Informatie

Ribosomaal DNA verwijst naar sequenties


Ik heb wat moeite met het zoeken naar dit stukje informatie. Ik doe een onderzoek naar de fylogenetische gevoeligheid van gastheren voor ziekteverwekkers (gebaseerd op een recente publicatie van Nature), in het bijzonder voor griep. Dit vereist het kennen van de verwijzing 18S ribosomale DNA-sequentie voor onder meer kippen, wilde eenden, paarden, varkens en mensen. Is er een bron waarmee we deze gemakkelijk kunnen downloaden?


Voor vogels kun je beginnen met zoeken 18 jaar op http://birdgenenames.org/cgnc/

Maar over het algemeen zou de NCBI Nucleotide-database u alle informatie en toegangsnummers moeten geven. Zie deze brede zoekopdracht: http://www.ncbi.nlm.nih.gov/nuccore/?term=18S+ribosomal+RNA+gene

Door soortspecificatie en andere parameters toe te voegen, vindt u misschien wat u zoekt. Zie bijvoorbeeld kip 18S ribosomaal RNA-gen


Ik ben hier misschien aan het springen, maar ervan uitgaande dat je NCBI of ensemble niet hebt doorzocht, zou ik dat eerst doen.

In wezen wordt alle genomische informatie onderhouden door een samenwerking tussen de Amerikaanse NIH, de EU EBI en Japan. Alle databases zijn met elkaar gesynchroniseerd en daarom zouden de gegevens (theoretisch) hetzelfde moeten zijn (in de praktijk is dat nooit zo). Ik stel voor dat je één server kiest en je eraan houdt.

In mijn lab gebruiken we het liefst NCBI, maar dat verschilt van lab tot lab.

U kunt NCBI zoeken door de tutorial hier te volgen (http://www.ncbi.nlm.nih.gov/guide/howto/find-published-info-gene-sequence/) of ensembl bu door de tutorial hier te volgen (http:/ /www.ebi.ac.uk/training/online/course/ensembl-browsing-chordate-genomes/how-search-ensembl)

Een voorbeeldzoekopdracht voor kip levert dit op (http://www.ncbi.nlm.nih.gov/gene/100861561) met drie vermeldingen voor genomisch dna en één voor mRNA. Ik zou een volledige reeks verkiezen boven een gedeeltelijke reeks.

Misschien wil je in hun help ook de betekenis van cd's opzoeken (codeervolgorde; je zult het tegenkomen)


Taxonomische betrouwbaarheid van DNA-sequenties in openbare sequentiedatabases: een schimmelperspectief

DNA-sequenties worden in veel groepen organismen steeds meer gezien als een van de belangrijkste informatiebronnen voor de identificatie van soorten. Dergelijke benaderingen, in de volksmond bekend als barcodering, worden ondersteund door de veronderstelling dat de referentiedatabases die voor vergelijking worden gebruikt voldoende volledig zijn en correct en informatief geannoteerde gegevens bevatten.

Methodologie/Belangrijkste bevindingen

De huidige studie maakt gebruik van een groot aantal DNA-sequenties van schimmels uit de inclusieve International Nucleotide Sequence Database om aan te tonen dat de taxonbemonstering van schimmels verre van compleet is, dat ongeveer 20% van de inzendingen onjuist kan worden geïdentificeerd tot op soortniveau, en dat de meerderheid van de inzendingen ontbreken beschrijvende en actuele annotaties.

Conclusies

De problemen met taxonomische betrouwbaarheid en onvoldoende annotaties in openbare DNA-opslagplaatsen vormen een tastbaar obstakel voor de identificatie van soorten op basis van sequenties, en het is duidelijk dat de grootste uitdagingen voor biologische barcodes eerder van taxonomische dan van technische aard zullen zijn.

Citaat: Nilsson RH, Ryberg M, Kristiansson E, Abarenkov K, Larsson KH, Kõljalg U (2006) Taxonomische betrouwbaarheid van DNA-sequenties in openbare sequentiedatabases: een schimmelperspectief. PLoS EEN 1(1): e59. https://doi.org/10.1371/journal.pone.0000059

Academisch redacteur: Cecile Fairhead, Pasteur Instituut, Frankrijk

Ontvangen: 16 oktober 2006 Geaccepteerd: 26 oktober 2006 Gepubliceerd: 20 december 2006

Auteursrechten: © 2006 Nilsson et al. Dit is een open-access artikel dat wordt gedistribueerd onder de voorwaarden van de Creative Commons Attribution License, die onbeperkt gebruik, distributie en reproductie in elk medium toestaat, op voorwaarde dat de oorspronkelijke auteur en bron worden vermeld.

Financiering: Dit werk werd ondersteund door de stichtingen van Helge Axe:son Johnson, Wilhelm en Martina Lundgren en Lars Hierta.

Concurrerende belangen: De auteurs hebben verklaard dat er geen concurrerende belangen bestaan.


Abstract

Omgevingssequencing heeft onze kennis van micro-eukaryote diversiteit en ecologie enorm uitgebreid door voorheen onbekende geslachten en hun verspreiding te onthullen. De waarde van deze gegevens is echter kritisch afhankelijk van de kwaliteit van de referentiedatabases die worden gebruikt om een ​​identiteit toe te kennen aan omgevingssequenties. Bestaande databases bevatten fouten en hebben moeite om gelijke tred te houden met de snel veranderende eukaryote taxonomie, de instroom van nieuwe diversiteit en rekenkundige uitdagingen met betrekking tot het samenstellen van de hoogwaardige uitlijningen en bomen die nodig zijn voor nauwkeurige karakterisering van afstammingsdiversiteit. EukRef (eukref.org) is een doorlopend, door de gemeenschap aangestuurd initiatief dat deze uitdagingen aanpakt door taxonomen samen te brengen met expertise op het gebied van de eukaryote levensboom en microbiële ecologen, die omgevingssequentiegegevens gebruiken om betrouwbare referentiedatabases te ontwikkelen over de diversiteit van microbiële eukaryoten. EukRef organiseert en faciliteert rigoureuze mijnbouw en annotatie van sequentiegegevens door protocollen, richtlijnen en hulpmiddelen te bieden. De EukRef-pijplijn en -hulpmiddelen stellen gebruikers die geïnteresseerd zijn in een bepaalde groep microbiële eukaryoten in staat om alle sequenties die tot die groep behoren op te halen uit International Nucleotide Sequence Database Collaboration (INSDC) (GenBank, het European Nucleotide Archive [ENA], of de DNA DataBank of Japan [ DDBJ]), om die sequenties in een fylogenetische boom te plaatsen en om taxonomische en milieu-informatie voor de groep samen te stellen. We bieden richtlijnen om het proces te vergemakkelijken en om taxonomische annotaties te standaardiseren. De uiteindelijke resultaten van dit proces zijn (1) een referentieboom en uitlijning, (2) een database met referentiesequenties, inclusief taxonomische en omgevingsinformatie, en (3) een lijst van vermeende chimeren en andere kunstmatige sequenties. Deze producten zullen nuttig zijn voor de brede gemeenschap als ze openbaar beschikbaar komen (op eukref.org) en worden gedeeld met bestaande referentiedatabases.

Citaat: del Campo J, Kolisko M, Boscaro V, Santoferrara LF, Nenarokov S, Massana R, et al. (2018) EukRef: Fylogenetische curatie van ribosomaal RNA om het begrip van eukaryote diversiteit en distributie te verbeteren. PLoS Biol 16 (9): e2005849. https://doi.org/10.1371/journal.pbio.2005849

Gepubliceerd: 17 september 2018

Auteursrechten: © 2018 del Campo et al. Dit is een open access-artikel dat wordt gedistribueerd onder de voorwaarden van de Creative Commons Attribution-licentie, die onbeperkt gebruik, distributie en reproductie in elk medium toestaat, op voorwaarde dat de oorspronkelijke auteur en bron worden vermeld.

Financiering: Gordon en Betty Moore Stichting moore.org. Ontvangen door JdC en LWP. National Science Foundation www.nsf.gov (subsidienummer 1545931). Ontvangen door MB, JdC en LWP. International Society of Protistologists protistologists.org. Ontvangen door JdC en LWP. Stichting Tula tula.org. Ontvangen door JdC, VB, MK en PJK. Marie Skłodowska-Curie Actions Europese Commissie https://ec.europa.eu/research/mariecurieactions/ (subsidienummer FP7-PEOPLE-2012-IOF -331450 CAARL). Ontvangen door JdC. Tsjechische Academie van Wetenschappen, Tsjechische Fellowship Purkyne. Ontvangen door MK. Europees Fonds voor Regionale Ontwikkeling http://ec.europa.eu/regional_policy/en/funding/erdf/ (subsidienummer CZ.02.1.01/0.0/0.0/16_019/0000759CePaViP). Ontvangen door MK. National Science Foundation www.nsf.gov (subsidienummer OCE1435515). Ontvangen door LS. Investissements d'Avenir (subsidienummer ANR-11-BTBR-0008OCEANOMICS). Ontvangen door CB en CdV. NSERC-DG http://www.nserc-crsng.gc.ca/. Ontvangen door LWP. De financiers hadden geen rol bij het ontwerp van de studie, het verzamelen en analyseren van gegevens, de beslissing om het manuscript te publiceren of de voorbereiding van het manuscript.

Concurrerende belangen: De auteurs hebben verklaard dat er geen concurrerende belangen bestaan.

Afkortingen: DDBJ, DNA DataBank of Japan EBI, European Bioinformatics Institute ENA, European Nucleotide Archive EnvO, Environment Ontology HTES, high-throughput environment sequencing INSDC, International Nucleotide Sequence Database Collaboration MAST, marine stramenopiles MIxS, Minimum Information about any (x) Sequence NCBI, National Center for Biotechnology Information OTU, operationele taxonomische eenheid PR 2 , Protist Ribosomal Reference Database SAR, Stramenopiles, Alveolates en Rhizaria SSU rRNA, small subunit ribosomaal RNA-gen 18S rRNA, eukaryotic small subunit ribosomaal RNA-gen


Een overzicht van het gebruik van ribosomaal DNA (rDNA) om onderscheid te maken tussen cryptische Anopheles soort

Cryptische soortencomplexen zijn groepen nauw verwante soorten die moeilijk of onmogelijk te onderscheiden zijn door morfologische kenmerken. Deze complexen zijn bekend van een grote verscheidenheid aan geleedpotigen en komen veel voor bij de goed bestudeerde, medisch belangrijke insecten. Veel van de anofelinevectoren van malariaparasieten zijn bijvoorbeeld leden van cryptische soortencomplexen. Complexen omvatten typisch zowel vector- als niet-vectorsoorten, en twee of meer lidsoorten worden vaak sympatrisch gevonden. Tot het einde van de jaren vijftig waren er slechts twee van dergelijke Anopheles complexen bekend waren, A. gambiae complex uit Afrika en de A. maculipennis complex uit Europa. Vandaag tientallen Anopheles cryptische soortencomplexen worden herkend, en toenemend bewijs suggereert dat de meeste belangrijke malariavectoren waarschijnlijk lid zijn van dergelijke complexen.

Er is een verscheidenheid aan methoden ontwikkeld voor het identificeren van de soorten individuele exemplaren van deze complexen, hoewel tot voor kort alleen die op basis van soortspecifieke allozymen en polytene-chromosoominversies op grote schaal werden gebruikt. De beperkingen die inherent zijn aan deze methoden zijn omzeild met op DNA gebaseerde procedures, die vooral nuttig zijn omdat beide geslachten en alle ontwikkelingsstadia kunnen worden geïdentificeerd, en DNA kan worden teruggewonnen uit monsters die zijn opgeslagen met een breed scala aan eenvoudige methoden. Er zijn verschillende op DNA gebaseerde identificatietechnieken ontwikkeld, waaronder hybridisatie-assays op basis van soortspecifieke herhalingssequenties en diagnostische PCR-fragmenten die zijn geproduceerd door het gebruik van willekeurige PCR-primers of door DNA te amplificeren met primers op basis van bekende soortspecifieke sequenties. In deze review bespreken we de relatieve verdiensten van verschillende methoden voor cryptische soortidentificatie, met de nadruk op het gebruik van ribosomaal DNA als doelwit voor soortdiagnostische PCR-assays.


Specifieke ribosomale DNA-sequenties uit verschillende omgevingen correleren met experimentele verontreinigingen

Fylogenetische analyse van 16S-ribosomaal DNA (rDNA)-klonen verkregen door PCR van niet-gecultiveerde bacteriën die in een breed scala van omgevingen leven, heeft onze kennis van bacteriële diversiteit vergroot. Een mogelijk probleem bij de beoordeling van bacteriële diversiteit op basis van sequentie-informatie is dat PCR buitengewoon gevoelig is voor verontreinigend 16S-rDNA. Dit verhoogt de mogelijkheid dat sommige vermeende omgevings-rRNA-sequenties in feite overeenkomen met sequenties van verontreinigende stoffen. Om mogelijke contaminanten te documenteren, hebben we PCR-geamplificeerde 16S rDNA-fragmenten gekloond en gesequenced, verkregen bij lage niveaus in afwezigheid van toegevoegd matrijs-DNA. 16S rDNA-sequenties die nauw verwant zijn aan de genera Duganella (voorheen Zoogloea), Acinetobacter, Stenotrophomonas, Escherichia, Leptothrix, en Herbaspirillum werden geïdentificeerd in contaminantenbibliotheken en in kloonbibliotheken uit diverse habitats met een lage biomassa. De gedetecteerde rRNA-sequenties zijn mogelijk veelvoorkomende verontreinigingen in reagentia die worden gebruikt om genomisch DNA te bereiden. Dientengevolge is het mogelijk dat hun detectie in verwerkte milieumonsters geen milieurelevante organismen weerspiegelt.

De kennis over microbiële diversiteit is de afgelopen jaren enorm toegenomen, deels als gevolg van sequencing van rRNA-genen uit DNA dat rechtstreeks is verkregen uit niet-gecultiveerde microbiota, vaak door gebruik van PCR en rRNA-specifieke primers (2, 21). Deze benadering is toegepast om de microbiële diversiteit in verschillende omgevingen te beoordelen, bijvoorbeeld arctische toendra (34), diepe mariene ondergronden (27), warmwaterbronnen van Yellowstone (14), veenmoerassen (26) en menselijke infecties (9 , 12, 17). Hoewel de aanpak een gevarieerde verzameling sequenties heeft opgeleverd en onze kijk op microbiële diversiteit heeft uitgebreid, heeft de analyse van microbiële 16S-ribosomale DNA- (rDNA) -sequenties beperkingen bij het relateren van specifieke rDNA-sequenties aan organismen in de onderzochte omgeving en zit vol met potentiële artefacten.

Een mogelijk artefact bij de toepassing van PCR op gemeenschapsanalyse is de mogelijke introductie van verontreinigend rDNA tijdens experimentele procedures, met name in stappen voorafgaand aan PCR. Tijdens het samenstellen van 16S rDNA-sequenties uit de omgeving, hebben we enkele zeer vergelijkbare (㺙%) sequenties opgemerkt die zijn verkregen uit veel fysiek en chemisch verschillende omgevingen. De organismen die door deze sequenties worden vertegenwoordigd, kunnen inderdaad veel voorkomen in zulke uiteenlopende omgevingen. De moeilijkheid bij het bereiden van genomisch DNA dat absoluut vrij is van verontreinigend DNA, in combinatie met de uitstekende gevoeligheid van PCR om sporendoel-DNA te amplificeren, maken besmetting echter een serieus probleem, vooral bij monsters met een lage biomassa (16, 18, 28, 29). We rapporteren hier een overzicht van 16S rDNA-sequenties die werden verkregen uit negatieve extractiecontroles, dat wil zeggen DNA-extractie en -zuivering uitgevoerd zonder toegevoegd monster, en de overeenkomst van deze sequenties met sommige hersteld uit verschillende omgevingen.

We onderzochten de 16S rDNA-sequenties van 96 klonen die waren afgeleid van een PCR-product dat het resultaat was van een controle-extractie die geen omgevingsmonster bevatte. Er zijn minder uitgebreide analyses uitgevoerd met onafhankelijk verwerkte negatieve controles. De extractie werd op dezelfde manier uitgevoerd als met authentieke monsters die genomisch DNA bevatten, door gebruik te maken van lysozyme, proteïnase K, natriumdodecylsulfaat, parelkloppen en fenolbehandeling zoals elders beschreven (4). Details waren als volgt: buffer A bestond uit 200 mM Tris HCl (pH 8,0), 200 mM NaCl en 20 mM EDTA, kralen slaan (0,5 g met zuur gewassen kralen) werd uitgevoerd gedurende 2 min bij lage snelheid en 0,5 min. met hoge snelheid, en nucleïnezuren werden geprecipiteerd uit 300 mM NaCl en 3 volumes 100'00025 ethanol. Alle oplossingen werden bereid met geautoclaveerd, gefilterd (0,2-μm poriegrootte filter, steriele Acrodisc Gelman Sciences) ddH2O voor gebruik. Hoewel sommige kleine bacteriën mogelijk door de filterporiën van 0,2-μm zouden kunnen gaan, resulteerde een negatieve controle in de afwezigheid van een sjabloon, dat wil zeggen zonder het negatieve extractiecontrolemateriaal, in geen PCR-product na 40 cycli. Alle DNA-extractieprocedures en -manipulaties werden uitgevoerd in een kap met laminaire stroming om besmetting vanuit de lucht te minimaliseren. Het monster werd opgelost in 200 µl water en 100 pcr’s werden uitgevoerd met 1 µm template (40 cycli van touchdown-PCR, bestaande uit 20 cycli van 1 min bij 94 °C, 40 sec. beginnend bij 67ଌ en afnemend met 1ଌ/cyclus, en 1 min bij 72ଌ, en 20 cycli van 1 min bij 94ଌ, 1 min bij 50ଌ, en 1,5 min plus 1 s/cyclus bij 72& #x000b0C). Vijf eenheden Ampli Taq Per 100 µl reactiemengsel werd goud (Perkin-Elmer) toegevoegd. Voor de amplificatie werden bacteriespecifieke primers gebruikt (27F, AGAGTTTGATCCTGGCTCAG en 805R, GACTACCAGGGTATCTAATCC). Deze primers komen overeen met de meeste sequenties in het domein bacteriën in het primer-doelgebied. Drie 100-μl reactieproducten werden geprecipiteerd met ethanol, en het gehele monster werd gescheiden door agarosegelelektroforese. Zelfs met deze voorzorgsmaatregelen werden PCR-producten van rDNA-formaat verkregen na uitgebreide rondes van thermische cycli. De PCR-producten van rDNA-formaat werden uit de gel geëlueerd en gekloond, en 96 klonen werden geanalyseerd door restrictiefragmentlengtepolymorfismen (RFLP) met behulp van de enzymen Mspik en hihiP1I zoals gedetailleerd door Hugenholtz et al. (14). Twintig verschillende RFLP-types werden geïdentificeerd en gesequenced. De 16S rDNA-sequenties (460 tot 780 nucleotiden [nt]) werden vergeleken met bekende sequenties met behulp van het gapped BLAST-zoekalgoritme (1, 5) en werden uitgelijnd met naaste verwanten met behulp van de GDE-uitlijningseditor (19). 16S rDNA-sequenties werden geplaatst in een fylogenetische boom die meer dan 7.000 bacteriële rDNA-sequenties bevatte met behulp van het ARB-softwarepakket (30).

Analyse van klonen van de negatieve extractiecontrole onthulde een diverse verzameling verontreinigende sequenties. We hebben vergelijkbare sequenties gezien in andere analyses van verontreinigende rDNA's. 16S-rDNA-sequenties die in wezen identiek zijn aan de sequenties van de negatieve controle, zijn ook aangetroffen door een aantal laboratoria in kloonbibliotheken uit een grote diversiteit aan omgevingen, zoals samengevat in tabel Tabel 1. 1 . Bijkomende sequenties uit de negatieve controle, die niet in omgevingsanalyses zijn vermeld, zijn gerelateerd aan de rDNA's van de volgende organismen: Micrococcus luteus (98% identiteit naar MT2), Pseudomonas aeruginosa (99% identiteit naar MT5), an Afipia sp. (97% identiteit naar MT8), Variovorax paradoxus (97% identiteit naar MT11), Gemella haemolysans (100% identiteit naar MT1), Shigella boydii (99% identiteit naar MT19), en Phyllobacterium myrsinacearum (99% identiteit naar MT17). Een paar sequenties waren identiek aan die van bekende organismen. Een compilatie van sequenties verkregen uit bibliotheken met negatieve controle is beschikbaar op onze website op http://crab2.berkeley.edu/pacelab/177.htm. Deze site zal worden bijgewerkt als aanvullende sequenties worden bepaald uit bibliotheken met negatieve controles. Inzendingen zijn welkom.

TAFEL 1

Verspreiding van verontreinigende klonen met vertegenwoordigers van milieustudies

Kloon(s) van negatieve controleOmgeving en kloon 㺘% identiek aan kloon met negatieve controle (referentie)GenBanknr.Meest nauw verwante organisme% Identiteit a
MT3Bentoniet/zand ondergrond, Canada, kloon K13 (22) <"type":"entrez-nucleotide","attrs":<"text":"X91528","term_id":"987803","term_text":"X91528">> X91528Stenotrophomonas maltophilia96.7
Zure mijnafvoer, kloon TRA2-7 (11) <"type":"entrez-nucleotide","attrs":<"text":"AF047649","term_id":"2944372","term_text":"AF047649">> AF047649
MT6Bentoniet/zand ondergrond, Canada, kloon K9 (22) <"type":"entrez-nucleotide","attrs":<"text":"X91524","term_id":"987799","term_text":"X91524">> X91524Acinetobacter sp. DSM59099.7
Diep zeesediment, kloon JAP752 (27) <"type":"entrez-nucleotide","attrs":<"text":"U09828","term_id":"495561","term_text":"U09828">> U09828
Grondwater/ondergrond bij Äspö hard rock lab, Zweden, kloon A24otpmn (23) <"type":"entrez-nucleotide","attrs":<"text":"X91447","term_id":"1217616","term_text":"X91447">> X91447
Diep granietachtig grondwater, Stripa-onderzoeksmijn, Zweden, kloon Groep III (10) <"type":"entrez-nucleotide","attrs":<"text":"L20812","term_id":"999472","term_text":"L20812">> L20812
MT9Bentoniet/zand ondergrond, Canada, kloon K16 (22) <"type":"entrez-nucleotide","attrs":<"text":"X91531","term_id":"987806","term_text":"X91531">> X91531Escherichia coli98.0
Prostatitis, kloon 5725 (17)n.v.t
MT14, CMT35PGrondwater/ondergrond, Gabon, Afrika, kloon G4 (24) <"type":"entrez-nucleotide","attrs":<"text":"X91175","term_id":"984098","term_text":"X91175">> X91175Leptothrix cholodni96.5
Geïnfecteerde cavialong, kloon GPMT16 (31) <"type":"entrez-nucleotide","attrs":<"text":"AF058793","term_id":"3075486","term_text":"AF058793">> AF058793
Zure mijnafvoer, kloon TRB32 (11) <"type":"entrez-nucleotide","attrs":<"text":"AF047647","term_id":"2944370","term_text":"AF047647">> AF047647
MT18, CTHB-18Bentoniet/zand ondergrond, Canada, kloon K11 (22) <"type":"entrez-nucleotide","attrs":<"text":"X91526","term_id":"987801","term_text":"X91526">> X91526Duganella zoogloeoides (voorheen Zoogloea ramigera)99.8
Diep zeesediment, kloon JAP405 (27) <"type":"entrez-nucleotide","attrs":<"text":"U09778","term_id":"495530","term_text":"U09778">> U09778
Zure mijnafvoer, kloon AMDke9.1 (11)NA
Antarctica, kloon BP-S155 (11)NA
Basaltzand diepe ondergrond, kloon BS43 (11)NA
Yellowstone warmwaterbron, kloon OPS122B (14) <"type":"entrez-nucleotide","attrs":<"text":"AF026984","term_id":"2746093","term_text":"AF026984">> AF026984
Siberische toendragrond, kloon S-41 (34) <"type":"entrez-nucleotide","attrs":<"text":"AF016752","term_id":"2323510","term_text":"AF016752">> AF016752
Dentoalveolair abces (pusmonster), kloon PUS 10.40 (9) <"type":"entrez-nucleotide","attrs":<"text":"U34035","term_id":"1039429","term_text":"U34035">> U34035
Verontreinigde watervoerende laag, kloon WFeA1-06 (8) <"type":"entrez-nucleotide","attrs":<"text":"AF050528","term_id":"2967704","term_text":"AF050528">> AF050528
Grondwater/ondergrond, Gabon, Afrika, klonen G22 en G41 (24) <"type":"entrez-nucleotide","attrs":<"text":"X91274","term_id":"987022","term_text":"X91274">> X91274
Hawaiiaanse bodem, kloon HRS-17 (20) <"type":"entrez-nucleotide","attrs":<"text":"AF016530","term_id":"2702342","term_text":"AF016530">> AF016530
Humusreducerende omgeving, moleculair isolaat uit een PCR-product (6) <"type":"entrez-nucleotide","attrs":<"text":"AF019941","term_id":"2443651","term_text":"AF019941">> AF019941
Cavialong, kloon MTseq15 (31) <"type":"entrez-nucleotide","attrs":<"text":"AF058388","term_id":"3065808","term_text":"AF058388">> AF058388
Mycobacterium tuberculosis-geïnfecteerde cavia, long, kloon GPMT3 (31) <"type":"entrez-nucleotide","attrs":<"text":"AF058387","term_id":"3065807","term_text":"AF058387">> AF058387
MT22Laag-pH veenmoeras, klonen TM221 en TM252 (26) <"type":"entrez-nucleotide","attrs":<"text":"X97095","term_id":"1805658","term_text":"X97095">> X97095Herbaspirillum seropedicae98.6
Carolina baai sediment, klonen RB-06 en RB-37 (33) <"type":"entrez-nucleotide","attrs":<"text":"U62830","term_id":"1498401","term_text":"U62830">> U62830

Verschillende verontreinigende klonen en talrijke omgevingsklonen uit verschillende omgevingen zijn nauw verwant aan rDNA's van het geslacht Duganella (voorheen Zoogloea). Dergelijke organismen (β-proteobacteriën) vervuilen vaak waterbronnen en worden routinematig geïsoleerd uit afvalwateromgevingen (13) en drinkwaterbiofilms (15). Hun voorkomen in materialen die worden gebruikt voor laboratoriumexperimenten is daarom niet verrassend. Afbeelding ​ Afbeelding1 1 toont de relaties van enkele van de verontreinigende sequenties en omgevingsgroepen van sequenties met die van Duganella zoogloeoides en Herbaspirillum seropedicae. De Duganella verwantschapsgroep, gezien als twee clades met ca. 98.5% identiteit in rRNA-sequenties, bestaat voornamelijk uit omgevings-rDNA-sequenties, allemaal bijna identiek, uit verschillende gepubliceerde onderzoeken (6, 8, 9, 20, 22�, 27, 34). Naast de Duganella cluster van sequenties, een aantal andere veelvoorkomende sequenties van verontreinigende stoffen, opgesomd in tabel Tabel 1, 1 , komen nauw overeen met sequenties die zijn gerapporteerd uit verschillende omgevingen. Leptothrix spp., bijvoorbeeld, zoals Duganella spp., worden aangetroffen in langzaam stromend zoet water en in vervuild water en actief slib. Het is opmerkelijk dat in wezen identieke rRNA-sequenties worden verkregen uit verschillende omgevingen zoals diep ondergronds grondwater, een zeesediment, een hete bron van Yellowstone, een cavialong en een dentoalveolair abces (pus rond de tanden). Alle extracties van omgevingsmonsters die resulteerden in klonen die equivalent zijn aan de verontreinigende rDNA's bevatten waarschijnlijk slechts zeer lage niveaus van biomassa. Extractie van DNA uit monsters met een lage biomassa is bijzonder gevoelig voor mogelijk verontreinigend DNA tijdens de verwerking, omdat het verontreinigende DNA minimaal wordt verdund door het monster-DNA. De exacte bronnen van besmetting werden echter niet vastgesteld, de Taq polymerase en amplificatiebuffer zijn niet detecteerbaar verontreinigd, aangezien reacties zonder toegevoegde template of negatief extractiecontrolemateriaal geen geamplificeerde producten produceerden. Daarom zijn de meest waarschijnlijke bronnen van verontreiniging zouten en buffers, lysozym, proteïnase K en/of de zirkoniumoxide/silicakorrels.

Evolutionaire afstand dendrogram met de relatieve posities van omgevings 16S rDNA kloon en stamsequenties naar de geslachten Duganella en Herbaspirillum. Bar geeft de nucleotidesubstitutiesnelheid aan. De sequentielengte in nucleotiden volgt de kloon- of stamaanduiding. Referenties voor klonen worden gegeven in Tabel ​ Tabel1. 1 . Klonen zijn vetgedrukt, de gekweekte stammen marine isolate BAL15 (25), arctic isolate arc21 (3) en stam Mena 23/3-3c (32) worden in lightface getoond. Sequenties voor beschreven bacteriesoorten (cursief) werden verkregen van GenBank (5). De rDNA-sequentie van Rhodocyclus purpureus werd gebruikt als een outgroup. De resolutie van de hier getoonde boom wordt beperkt door de kwaliteit van de sequentiegegevens en de korte lengtes (minder dan 500 nt) van vele sequenties. Korte sequenties (𼔀 nt) werden in de boom ingevoegd met behulp van de spaarzaamheid-insertietool van het ARB-softwareprogramma (30). De verontreinigende kloon CTHB-18 werd geïdentificeerd in een afzonderlijke extractie met negatieve controle, onafhankelijk van die voor de MT-kloonbibliotheek.

In deze studie rapporteren we dat veel rRNA-sequenties met een kleine subeenheid die zijn verkregen uit kloonbibliotheken zonder monster, nauw verwant zijn aan sequenties die zijn teruggevonden in andere onderzoeken uit verschillende omgevingsmonsters. Deze overeenkomst van verontreinigende en omgevingssequenties kan erop wijzen dat sommige van de omgevingssequenties zijn afgeleid als experimentele verontreinigingen en niet relevant zijn voor de milieugemeenschappen. Aangezien elke bron van verontreinigende sequenties waarschijnlijk idiosyncratisch is, afhankelijk van de operator, de bron van de reagentia, water, enz., moeten onderzoekers die de biodiversiteit onderzoeken met behulp van kloneringstechnieken in de omgeving, zich bewust zijn van dit probleem en alles in het werk stellen om het minimaliseren, detecteren en analyseren mogelijke besmetting. Misschien wel de belangrijkste boodschap van de hier gepresenteerde resultaten is dat definitief bewijs voor het voorkomen van een organisme dat wordt aangegeven door een gekloonde rRNA-sequentie, expliciete identificatie van dat organisme in situ vereist. Momenteel wordt dit het gemakkelijkst bereikt door gebruik te maken van op 16S rRNA gebaseerde fluorescentiehybridisatietechnieken (2, 7).

Nucleotidesequentie toegangsnummers.


Plant materialen

Zevenendertig soorten van de Paphiopedilum geslacht dat alle zeven secties bestrijkt, werden in deze studie geanalyseerd. Informatie over de soorten en secties wordt gegeven in Tabel 1. Actief groeiende wortels werden gebruikt voor chromosoombereiding, terwijl bladeren werden gebruikt voor genomische DNA-extractie.

Chromosoom voorbereiding

Wortelpunten werden voorbehandeld met 0,004 M 8-hydroxychinoline gedurende 4-6 uur bij 10°C en gefixeerd in vers bereid fixeermiddel (3:1 ethanol:azijnzuur) gedurende 48 uur bij 10°C. De vaste wortelpunten werden vervolgens grondig gespoeld met leidingwater en gemacereerd in een enzymmengsel dat 2% cellulase (Onozuka R-10, Rpi) en 1% pectolyase (Aspergillus japonicus Y-23, MP) gedurende 30 minuten bij 37°C. Na 15 minuten opnieuw fixeren in fixatief, werden de meristeemcellen geplet in een druppel van 45% azijnzuur onder een dekglaasje (22 x 22 mm) op een microscoopglaasje. De objectglaasjes werden vervolgens in vloeibare stikstof gedompeld en aan de lucht gedroogd nadat de dekglaasjes voorzichtig met een mes waren verwijderd.

Probe labeling en fluorescentie in situ hybridisatie (FISH)

25S rDNA, een 2,3-kb ClaI-subklonen van het 25S-rDNA-coderende gebied van Arabidopsis thaliana [54] en 5S rDNA (pTa794) [55] werden als probes gebruikt. 25S-rDNA werd gelabeld met biotine-16-dUTP (Roche) en 5S-rDNA werd gelabeld met digoxigenine-11-dUTP (Roche), allemaal door middel van nick-translatiemethode met behulp van de kit van Roche. De hybridisatiebuffer bestond uit 50% gedeïoniseerd formamide, 2 x SSC, 50 mM natriumfosfaat (pH 7,0), 10% dextransulfaat en geschoren zalmsperma-DNA (Invitrogen) in 100 x overmaat gelabelde probes. De 25S- en 5S-rDNA-probes werden gemengd tot een eindconcentratie van ongeveer 2 ng/μl en vervolgens 10 minuten gedenatureerd bij 94°C voordat ze werden gebruikt. Dia's met metafase-spreads werden gedurende 2 minuten bij 70 ° C behandeld met 70% gedeïoniseerd formamide in 2 x SSC. Gedenatureerde probes in hybridisatiebuffer werden vervolgens op de objectglaasjes aangebracht, die gedurende 10 uur bij 37°C in een vochtige kamer werden geïncubeerd. Wassingen na hybridisatie en immunodetectie werden uitgevoerd in een geautomatiseerd in situ hybridisatie-instrument, de InsituPro VSi (Intavis Bionanalytical Instruments). De objectglaasjes werden gedurende 5 minuten gewassen in 2 x SSC bij kamertemperatuur en tweemaal gedurende 10 minuten in 2 x SSC bij 50 ° C. Fluorescentiesignaal werd gedetecteerd met behulp van anti-Digoxigenine-Rhodamine-conjugaat (Roche) en streptavidine-fluoresceïne-conjugaat (Invitrogen). De preparaten werden gemonteerd en tegengekleurd in Vectashield met 1,5 g/ml DAPI (4', 6-diamidino-2-fenylindol) (Vector Laboratories). Beelden werden gemaakt door een Zeiss AxioCam MRm zwart-wit CCD-camera op een Zeiss Imager. Z1-fluorescentiemicroscoop en vervolgens uniform verwerkt met behulp van Zeiss AxioVision-software. FISH-signalen waren vals gekleurd en DAPI-fluorescentie bleef in grijstint.

PCR-amplificatie, klonen en sequencing

Totaal genomisch DNA werd geëxtraheerd uit verse bladeren met behulp van de Qiagen DNeasy Plant Mini-kit. Het 5S-NTS-gebied werd geamplificeerd door PCR met behulp van de universele gedegenereerde primers: 5'-TGGGAAGTCCTYGTGTTGCA-3' en 5'-KTMGYGCTGGTATGATCGCA-3' [56]. Touchdown-amplificatie werd als volgt uitgevoerd: een eerste stap bij 94°C gedurende 5 minuten, gevolgd door 10 cycli van 94°C gedurende 1 minuut, uitgloeien gedurende 1 minuut (begin bij 60°C en verlaagd met 1°C per cyclus) en 72 °C gedurende 1 minuut, daarna 35 cycli van 94 °C gedurende 1 minuut, 50 °C gedurende 1 minuut en 72 °C gedurende 1 minuut, werd de laatste stap bij 72 °C verlengd tot 10 minuten. Na gelzuivering met behulp van QIAquick Gel Extraction Kit (Qiagen), werden PCR-producten geligeerd in pDrive Cloning-vector en getransformeerd in QIAGEN EZ competente cellen (Qiagen PCR Cloning-kit). Recombinante klonen werden gescreend door middel van kolonie-directe PCR-werkwijze en de sequentie van 7-8 klonen per soort werd bepaald met gebruikmaking van T7 (5'-TAATACGACTCACTATAGGG-3')-primer.

Gegevensanalyse

Sequenties werden uitgelijnd met behulp van de MAFFT (Multiple Alignment using Fast Fourier Transform) webserver bij het European Bioinformatics Institute [57]. Standaard parameters werden gebruikt: gap opening penalty = 1.53, gap extension penalty = 0.123, tree rebuilding number = 1, maxiterate = 0, en voer FFTS = localpair uit. De sequentie-uitlijning is beschikbaar als een aanvullend FASTA-bestand (aanvullend bestand 4).

Binnen-species 5S-NTS polymorfisme werd geschat, op basis van de bovengenoemde meervoudige uitlijning, met behulp van DnaSP versie 5.10.01 [58]. De relatie tussen het aantal polymorfe sites en het minimale aantal zichtbare 5S rDNA-signalen werd onderzocht met behulp van lineaire regressieanalyse (in Microsoft Excel).

Fylogenetische reconstructie werd uitgevoerd met behulp van maximale waarschijnlijkheidsoptimalisatie die beschikbaar is via de RaxML BlackBox-webserver [59] met RaxML versie 7.2.8 [60]. Er zijn standaardinstellingen gebruikt. de 8 Phragmipedium besseae sequenties werden aangeduid als de outgroup. RaxML werd aangeroepen met de volgende opdrachten: raxml -# 100 -n geplakt -o bess1, bess2, bess3, bess4, bess5, bess6, bess7, bess8 -f a -m GTRGAMMA -x 564547904 -p 564547904 -s 0VaDTW . Alle zoekinformatie, zoals die op de website is weergegeven, is opgenomen in Aanvullend bestand 5.


Karakterisering van de volledige nucleaire ribosomale DNA-sequenties van Eurytrema pancreaticum

Eurytrema pancreaticum is een van de meest voorkomende trematoden van runderen en schapen, en infecteert ook af en toe mensen, met grote economische verliezen en medische kosten tot gevolg. In deze studie werden voor het eerst de sequenties van de complete nucleaire ribosomale DNA (rDNA) herhalingseenheden van vijf E. pancreaticum-individuen bepaald. Ze waren 8306-8310 bp lang, inclusief de kleine subeenheid (18S) rDNA, intern getranscribeerde spacer 1 (ITS1), 5.8S rDNA, intern getranscribeerde spacer 2 (ITS2), grote subeenheid (28S) rDNA en intergene spacer (IGS) . Er waren geen lengtevariaties in de onderzochte 18S (1996 bp), ITS1 (1103 bp), 5.8S (160 bp), ITS2 (231 bp) of 28S (3669 bp) rDNA-sequenties, terwijl de IGS-rDNA-sequenties van E pancreaticum had een lengtevariatie van 4 bp, variërend van 1147 tot 1151 bp. De intraspecifieke variaties binnen E. pancreaticum waren 0-0,2% voor 18S rDNA, 0-0,5% voor ITS1, 0% voor 5.8S rDNA en ITS2, 0-0,2% voor 28S rDNA en 2,9-20,2% voor IGS. Er waren negen soorten herhaalde sequenties in ITS1, twee soorten in 28S rDNA, maar geen in IGS. Een fylogenetische analyse op basis van de 18S rDNA-sequenties classificeerde E. pancreaticum in de familie Dicrocoeliidae van Plagiorchiata, nauw verwant aan de onderorde Opisthorchiata. These results provide useful information for the further study of Dicrocoeliidae trematodes.


Restriction Digestion


Restriction enzymes are endonucleases which cleave double-stranded DNA at specific oligonucleotide sequences. The specific sites at which they cleave the nucleic acids in order to generate a set of smaller fragments are called restriction sites. The natural function of restriction enzymes in bacteria may be the destruction of foreign DNA that may enter the bacterial cell. But the cells own DNA is not cleaved by these restriction enzymes. This self protection is achieved by the help of the specific DNA methyltransferase enzyme which will methylates the specific DNA sequence for its respective restriction enzymes by transferring methyl groups to adenine or cytosine residues to produce N6-methyladenine or 5-methylcytosine. An interesting feature of restriction endonuclease is that they commonly recognize recognition sequences that are mostly palindromes - they shows the same forward (5' to 3' on the top strand) and backward (5' to 3' on the bottom strand) sequences. The DNA fragments of varying length can be separated by gel electrophoresis and stained with ethidium bromide and can be photographed for future studies.


Corneo, G., Ginelli, E., and Polli, E., J. Mol. Biol., 33, 331 (1968).

Corneo, G., Ginelli, E., and Polli, E., J. Mol. Biol., 48, 319 (1970).

Coudray, Y., Quetier, F., and Guille, E., Biochim. Biofysica. Acta, 217, 259 (1970).

Birnstiel, M., Wallace, H., Sirlin, J. L., and Fischberg, M., nat. Cancer Inst. Monog., 23, 431 (1966).

Birnstiel, M., and Keddes, L. H., Nature New Biology, 230, 165 (1971).

John, H. A., Birnstiel, M., and Jones, K. W., Natuur, 223, 582 (1969).

Pardue, M. L., and Gall, J., Proc. US Nat. Acad. Wetenschap., 64, 600 (1969).

Chamberlain, M., and Berg, P., Proc. US Nat. Acad. Wetenschap., 48, 81 (1961).

MacGreggor, H. C., and Kezer, J., Chromosoma, 33, 167 (1971).

Court Brown, W. M., Buckton, K. E., Jacobs, P. A., Tough, I. M., Kunsberg, E. V., and Knox, J. D. E., Eugenics Lab. Memoirs, 42 (Cambridge University Press, 1966).

Sumner, A. T., Evans, H. J., and Buckland, R. A., Nature New Biology, 232, 31 (1971).

Jones, K. W., Natuur, 225, 912 (1970).

Pardue, M. L., and Gall, J. G., Wetenschap, 168, 1556 (1970).

Hennig, W., and Walker, P. M. B., Natuur, 225, 915 (1970).

Jones, K. W., and Robertson, F. W., Chromosoma, 31, 331 (1970).

Arrighi, F., Hsu, T. C., Saunders, P., and Saunders, G. F., Chromosoma, 32, 224 (1971).


Bekijk de video: ncRNAs - all types of non-coding RNA lncRNA, tRNA, rRNA, snRNA, snoRNA, siRNA, miRNA, piRNA (November 2021).