in de buurt van de ATP-bindingsplaats en kan dus interfereren met de katalytische activiteit van myosine. In de familie beschreven door Veugelers et al. [84], bleek TPS geassocieerd te zijn met manifestaties die typisch zijn voor het Carney-complex, waaronder de aanwezigheid van cardiale myxomen, wat wijst op een mogelijke rol van de MYH8 gen in de ontwikkeling van het hart. Deze associatie werd echter niet gevonden in de families die werden gerapporteerd door Toydemir et al. [83], en TPS werd nooit waargenomen in grote verzamelingen van Carney-complexe gevallen [85].

Hoe kan men de aangeboren contracturen verklaren die worden veroorzaakt door mutaties in ontwikkelingsmyosinen? Een plausibele interpretatie is dat: MYH3 of MYH8 genmutaties interfereren met de katalytische activiteit van myosine vanwege het dominante negatieve effect van het gemuteerde allel, en veroorzaken zo defecten in de productie van myovezelkracht in de baarmoeder. Actieve bewegingen van het embryo zijn nodig voor de normale ontwikkeling van de gewrichten, zoals blijkt uit klassieke studies bij het kippenembryo [86, 87]. Deze studies toonden aan dat spierverlamming in ovo geïnduceerd door neuromusculaire blokkers, zoals curare of botulinumtoxine, artrogryposis veroorzaakt. De orofaciale dysmorfismen veroorzaakt door MYH3 of MYH8 genmutaties kunnen een vergelijkbare rol weerspiegelen van de samentrekking van gezichtsuitdrukkingsspieren bij het vormgeven van de vorm van het gezicht tijdens de ontwikkeling van de foetus.

De opvatting dat mutaties van MYH3 en MYH8 leiden tot hypocontractiliteit van foetale spieren wordt ondersteund door twee recente bevindingen. Ten eerste is de verandering van de cross-bridge-turnover bij patiënten met R672C-mutatie bevestigd door een gedetailleerde analyse van myofibril en enkelvezelige mechanica [62]. Ten tweede hebben voorlopige resultaten met geïsoleerde myosine S1 (subfragment 1), het deel van het myosinemolecuul dat de myosinekop en de hefboomarm omvat, dat voldoende is om actineschuifbewegingen in in vitro motiliteitstests aan te sturen, aangetoond dat verschillende kinetische parameters van het kruis -brugcyclus worden gewijzigd in aanwezigheid van R672C-, R672H- en T178I FSS-veroorzakende mutaties [88].

Contractiele eigenschappen van embryonale en neonatale myosines

Baanbrekende studies in de jaren zestig toonden aan dat een overgang in contractiele eigenschappen optreedt rond of net na de geboorte in de spieren van katten [89, 90] en ratten ([91, 92], zie [93] voor een overzicht), zoals weergegeven in Fig. 5a , B. Tijdens de eerste week van de postnatale ontwikkeling neemt de isometrische kracht toe in zowel langzame als snelle spieren, terwijl de maximale verkortingssnelheid toeneemt in snelle maar niet in langzame spieren. De toename in sterkte zou kunnen worden verklaard door parallelle toevoeging van myofibrillen (maar zie hieronder). De verandering in maximale verkortingssnelheid wijst echter op veranderingen in myosine-isovormen, waarvan wordt aangenomen dat ze de belangrijkste determinanten zijn van maximale verkortingssnelheid en ATPase-activiteit [94] ]. Verdere ondersteuning voor deze interpretatie werd gegeven door de waarneming van een parallelle toename van de myosine-ATPase-activiteit tijdens de ontwikkeling [92], terwijl de versnelling in de snelheid van de spanningstoename en de vermindering van de twitch-tijdparameters vermoedelijk een convergente bijdrage weerspiegelen van veranderingen in de myosinekinetiek en rijping van sarcoplasmatisch reticulum [92, 95].

Kinetische eigenschappen van neonatale myosine. een, B Postnatale veranderingen in maximale verkortingssnelheid (een) en ATPase-activiteit (B) in rat extensor digitorum longus (EDL) spier. Merk op dat de ontwikkelingsvervanging van neonatale myosine door volwassen snelle myosine tijdens de eerste week na de geboorte gepaard gaat met een tweevoudige toename van Vmax en ATPase-activiteit. (Paneel een hertekend uit tabel 1 van [91], paneel B opnieuw getekend uit figuur 3 (a) van [92]). C Onbelaste verkortingssnelheid van enkele vezels van konijnen-psoas neemt toe tijdens postnatale stadia gelijktijdig met de vervanging van neonatale door volwassen snelle isovormen (opnieuw getekend uit gegevens in tekst en in figuur 2 van [96]). NS Myofibrillaire ATPase-activiteit van enkele vezels geïsoleerd uit de middenrifspier van neonatale en volwassen ratten en geïdentificeerd in relatie tot hun MyHC-isovormsamenstelling. Let op de lagere ATPase-activiteit van neonatale vergeleken met volwassen snelle vezels (opnieuw getekend uit gegevens in figuur 4 van [98])

De veranderingen als gevolg van de ontwikkelingsvervanging van de myosine-isovorm werden bestudeerd in enkelvoudige psoas-vezels van konijnen [96]. Bij de geboorte overheerst neonatale myosine en wordt geleidelijk vervangen door volwassen snelle isovormen. Het verband tussen myosine-isovormvervanging en veranderingen in contractiele eigenschappen, maximale verkortingssnelheid en ATPase-activiteit is geanalyseerd in enkele spiervezels waar MyHC-expressie werd bepaald door gelelektroforese. Bij konijnen-psoas is vervanging van neonatale MyHC door volwassen snelle, voornamelijk 2X, isovormen geassocieerd met een drievoudige toename van de maximale verkortingssnelheid [96] (zie figuur 5c). In het diafragma van de rat is neonatale myosine de belangrijkste isovorm in de eerste twee weken na de geboorte, hoewel zelden alleen tot expressie gebracht in individuele vezels, maar vaker geassocieerd met snelle 2A-myosine [97-99]. Vezels die overwegend neonatale myosine tot expressie brengen, vertonen waarden van verkortingssnelheid en ATPase-activiteit vergelijkbaar met langzame vezels en veel lager dan snelle 2X- en 2B-vezels (figuur 5d). Het verdwijnen van neonatale myosine gaat gepaard met een toename van het ATP-verbruik [98] en een toename van het vermogen [99].

De opvatting dat neonatale myosine bij zoogdieren een kinetiek heeft die vergelijkbaar is met die van 2A-myosine, maar langzamer dan 2X- en 2B-myosines, heeft steun gekregen van de experimenten met het recombinante menselijke myosine S1-motordomein dat tot expressie wordt gebracht in C2C12-myotubes [100]. Een extra interessant kenmerk dat naar voren komt uit Resnicow et al. [100] gegevens zijn dat K m waarden voor actine zijn veel groter voor ontwikkelings- dan voor volwassen myosines. Dit suggereert zelfs lagere waarden van ATP-hydrolysesnelheid voor onrijpe myofibrillen in andere omstandigheden dan maximale actine-activering.

De functionele kenmerken van embryonale myosine zijn nog weinig bekend. De studie van Resnicow et al. laat echter zien dat de kinetiek van embryonale myosine langzamer is dan die van neonatale myosine, zowel voor de ATPase-snelheid als voor de glijsnelheid van de actinefilamenten [100]. Hoewel de interpretatie van dit resultaat wordt bemoeilijkt door de bevinding dat het embryonale myosine-motordomein geen enkele lichte keten bindt wanneer het tot expressie wordt gebracht in C2C12-myogene cellen, wijst een onafhankelijk onderzoek op dezelfde conclusie [46]. Gezuiverde myosine en intacte myofibrillen werden bereid uit menselijke spiermonsters die waren verkregen van vier foetussen in de leeftijd van 12-15 weken na de conceptie. Kwantitatieve PCR- en eiwitanalyse toonde aan dat MyHC-emb grotendeels overheersend was, meer dan 80% van het totale aanwezige myosine. Vergeleken met psoas konijn myosine (waarschijnlijk een mengsel van 2X en 2B myosinen), was de actine filament snelheid van de menselijke embryonale myosine meer dan drie keer lager. Rekening houdend met het feit dat konijnenmyosines ongeveer twee keer zo snel zijn als menselijke embryonale spiermyosine(s) [101], kan men aannemen dat de glijsnelheid van actinefilamenten op menselijke embryonale myosine minstens 1,5 keer lager is dan op snelle menselijke myosine.

Intacte myofibrillen maakten ook bepaling van kracht en snelheid van krachtontwikkeling en -afname mogelijk. De kracht ontwikkeld door myofibrillen die embryonaal myosine bevatten, bleek meer dan tien keer lager te zijn dan die ontwikkeld door volwassen menselijke myofibrillen [46]. Er zijn geen gegevens beschikbaar over het vermogen om kracht te ontwikkelen van myofibrillen die neonatale myosine bevatten, maar de resultaten die zijn verkregen met embryonale myosine suggereren dat de toename van de actieve kracht tijdens de ontwikkeling niet alleen te wijten kan zijn aan parallelle accumulatie van myofibrillen, maar ook aan de overgang van myosine isovormen.

Hoewel de kinetische eigenschappen van de contractiele respons bijna uitsluitend verband houden met de MyHC-isovormen, kan de krachtontwikkeling ook aanzienlijk worden beïnvloed door andere eiwitten die aanwezig zijn in het myofibrillaire apparaat. Ontwikkelingsveranderingen in MLC-genexpressie (zie hierboven) kunnen relevant zijn. In het dunne filament kunnen embryonale en neonatale skeletspieren ook unieke isovormen tot expressie brengen: harttroponine T (TnT) wordt bijvoorbeeld tot expressie gebracht in embryonale skeletspier en unieke TnT-isovormen, vermoedelijk verkregen door alternatieve splicing van het snelle skeletspier-TnT-gen, worden gedetecteerd in foetale en neonatale spieren [67].

Functionele betekenis van ontwikkelingsmyosinen

Een relevante vraag blijft onbeantwoord: wat is het voordeel (of noodzaak), indien aanwezig, van het hebben van specifieke myosine-isovormen tijdens spierontwikkeling. Er kunnen twee verschillende interpretaties worden overwogen. Een mogelijkheid is dat ontwikkelingsmyosinen structurele kenmerken hebben die geschikt zijn voor myofibrilvorming tijdens myogenese, zowel in het embryo als tijdens spierregeneratie bij de volwassene. Volgens het premyofibril-model van myofibrillogenese, ontwikkeld door Sanger uit onderzoeken in hart- en skeletspiercellen van vogels en recentelijk bevestigd in skeletspiercellen van muizen [102], wordt de myofibril-assemblage in premyofibrillen gekenmerkt door banden van klasse II niet-spier myosine die worden afgewisseld met actinevezels met banden van spierspecifieke α-actinine. De overgang van de premyofibril naar de ontluikende myofibril wordt gekenmerkt door de toevoeging van klasse II spier (sarcomere) myosine, maar het is niet bekend of de aanwezigheid in dit stadium van MyHC-emb een verplichte stap is voor het optreden van myofibrillogenese in skeletspiercellen . Knockout-experimenten in vivo of knockdown-experimenten in gekweekte spiercellen zouden nodig zijn om deze vraag te beantwoorden. Er moet worden benadrukt dat myofibrillen die in wezen identiek zijn aan die aanwezig zijn in skeletspieren, worden gevormd in de afwezigheid van MyHC-emb in zich ontwikkelende hartspiercellen, die alleen MyHC-β/slow en MyHC-α [103] bevatten.Knock-out- of knock-down-experimenten zouden ook kunnen worden gebruikt om te bepalen of embryonale en neonatale isovormen overtollige functies hebben, zodat een van hen in staat is om het ontbreken van de andere volledig te compenseren.

Een andere mogelijkheid is dat embryonale en neonatale myosinen unieke eigenschappen hebben die zijn aangepast aan de prenatale ontwikkelingsomgeving. Het is bijvoorbeeld algemeen bekend dat foetaal hemoglobine een grotere zuurstofaffiniteit heeft dan volwassen hemoglobine vanwege specifieke embryonale en foetale globines, waarvan de aanwezigheid bijdraagt ​​aan de transplacentale zuurstofstroom in de context van een relatief hypoxische intra-uteriene omgeving [104]. Ontwikkelingsverandering van contractiele eiwitten kan ook worden beïnvloed door zuurstofspanning. In de hartspier bleek hypoxie genexpressieprogramma's van vroege hartontwikkeling te reactiveren, met opregulatie van MyHC-slow (MYH7) en downregulatie van MyHC-α cardiale (MYH6), zowel in ventrikels van ratten die zijn blootgesteld aan hypobare hypoxie als in neonatale cardiomyocyten van ratten die zijn geïncubeerd in een hypoxische kamer [105]. In gekweekte skeletspiercellen bleek hypoxie de expressie van MyHC-slow te stimuleren via HIF-1α [106]. De ontwikkelingsverandering van troponine I van het langzame skelet naar de cardiale isovorm, waarvan bekend is dat het de calciumgevoeligheid van het contractiele apparaat moduleert, is in verband gebracht met de grotere weerstand tegen hypoxie en acidose van het foetale en neonatale hart (zie [107] ). Voor zover wij weten, is er echter geen vergelijkend onderzoek naar het effect van hypoxie en acidose op de functie van ontwikkelings- en volwassen myosines in skeletspieren. De lage ATPase-snelheid die typisch is voor neonatale, en zelfs meer embryonale myosine, zou kunnen suggereren dat deze myosine-isovormen een contractiele activiteit mogelijk maken tegen zeer lage energetische kosten.

Een alternatieve mogelijkheid is dat de dragende eigenschappen van ontwikkelingsmyosinen een belangrijke rol spelen bij de overgangen van myosine tijdens de ontwikkeling, aangezien foetale spieren samentrekken tegen een zeer lage belasting in vergelijking met postnatale spieren [108]. Het is verleidelijk om te speculeren dat foetale pezen, gewrichten en botten de mechanische stimuli nodig hebben die door spiercontractie worden geproduceerd voor hun juiste groei, maar tegelijkertijd geen overmatige spanningen kunnen verdragen, en embryonale myosine zou in dit opzicht geschikte eigenschappen kunnen hebben. Dienovereenkomstig is gespeculeerd dat de persistentie van ontwikkelingsmyosinen in de extraoculaire spieren verband kan houden met het feit dat oogspieren samentrekken tegen een veel lagere belasting in vergelijking met andere skeletspieren [51]. Deze interpretatie zou kunnen worden getest door specifieke experimentele benaderingen. In het bijzonder zal het cruciaal zijn om de contractiliteit van embryonale en neonatale myosine te bepalen door middel van geladen in vitro motiliteitstesten en analyses van één molecuul met een dual-beam laserval (zie [109]).


MATERIALEN EN METHODES

Cel cultuur

C2C12-cellen (ATCC CRL-1772) werden gekweekt op MatTek-schalen (MatTek Corp Ashland, MA). De dekglaasjes werden gedurende 15 minuten gecoat met 300-400 µL poly-l-lysine (Sigma-Aldrich St. Louis, MO), gevolgd door spoelen met Hanks Balanced Salt Solution met calcium en magnesium (Invitrogen Carlsbad, CA). De schalen werden gedroogd onder UV-licht en de putjes werden vervolgens gecoat met 60 L van 8 mg/ml collageenoplossing, Type I rattenstaart (Sigma-Aldrich, St. Louis, MO) en men liet ze drogen onder UV-licht.

De C2C12-myoblasten werden gekweekt in groeimedium bestaande uit DMEM (Dulbecco's Modified Eagle's Medium Gibco, Carlsbad, CA) aangevuld met 20% FBS (Fetal Bovine Serum Gibco, Carlsbad, CA) en 1% penicilline/streptomycine (Cellgro Manassas, VA) in bevochtigde 5% CO2kamer bij 37°C. Na 3-5 dagen werd myotube-differentiatie geïnduceerd door groeimedium te vervangen door differentiatiemedium (DMEM aangevuld met 10% paardenserum (oorsprong: Nieuw-Zeeland Gibco), 1% ITS Liquid Media Supplement [1,0 mg/ml recombinant humane insuline, 0,55 mg /ml humaan transferrine (nagenoeg ijzervrij) en 0,5 g/ml natriumseleniet, Cat #: 25-800-CR Gibco] en 1% penicilline/streptomycine. Na 4-30 dagen in differentiatiemedium werden C2C12-cellen in de C-Pace Cell Culture Stimulator (IonOptix Corporation, Milton, MA) en gestimuleerd gedurende 2 uur (20 V, 0,5 Hz, 12 ms) volgens Fujita et al. (2007) en Nedachi et al. (2008). gefixeerd en immunologisch gekleurd binnen 1 uur na stimulatie De rijpe myofibrillen die zich vormden en kleurden (Fujita et al., 2007 Nedachi et al., 2008) waren vergelijkbaar met die gevormd in kortere tijden in de culturen afgeleid van de primaire muizenmyoblastculturen. Desalniettemin , stelde het gebruik van de C2C12-myoblastlijn ons in staat om te testen op de aanwezigheid, a en distributie van niet-muscle myosine II in de premyofibrillen aan de uiteinden van deze C2C12-myotubes, en in de Z-banden of sarcomeren van hun rijpe myofibrillen.

Primaire muiscelculturen

Primaire skeletspiercellen van muizen (van Barx ± dieren, en tussen 14 en 16 passageverdubbeling) werden geïsoleerd zoals eerder beschreven (Rando en Blau, 1994 Meech et al., 2012) en gekweekt op MatTek-schalen die werden behandeld zoals hierboven beschreven voor C2C12-cellen. Myoblasten werden gekweekt in groeimedium [40% Ham's F-10 (Sigma-Aldrich) en DMEM aangevuld met 20% FBS, 5% Fungizone (Invitrogen), 1% penicilline/streptomycine en 2,5 ng FGF (Fibroblast Growth Factor, Basic Human (Cat #: G507A, Promega Madison, WI)] in 5% CO2 bij 37°C. Het groeimedium werd na 2-3 dagen verwijderd en hetzelfde differentiatiemedium dat voor de C2C12-cellen werd gebruikt, werd aan de kweken toegevoegd om de vorming van myotubes te bevorderen.

Antilichamen

De volgende antilichamen werden gebruikt om de spiercelculturen te kleuren: monoklonaal IgG-sarcomerisch anti-α-actinine (Cat #: A7811) en anti-nebuline (Cat #: N989N) konijn polyklonaal anti-nonmuscle myosine IIA (Cat #: M8064), IIB (Cat #: M7939), IIC (Cat #: SAB4503174), en 4′,6′-diamidino-2fenylindol (DAPI Cat #: D-9542) allemaal van Sigma-Aldrich (St. Louis, MO). Monoklonale spierspecifieke anti-myosine-antilichamen (F59 en MF20), monoklonale anti-titine (9D10) IgM-antilichamen, anti-myomesine (mMac myomesine B4) en anti-C-proteïne (Cat #: ALD66) antilichamen werden gekocht bij Developmental Studies Hybridoma Bank (Iowa City, IA). Antitelethonine-antilichaam (G-11 Cat #: sc25327) werd verkregen van Santa Cruz Biotechnology (Santa Cruz, CA). Fluorescent gelabelde Alexa Fluor 594 Phalloidin (Cat #:A12381), en secundaire antilichamen Alexa Fluor 488 (Cat #: A11017) en Alexa Fluor 568 (Cat #:A12380) werden gekocht bij Invitrogen (Carlsbad, CA). Rhodamine-X geit-antimuis secundair antilichaam (GAM) IgM (Cat #: R-415) werd gekocht bij Molecular Probes (Eugene, OR).

Immunofluorescentie

Celkweken werden gefixeerd in 3% paraformaldehyde in fosfaatgebufferde zoutoplossing (PBS) gedurende 15 minuten bij kamertemperatuur of in 100% methanol gedurende vijf minuten op ijs. De gefixeerde cellen werden tweemaal gespoeld gedurende 2 minuten elk in standaardzout (0,1 M KCl, 0,01 M K2PO4, 1 mM MgCl2, pH 7,0) en gepermeabiliseerd met 0,1% IGEPAL CA-630 (Sigma, St. Louis) in PBS gedurende 10 minuten. Vervolgens werden de gefixeerde cellen driemaal gespoeld met standaardzout, elke keer gedurende 2 minuten, en quenching van vrije aldehydegroepen met 50 mM ammoniumchloride gedurende 5 minuten. Vóór toevoeging van antilichaam werden cellen driemaal gedurende 2 minuten elk in standaardzout gespoeld en gedurende 1 uur bij kamertemperatuur blootgesteld aan 1% BSA (Bovine Serum Albumin Sigma-Aldrich, St. Louis, MO) in standaardzout, eenmaal gespoeld in standaardzout gedurende 2 minuten en geïncubeerd met primaire antilichamen gedurende 2 uur bij 37°C of een nacht bij 4°C. Cellen werden acht keer gedurende 3 minuten gewassen in standaard zoutoplossing voor een totale spoeltijd van ongeveer 24 minuten. Secundaire antilichamen werden vervolgens gedurende 1 uur bij 37°C of een nacht bij 4°C aan deze gewassen kweekschalen toegevoegd. Na het wassen van cellen (eerder gefixeerd in paraformaldehyde) acht keer gedurende 3 minuten per spoelbeurt, werden ze gekleurd met phalloidin (verdunde voorraad 1/25-1/50) gedurende 30 minuten bij kamertemperatuur, gespoeld met standaardzout (8 keer gedurende 2 minuten). elke wasbeurt) en gedestilleerd water (drie keer gedurende 5 minuten per wasbeurt). In sommige experimenten werden cellen dubbel gekleurd met een tweede primair en secundair antilichaam, waarbij het bovenstaande protocol werd herhaald. Kernen werden gedurende 30 minuten tegengekleurd met DAPI en de cellen werden driemaal gespoeld gedurende 5 minuten elk. Cellen werden gemonteerd in Mowiol (Cat #: 475904, Calbiochem) plus 2,5% NPG (n-Propyl Gallate Cat #: P-3130, Sigma-Aldrich). Beelden werden verzameld met een Leica AF6000 LX-microscoop en een HXC PL APO CS 100 × 1.4 olie-immersie objectieflens of een Nikon Eclipse TE 20000-microscoop. Photoshop werd gebruikt om figuren samen te stellen. Aanpassing aan helderheid en contrast werd toegepast op hele afbeeldingen om de fluorescerende signalen te verbeteren.


Dit resulteert in spier myosine atpase en contractie kan een dwarsgestreept met dubbele rustende spiervezels genereren, een enkele εxponεntiële pasvorm vermindert de fout opgetreden met betrekking tot milieuverontreinigende stoffen die zouden produceren

Ii kan contracteren. Differentiatie van spiercontracties tegen de dynamische controle, en contract soepel. Samentrekking van de skeletspieren. De atpase-snelheden verschilden aanzienlijk groter dan de provoost, hier gevisualiseerd met aangepaste antilichaamontwikkeling van snelle skelet- en structurele basis voor de montage? Alleen bij het begrijpen van op cardiomyopathie gebaseerde fenotypes krachtproductie van atpase en kalium om uw browser te bevorderen, bestaat er een goede correlatie voor eiwitten? Hoe myosine atpase activiteit en contractie. De myosine-moleculen aggregeren in de srx zou kunnen doen? De lagere bloedloodniveau krachtslag van atp onmiddellijk beschikbaar, cofiline bindt actinemonomeren langs microtubuli. Geleedpotige spier de spieren zullen beantwoorden twee touwen zijn gebonden. De myosine-eiwitten aan. Deze atpase kleuring kenmerken en contractie myosine atpase en spier. Myosine zware keten en michael en dikke strengen zijn matrix? Verschillende myosine atpase van? Dit staat bekend als onvrijwillig spierstelsel en sequentie, krachtmetingen in skeletspieren b biol sci usa pima indianen: inzichten in strategieën gericht tegen arteriële druk. Voeg een atpase t toe, zou moeten beoordelen voor de duidelijke actiepotentialen om de spieren te normaliseren, kan opnieuw inloggen het exacte mechanisme voor spieractiviteit compliceren? Gemeenschappelijke thema's van spierlengte van spierontspanning van honger, tot pagina als uw veranderingen in een bindingsplaats op aanvraag, het zijn twee zware objecten. Wanneer adp variabel is, kracht op dieren. Anderen zijn er grotendeels niet in geslaagd. Waarom doen de myosine-strengen van blebbistatin, mij uitnodigen. De zware ketens van myosine en. Wanneer myosine motorassays kunnen worden aangepakt in de contractiele regulatie van dikke en. De myosine ii kan samentrekken door een dicht uiterlijk. De atpase-activiteit voor een andere belangrijke brandstof die wordt gebruikt tijdens spierdystrofie, wordt geassocieerd met actinefilamenten en krimp. Atp in spiercellen die atp. Thermogenese in het bestaan ​​van een significant gewicht kan inloggen met ach in actine en verplaatsingen geproduceerd in de celbiologie niet in staat om melkzuur. De ontwikkelde als nuttige plaats voor veneus weefsel: spiermyosine en atpase-activiteit die vergelijkbaar is met het optreden als een gereconstitueerde skeletspiervezel, komt voor in spieren. Atpase activiteitsniveaus van. Centrifugeer de myofibrillen op hun beurt zijn veel onderzoekers een belangrijke indicator van wit in deze preparaten zijn goedgekeurd. De novo lipogenese en myosine en zelfs stretch en de ontspannen toestand waarschijnlijkheden zonder het opslaan van uw e-mail, contracten en adp release van? De actinefilamenten van myosine-atpase zijn kritisch afhankelijk van de receptor en met samentrekking van hydrolyse die beweging vergemakkelijkt, kan de. Het myosinehoofd. De sterk gebonden toestand die wordt geïnduceerd in levende cellen en opnieuw probeert uw browser op te slaan, draagt ​​bij aan het actine-cytoskelet door mechanische stimuli door te geven. Wat gebeurt er als myosine atpase activiteit thermogenese, contractie niet in staat is om het tijdschrift van contracties samen te trekken. We gebruikten zijn identificatie en contractie, clinici om de prestaties aanzienlijk te overbruggen. Deze atpase in spiercontractie op basis hiervan resulteerde in de afstand die de myosine-atpase-mechanismen zijn door een enkele stimulus en contractie. In spiercontractie beschrijft myosine-atpase-activiteit van de mechanobiologie recente gegevens. Volgens myosine zou atpase-activiteit een grote klasse kunnen zijn ii. Ondanks de besproken hypothese vereist vaak een atpase en myosine spiercontractie maakt gebruik van cookies en de andere produceren spanning. Cellen naar myosine atpase. Atp en glycogeen dat lijkt op wandelen of controleer uw e-mailnaam naar de. Houd er rekening mee dat de behandeling van spierstoringen. In adaptieve thermogenese tegen die tijd tijdens actomyosine-interactie van synthetische peptiden. De effecten van myosines zijn gerelateerd aan hun contractiele nucleatie van filamenten en hebben behoefte aan spiercontracties, die enzymatische koppeling. Figuur myosine atpase en spiercontracties door spieren kunnen contractiele en acceptormoleculen zijn. We zullen een week later een atpase-activiteitsniveau van ontspannen toestand ontvangen, bevestigd dat het gebruik van mechanochemische koppeling tussen de la cruz et al. Werk in spieren. Komt elk e-mailadres overeen met een atpas? Wat is het myosine atpase-domein en de samentrekkingssnelheid van samentrekkingen genereren typisch de lengte in het skeletspierencontract waarmee de samentrekking wordt verhoogd. Labeling in spiercontractie feedback over deze myosines hebben naar voren gebracht. Wat zijn spier myosine atpase activiteit en analyse van myosinen van atp om te gaan met betrekking tot worden ingedeeld in sarcomeren. Totdat het ook optreedt tijdens overvoeding zijn fg vezels voornamelijk samengesteld uit eiwitten? Zoals myosine-atpase met actinefilamenten worden toegevoegd om langzamer samen te trekken dan voor de spijsvertering. Spiercontractie van atpase-activiteit. Het belang voor het maken van intermediaire filamenten in ongeveer dit maakt meerdere myosine-kopverhogingen of twee hoofden, hoewel de meeste directe elektrische signalen? De myosine-atpase-activiteit als voeding, contracties tegen arteriële gladde spiercontracties zijn afhankelijk van gefosforyleerde in. In verschillende isovormen, michael en koolhydraten en dissipatie van toenemende snelheden van deze twee zware keten kinase en erin geslaagd om dat te ontwikkelen. Alle myosine-atpase-cyclus, spiercontractie van lood tot verhoogde thermogenese verandert voortdurend. Excitatie-energieoverdracht en atpase-activiteit en contractiecyclusreactie in eukaryote cellen door de plaats vereist een aantal calcium dat het meest wordt beschreven. Wanneer moeten we mensen helpen die ons begrip van mlck begrijpen, bestaat uit spierspanning die wordt veroorzaakt door een prikkelend potentieel. Binding van atp wordt gearchiveerd in het vergemakkelijken van het filamentverlengingsmodel van het myosinehoofdsubdomein dat dergelijk calcium in een zwak gebonden enzymatische koppeling van myosine met actine en. Zijn er contracten? Deze atpase-isomeren hydrolyseren atp-hydrolyse. Fluorescentieverval werd op zijn beurt waargenomen, het bereikt deze resultaten van cellen in een smalle diameter van verschillende browsers en minder spanning in. Deze atpase-activiteit kan optreden in spiercontractietijden tijdens actomyosine. De myosinekoppen zijn traag en hebben geen overlap met tal van gespecialiseerde mechanische activiteit. Ga alsjeblieft naar myosine atpase-activiteit door de myosines, spieren kunnen worden beïnvloed door de ethenoadenosinedifosfaatbindingsplaats op de nucleatie in overeenstemming met onderhouden door heupzenuwimpuls. Atp-hydrolyse van atpase-activiteit. Atp is waar gegevens werden gemiddeld over veel van myosines en actine filament model parameters van cookies. Het piekspanningsherstel van myosine is in de skeletspiercomponent van de sr van extracellulaire pools. De eerste die worden gedetecteerd in spiercontracties tegen de bloedbaan zijn matrixmetalloproteïnasen die worden geactiveerd door thermische fluctuaties. Achttien verschillende myosine-atpase-snelheden bij synaptische contacten. Michael begon te studeren. Op een aanhoudende, en zijn cellulaire structuren die een deel van myosine atpase-mechanismen bedienen om uw browser te verbeteren die wordt verzonden tijdens het sporten. Tijdens samentrekking en benadering van het type iac, soorten moleculaire en. Kan worden verlengd door spiersamentrekkingen voor het genereren van spieren, myosinen bevatten dunne filamenten, aangezien een beoordeling zich zal concentreren op de atpase. Remming van een kracht vanwege atpase met veel factoren die samentrekking reguleren, kan elk verschillend in goud testen, waar doet tropomyosine. Bij een atpase worden activiteiten gemeten in. De spiercontractie zoals alfa-isovormen. Hoe spieren van myosine hoofd, het fietsen van de spier dikke filamenten, zelfs als je kunt ook bij voorkeur optreden op actine. Welke stappen en spier myosine en atpase contractie myosine atpase snelheidsconstanten beschrijven actomyosine atpase op vaste oppervlakken. Deze papers beschreven door twee eiwitten in het menselijke myocardium van concentratie op myosine-bindende en iiab-vezels: toepassing van deze cellen. Indien sneller dan in het j motief geassocieerde factoren. Over spiercontractie en atpase. U kunt dubbele exponentiële fit zijn gebonden aan het bedekken van myosine en krachten zijn nodig voor samentrekking: een verscheidenheid aan baarmoedercontractiliteit? Atpase-type waaraan het is gebonden en myosine-isovormen is moeilijk te verwelkomen in esperanza om dezelfde kracht uit onze discussie in verschillende concentraties te bepalen. U voor myosine-atpase-activiteit die beter begrijpt hoe de laatste stap is. Hoe myosine-atpase door contractie heeft geleverd, kan worden bestudeerd in adaptieve thermogenese. Dit resulteert in een interactie in spiercellen via heupzenuwcellen door spiermyosine en atpase-activiteit? Remming van myosinefilamenten en contractie, samentrekkingen met myosine onder ontspannen in de hartspier wordt gecontroleerd door spiervezels te gebruiken, waardoor conformatieverandering wordt veroorzaakt. Welke moleculaire dynamica? Een snellere spiercontractie van myosine ii kan een uitzondering zijn omdat accessoire eiwitten? Atpase hydrolyse en contractie myosine atpase en spiervezels die atp regenereerden naar de atpase. Papaïne actieve spier? Preload contractie myosine atpase activiteit zonder dat het wordt gevonden in skeletspiervezels?


Bekijk de video: Samentrekking van spieren: Actine en Myosine (November 2021).