Informatie

Hoe gedragen cis-regulerende elementen en trans-regulerende elementen zich anders?


Stel, je werkt met een operon in een diploïde organisme.

Ik ben op zoek naar een biochemische of genetische verklaring.

Waar ik vooral moeite mee heb, is begrijpen hoe iets alleen een gen op het ene chromosoom kan reguleren en niet op het andere. Ik dacht dat cis de voorkeur zou hebben omdat het gen dichtbij is, maar alles zweeft gewoon willekeurig rond in de cel, dus het zou hoe dan ook de voorkeur geven aan cis en afvlakken als je lang genoeg wacht.


Ik dacht dat cis de voorkeur zou hebben omdat het gen dichtbij is

Je intuïtie is correct. Cis-regulerende elementen zoals enhancers zijn efficiënter in het verbeteren van de transcriptie van genen in cis dan genen in trans, maar trans interacties van cis-regulerende elementen komen voor. Kijk eens naar figuur 2B van dit artikel en de begeleidende tekst:

... kwantitatieve RT-PCR toonde aan dat relatieve niveaus van GFP-transcripten van constructen ingevoegd op 37B vergelijkbaar waren met die van transgenen op 53F, met 1,7% [95% CI, 1,6-1,8%] van het totale GFP-transcript in oogschijven waar GMR werkt in trans ten opzichte van die waar activering in cis is ...

De interactie van allelen tussen homologe chromosomen wordt transvectie genoemd, en dit kan worden gerealiseerd als binding van de versterker die is geassocieerd met het ene allel aan de promotor van het andere allel. Afbeelding 9 van dit artikel is een goede verklarende afbeelding.


Cis en trans effecten dragen op verschillende manieren bij aan de evolutie van promotors en versterkers

Verschillen in genexpressie tussen soorten worden door beide aangedreven cis en trans Effecten. Terwijl cis effecten worden veroorzaakt door genetische varianten die zich op hetzelfde DNA-molecuul bevinden als het doelgen, trans effecten zijn te wijten aan genetische varianten die diffundeerbare elementen beïnvloeden. Eerdere studies hebben voornamelijk de impact beoordeeld van: cis en trans effecten op genniveau. Echter, hoe? cis en trans effecten op verschillende manieren invloed hebben op regulerende elementen zoals versterkers en promotors blijft slecht begrepen. Hier gebruiken we massaal parallelle reporter-assays om de transcriptionele output van duizenden individuele regulerende elementen in embryonale stamcellen direct te meten en te meten cis en trans effecten tussen mens en muis.

Resultaten

Onze aanpak laat zien dat cis effecten zijn wijdverbreid over getranscribeerde regelgevende elementen, en de sterkste cis effecten zijn geassocieerd met de verstoring van motieven die worden herkend door sterke transcriptionele activatoren. Omgekeerd vinden we dat trans effecten zijn zeldzaam, maar sterker in enhancers dan in promoters en zijn geassocieerd met een subset van transcriptiefactoren die differentieel tot expressie worden gebracht tussen mens en muis. Terwijl we vinden dat cis-trans compensatie is gebruikelijk binnen promotors, we zien geen bewijs van wijdverbreide cis-trans vergoeding bij versterkers. cis-trans compensatie is omgekeerd evenredig met de redundantie van de versterker, wat suggereert dat een dergelijke compensatie vaak voorkomt bij meerdere versterkers.

Conclusies

Onze resultaten benadrukken verschillen in de wijze van evolutie tussen promotors en versterkers in complexe zoogdiergenomen en geven aan dat het bestuderen van de evolutie van individuele regulerende elementen cruciaal is om het tempo en de wijze van genexpressie-evolutie te begrijpen.


Achtergrond

Talrijke transcriptionele regulerende factoren, die kunnen worden ingedeeld in cis-regulerende elementen en trans-regulerende factoren, reguleren genexpressie [1]. Cis-regulerende elementen, zoals promotors, versterkers en geluiddempers, zijn gebieden van niet-coderend DNA, die de transcriptie van nabijgelegen genen reguleren. Daarentegen reguleren (of wijzigen) transregulerende factoren de expressie van verre genen door te combineren met hun doelsequenties [1, 2]. In de meeste gevallen controleren complexe interacties tussen cis-regulerende sequenties en trans-werkende factoren de genexpressie [3, 4].

Er wordt gedacht dat cis- en trans-regulerende elementen variëren op basis van belangrijke genetische en evolutionaire eigenschappen [5, 6]. Bij diploïde individuen reguleren cis-regulerende elementen de genexpressie op een allelspecifieke manier. Cis-regulerende variatie heterozygoten brengen allelische onevenwichtigheden tot expressie op transcriptioneel en translationeel niveau. Ter vergelijking: transregulerende factoren interageren met doelsequenties om beide allelen te reguleren [1]. Transregulerende divergentie is verrijkt voor dominant effect, terwijl de effecten van cis-regulerende varianten additiviteit zijn [6, 7]. Gunstige cis-regulerende varianten zullen in de loop van de evolutie waarschijnlijk verrijkt worden tot fixatie, omdat de additieve effecten zeldzame allelen blootstellen aan selectie [5].

Zowel cis- als transregulerende variatie spelen een sleutelrol in fenotypische variatie [1, 8,9,10]. Eerder werk in een breed scala aan soorten, waaronder: Drosophila [7], muis [11, 12] en koffie [13], hebben allel-specifieke expressie (ASE) analyse [14] gebruikt om onderscheid te maken tussen cis- en trans-regulerende divergentie (Tabel 1). Genregulerende divergentie bij vogels zou echter kunnen verschillen van genregulerende divergentie bij zoogdieren, insecten of planten, aangezien sommige genetische mechanismen die betrokken zijn bij ASE bij vogels uniek zijn. Genomische imprinting is bijvoorbeeld waargenomen bij zoogdieren en sommige planten [15,16,17], maar lijkt grotendeels afwezig bij vogels die tot nu toe zijn beoordeeld [18,19,20]. Doseringscompensatie bestaat in sommige diploïde soorten om het effect van kopie-aantalverschillen van genen op het geslachtschromosoom te bufferen [21,22,23], maar er is gemeld dat het onvolledig is bij vogels [24,25,26,27,28] . Daarom is het van cruciaal belang om de divergentie van genen bij vogels te onderzoeken.

Kip is een modeldier voor studies met vogels en een opmerkelijk voorbeeld van snelle fenotypische divergentie, met kunstmatige selectie die resulteert in grote verschillen in grootte, gedrag en reproductie tussen rassen [29]. Eerdere studies hebben frequente ASE geïdentificeerd bij verschillende kippenrassen [19, 20]. De snelle verandering onder domesticatie biedt een uniek model voor het onthullen van het relatieve belang van de cis- en trans-regulerende variatie die ten grondslag ligt aan fenotypische verandering. We gebruikten wederzijdse kruisingen van White Leghorn (WL), een belangrijk leghennenras geselecteerd vanwege zijn hoge eiproductie, en Cornish Game-rassen (CG), een hoeksteenvleeskuikenras dat is geselecteerd vanwege zijn snelle groei en spierontwikkeling [30], om de rol te beoordelen van verschillende vormen van regulatoire variatie in de hersenen, lever en spierweefsel van 1-dag oude mannen en vrouwen.


Invoering

Insecten ontwikkelen vaak resistentie tegen insecticiden die worden gebruikt voor hun bestrijding. Deze micro-evolutionaire verandering als reactie op milieu-uitdagingen vormt een constante strijd tussen insecten en mensen [1-3]. Insecten ontwikkelen resistentie tegen insecticiden via meerdere mechanismen. Verbeterde ontgifting van insecticiden (metabole resistentie) en ongevoeligheid van de doelwitplaats (resistentie op de doelwitplaats) behoren tot de belangrijkste mechanismen. Cytochroom P450 (P450)-enzymen die synthetische insecticiden en plantenstoffen, waaronder toxines, kunnen metaboliseren, spelen een belangrijke rol bij de metabole resistentie [4]. Van overexpressie van genen die coderen voor P450's is aangetoond dat het geassocieerd is met resistentie tegen insecticiden in een breed scala aan insectensoorten [5-8]. Bijvoorbeeld, overexpressie van CYP6G1 geeft resistentie tegen de insecticiden DDT en imidacloprid in Drosophila melanogaster [9].

mutaties in cis-regulerende elementen in de promotorregio's van P450-genen en/of veranderingen in het expressieniveau van transcriptiefactoren die hieraan binden cis-regulerende elementen kunnen bijdragen aan verhoogde expressie van P450-genen [10-14]. mutaties in cisVan werkende elementen in P450-promotors is aangetoond dat ze constitutieve overexpressie van P450-genen veroorzaken [2,15-18]. In NS. melanogaster, opregulatie van CYP6G1 gen resulteert uit een TE-insertie in de promotorsequentie [3,19]. Van leden van nucleaire receptoren (NR's), basic-leucine zipper (bZIP) en basic-helix-loop-helix/per-ARNT-SIM (bHLH-PAS) superfamilies is bekend dat ze insecticideresistentie mediëren [20]. Bij geleedpotigen draagt ​​constitutieve overexpressie van nucleaire receptoren/transcriptiefactoren die tot deze superfamilies behoren bij aan het verhogen van de expressie van P450's die verantwoordelijk zijn voor metabole resistentie. Toename van de expressie van de nucleaire receptor, FTZ-F1 in Plutella xylostella veroorzaakt overexpressie van CYP6BG1 dat chlorantraniliprole metaboliseert [21]. Evenzo reguleert de aryl-koolwaterstofreceptor (AhR) die behoort tot de bHLH-PAS-eiwitfamilie [20] CYP6DA2 in Aphis gossypii het verlenen van gossypol en spirotetramat tolerantie [22]. De heterodimere bZIP-transcriptiefactoren Nrf2 en Maf spelen een belangrijke rol bij de regulatie van ontgiftingsgenen geassocieerd met oxidatieve of xenobiotische respons bij mensen [23]. CncC, de insectenortholoog van Nrf2 samen met zijn heterodimeerpartner, Maf-S reguleren ook de expressie van ontgiftingsgenen die geassocieerd zijn met het metabolisme van xenobiotica, waaronder insecticiden en plantenchemicaliën [24,25]. Deze transcriptiefactoren regelen bijvoorbeeld de overexpressie van P450-genen in NS. melanogaster [26] die resistent zijn tegen insecticiden. Ondanks groeiend begrip van de rol van veranderingen in cis-acteren en trans-werkende elementen in de regulatie van P450-resistentiegenen, het relatieve belang van de twee mechanismen en of ze voornamelijk geïsoleerd of in combinatie werken, blijft slecht begrepen.

Spodoptera exigua is een wereldwijde plaag die ernstige schade toebrengt aan veel gewassen [27] en resistentie heeft ontwikkeld tegen 38 insecticiden [28]. Dit werk werd uitgevoerd om de moleculaire basis van resistentie van deze soort tegen organofosfaat- en pyrethroïde insecticiden te onderzoeken. We vonden dat een combinatie van cis- en trans-werkende factoren werken samen om een ​​cytochroom P450 te reguleren, wat leidt tot resistentie tegen meerdere insecticiden.


Materialen en methodes

C. elegans stammen en kweekomstandigheden

GFP-expressieconstructen en transgenese

Ptrx-1(1kb)::gfp (Miranda-Vizuete) et al. 2006) en Pssu-1 (0,5 kb)::gfp plasmiden (Carroll et al. 2006) werden gebruikt als sjabloon voor het genereren van promoterdeletie GFP-reporters als lineaire PCR-fragmenten om de expressie-efficiëntie te maximaliseren (Etchberger en Hobert 2008). Deze constructen bevatten verschillende promotorfragmenten die waren gefuseerd met de gfp-coderende sequentie en het 3' UTR-gebied van de unc-54 gen. Mutagenesereacties (deleties en substituties) werden uitgevoerd met behulp van de QuickChange II XL Site Directed Mutagenese Kit (Stratagene) en bevestigd door sequencing. Het 3× tandem-repeat fragment werd gesynthetiseerd de novo als twee complementaire oligonucleotiden van 84 bp, gehybridiseerd en gekloond in de hihidIII en BamHI-sites van de pPD95.77 vector en vervolgens gebruikt als basis voor het genereren van het overeenkomstige lineaire fragment door PCR. De Ptrx-1::trx-1::DsRood construct is gemaakt door het klonen van de trx-1 promotor (1 kb) in de hihidIII en BamHI-plaatsen van het pCJ102-plasmide (Winkelbauer et al. 2005). Primer sequenties gebruikt voor trx-1 en ssu-1 constructies kunnen op aanvraag worden geleverd. De Psptf-1::gfp construct werd gegenereerd door het klonen van een PCR-fragment gegenereerd met primers AGCATGCTTGGGTAAACTGCTTGGGAAAGTGG en omgekeerd AGGATCCGTGATCTGGTTTTGCTGGCTCTGC in de sphoik en BamHI-sites stroomopwaarts van de gfp-coderende sequentie van de vector pPD95.79. Dit construct bevat een stroomopwaartse sequentie van ∼3,5 kb en fuseert de sptf-1 coderende sequentie aan het einde van het tweede exon naar GFP. Transgene wormen werden gegenereerd door DNA-micro-injectie zoals eerder beschreven (Mello et al. 1991). De pRF4 [rol-6(su1006)] plasmide werd gebruikt als injectiemarker bij 50 ng/μl. Alle fragmenten werden geïnjecteerd in N2 wildtype dieren in verschillende concentraties variërend van 5 tot 50 ng/μl.

Microscopie

GFP-transgene dieren werden gemonteerd in een druppel van 5 μl van 10 mM levamisol (Sigma, St. Louis) op een 3% agarose-pad bedekt met een dekglaasje van 24 x 24 mm en gescoord op een Olympus BX61 fluorescentiemicroscoop. Voor GFP-expressieanalyse in ASJ-neuronen werden ten minste 50 wormen per lijn/stam geanalyseerd onder een × 20-doelstelling. Cellen die tot expressie brengen Psptf-1::gfp werden geïdentificeerd op basis van hun positie binnen de dieren door fluorescentie- en DIC-microscopie te combineren met behulp van een Zeiss AxioImager Z1 op basis van colokalisatie met DsRed uitgedrukt in ASJ-neuronen van de trx-1 promotor en gebaseerd op DiI-fluorescerende kleurstofvulling gevisualiseerd met behulp van een Nikon Ti Eclipse-microscoop uitgerust met een Yokogawa CSU-X1 draaiende schijfeenheid, 491- en 561 nm-lasers en bundelsplitsers.

Fluorescerende kleurstofvulassays

Fluorescerende kleurstofvulling werd uitgevoerd met 0,1 mg/ml DiI (Molecular Probes) zoals eerder beschreven (Perkins® et al. 1986).

RNA-interferentie

Het voeden van RNA-interferentie (RNAi) werd uitgevoerd zoals eerder beschreven (Timmons et al. 2001). RNAi-screening werd uitgevoerd in de VZ289, VZ382, en VZ383 stammen.

Bio-informatica en database-analyse

De initiële analyse van het vinden van motieven in 70 genen die ASJ tot expressie bracht, werd uitgevoerd met de MEME-tool (//meme.sdsc.edu/meme/intro.html). Verschillende lengtes (tot 1 kb) van gen stroomopwaartse regulerende sequenties werden geanalyseerd. Alle sequentie-uitlijningen werden uitgevoerd met de EMBOSS Water Nucleotide Alignment-tool (//www.ebi.ac.uk/Tools/psa/emboss_water/nucleotide.html). Het ASJ-motieflogo dat wordt weergegeven in figuur 4F is gegenereerd met WebLogo (//weblogo.threeplusone.com). Voor de identificatie van transcriptiefactor(en) die mogelijk binden aan het ASJ-motief, hebben we de volgende voorspellingsprogramma's en databasebronnen gebruikt: Promo 3.0 (http://alggen.lsi.upc.es/cgi-bin/promo_v3/promo/promoinit .cgi?dirDB=TF_8.3) Alibaba 2.1 (http://labmom.com/link/alibaba_2_1_tf_binding_prediction) MatInspector (http://www.genomatix.de/online_help/help_matinspector/matinspector_help.html) en Jaspar (http:/ /jaspar.genereg.net/).


Discussie

De resultaten van de huidige studie suggereren dat het promotorgebied van de CVH gen, dat zich uitstrekt van -316 tot +275 bp en de 5' UTR en intron 1 bevat, kan de transcriptie van de CVH gen in PGC's van kippen. Ze suggereren ook dat aanzienlijk opgereguleerde TF's zoals: HSF2, NFYA, SP3, en ZNF143 bij kippen spelen PGC's een rol bij de expressie van CVH gen door directe interactie met vermeende bindingsplaatsen van de CVH gen promotor.

VASA, een evolutionair geconserveerde RBP die translationele controle van kiemcelspecifieke genen bevordert, wordt specifiek tot expressie gebracht in kiemcellen tijdens kiembaanontwikkeling [28]. Verschillende rapporten hebben aangetoond dat vasa spelen een cruciale rol bij de vorming van het kiemplasma en de gametogenese bij ongewervelde dieren zoals Caenorhabditis elegans en Drosophila melanogaster [29, 30]. Bovendien is VASA-expressie in kiemcellen essentieel voor hun overleving en proliferatie [31, 32]. Bij transgene dieren werden 5,1 kb, 4,7 kb, 2,4 kb, 5,6 kb, 8 kb en 4,3 kb vasa promotor zijn gebruikt voor kiemcelspecifieke expressie van reportergenen in respectievelijk medaka [33], regenboogforel [34], zebravis [35], muizen [36], koeien [37] en varken [38]. Bovendien, in Drosophila melanogaster, het is gemeld dat kiemlijnspecifiek vas genexpressie in oögenese is vereist voor een genomisch gebied van 40 bp van de vas gen, hoewel het specifiek interageert met bepaalde ovariële eiwitten [39]. Daarnaast is bij de malariamug vasa-achtig gen wordt specifiek tot expressie gebracht in zowel de mannelijke als vrouwelijke geslachtsklieren bij volwassen muggen en wordt gekarakteriseerd in de regulerende regio's die de volledige 5'UTR zijn en slechts 380-bp stroomopwaartse sequentie voor de specifieke kiemlijnexpressie in de GSC's van beide geslachten [40 ]. Hoewel studies over de transcriptionele controle van CVH voor temporele en ruimtelijke regulatie veelbelovend zijn voor praktische toepassingen, met betrekking tot het gebruik van een kiemcelspecifieke promotor voor het opsporen van kiemcellen en het begrijpen van het moleculaire netwerk van transcriptionele regulatie achter hun unieke kenmerken, is er zeer beperkte informatie beschikbaar over de regulerende elementen die betrokken zijn bij transcriptionele controle van de CVH gen in kip.

Eerder onderzoek toonde aan dat de CVH gen vereist een 5' flankerend gebied van 1.555 bp voor hogere inductie van specifieke expressie in geslachtscellen op transcriptioneel niveau [16]. Zoals getoond in Fig. 1, beschreven we echter dat het hoogste promotoractiviteitsgebied van de CVH gen, dat een fragment van 591 bp is (-316/+275) dat de 5'-UTR bevat, is voldoende voor de inductie van specifieke expressie in PGC's van kippen, zoals bepaald met een 5'-deletietest. Bovendien tonen onze bevindingen voor de eerste keer aan dat het 5'UTR-bevattende intron 1 vereist is voor promotoractiviteit van de CVH gen in PGC's van kippen, zoals bepaald door middel van 5'- en 3'-fragmentatieassays (Fig. 2). Met betrekking tot de rol van introns bij transcriptionele controle in diverse organismen, hebben verschillende rapporten aangetoond dat introns een cruciale rol spelen bij het beheersen van transcriptie, inclusief die van kiembaanspecifieke genen, en fungeren als versterkers om genexpressie te regelen [41-47]. Op zoek naar regelgevende elementen van vasa promotor in medaka, Li et al. toonde aan dat het eerste intron een belangrijke rol speelt in de VAS-activiteit van in totaal 11 regio's geïdentificeerd binnen de 5,1 kb vasa promotor [47], en vond vervolgens dat de eerste 35-bp van exon 1 van vasa gen voldoende is om de transcriptionele activiteit als versterker te verhogen [48]. Daarom lijkt het waarschijnlijk dat de 5′ UTR met intron 1 van de CVH gen waardevol zou zijn voor het construeren van een kiemcelspecifiek CVH promotorvector voor het praktische gebruik van genetische bronnen.

Transcriptionele controle is vereist voor regulerende elementen zoals gespecialiseerde promotorsequenties en promotorherkenning trans-werkende factoren [49]. Maar er zijn weinig rapporten over transcriptionele regulatoren van vasa gen. Een eerdere studie onthulde dat Mitf fungeert als transcriptionele activator van kiemcelspecifieke genen die gecodeerd zijn voor RNA-bindende eiwitten zoals vasa, dazl en dnd in medaka spermatogoniale cellijn [50]. Daarom hebben we onderzocht of voorspelde TF's met vermeende bindingsplaatsen in het fragment van 591 bp (−316/+275) van de CVH promotor kan de expressie van kip direct reguleren CVH. Met behulp van onze eerdere transcriptoomanalyse identificeerden we TF's die sterker tot expressie werden gebracht in PGC's van kippen dan in andere celtypen. De geïntegreerde benaderingen die in deze studie werden gebruikt, waren complementair voor het vinden van nieuwe TF's met vermeende bindingsplaatsen in de CVH promotor. We konden Mitf echter niet vinden in de geanalyseerde CVH bovengenoemde promotor. Ten slotte hebben we zes TF's geselecteerd (EP300, GABPA, HSF2, NFYA, SP3, en ZNF143) die vermeende bindingsplaatsen hebben in het fragment van 591 bp (−316/+275) van de CVH promotor door middel van een reeks experimenten. In Fig. 3 zijn alle TF's gemarkeerd voor consensussequenties en posities in de volgorde van de CVH promotor, inclusief de TATA-box-sequentie voor transcriptionele initiatie en het startcodon. We hebben ook hun expressieniveaus gevalideerd met behulp van kwantitatieve RT-PCR. Op basis van de resultaten zijn vijf TF's (EP300, HSF2, NFYA, SP3, en ZNF143) werden significant uitgedrukt in PGC's in vergelijking met hun niveaus in andere monsters, terwijl GABPA werden significant tot expressie gebracht in PGC's vergeleken met CEF, DF-1 en GSC, maar vertoonden geen significant verschil in expressie vergeleken met die in stadium X (Fig. 4). We hebben verder onderzocht of deze TF's de transcriptie van kiemcelspecifieke RBP's beïnvloeden (CVH, cDAZL, CIWI, en CDH) in kippen-PGC's door siRNA-gemedieerde knockdown.

Met betrekking tot significante expressie en functies in geslachtscellen, is gemeld dat hitteschokfactor 2 (HSF2) een rol speelt tijdens de embryonale ontwikkeling en onder stressomstandigheden, de vorming van beschadigde gameten voorkomt en de integriteit van het voortplantingsproces waarborgt [ 51]. Bovendien hebben knock-out muismodellen aangetoond dat HSF2 betrokken is bij oögenese en spermatogenese en sterk tot expressie wordt gebracht in PGC's [52, 53]. Als algemene transcriptie-activator bindt NF-Y sterk aan CCAAT-motieven en bestaat het uit NF-YA-, −YB- en -YC-subeenheden [54]. In C. elegans, mutaties in nfya-1 beïnvloeden de ontwikkeling van geslachtscellen en verminderen ook het aantal zaadcellen [55]. Bovendien wordt NF-Y sterk beïnvloed door het CCAAT-motief in termen van zijn transcriptionele activiteit met betrekking tot Miwi en CIWI gen [56, 57]. Bovendien is SP3 een van de Sp-familie van TF's, die wordt gekenmerkt door drie geconserveerde zinkvingers [58], en de transcriptionele activiteit van talrijke genen positief of negatief controleert door binding aan de GC-box in cis-regelgevende elementen [59]. Belangrijk is dat er is gemeld dat de regulering van Nanog genexpressie is vereist voor Sp1- en Sp3-expressie, naast Oct4 en Sox2, in muis [60]. Zinkvingereiwit 143 (ZNF143) werd voor het eerst geïdentificeerd in Xenopus [61], en de meeste ZNF143-bindingsplaatsen zijn verstoord in promoters die zijn geassocieerd met CpG-eilanden nabij de transcriptiestartplaats in het zoogdiergenoom [62]. Znf143 wordt in het bijzonder tot expressie gebracht in de muis ICM [63] en de expressie ervan is betrokken bij de regulatie van de overleving en vernieuwing van embryonale stamcellen van zoogdieren [64]. Het werd ook bewezen dat ZNF143, in wisselwerking met Oct4, de expressie van Nanog regelt door directe binding aan de Nanog proximale promotor [65]. Bovendien is ZNF143 onlangs geïdentificeerd als een nieuwe factor die promoters en distale regulerende elementen verbindt als een isolatorfunctie voor afstammingsspecifieke genexpressie [66]. Met betrekking tot transcriptionele regulator van Mouse Vasa Homologue (MVH), Znf143 voorkeur histon H3 lysine 27 acetylering (H3K27ac)-gemarkeerde regio's geassocieerd met de vroege genen, waaronder Kit, Prdm1, en Sox2 in plaats van de late genen zoals Mvh, Piwil1, Piwil2, Tdrd7, en Tdrd9 in geslachtscellen [67]. Uit onze resultaten bleek echter dat: HSF2, NFYA, SP3, en ZNF143 zou naar verwachting functioneren als transcriptionele regulatoren in PGC's van kippen. Gezamenlijk laten onze resultaten voor de eerste keer zien dat deze TF's betrokken zijn bij de promotoractiviteit van kiemcelspecifieke RBP's in PGC's van kippen, maar het moet nog worden bepaald of deze TF's direct op elke genpromotor werken tijdens de ontwikkeling van kippen-PGC's.


Het klassieke ASE-model maskeert individuele, duidelijke effecten van cis–trans verhoudingen

(Vgl 1) waar HR vertegenwoordigt de impact van hybridisatie op relatieve homoeologische expressie, in tegenstelling tot hoe de trans effect wordt geschat in klassieke ASE-analyse (d.w.z. trans = , zoals geïllustreerd in figuur 1 (b), dus trans = −HR). Dit erkent dat hybridisatie inherent homoloog-specifieke expressie beïnvloedt in trans, afhankelijk van de relatieve effecten van inter- versus intra-subgenoominteracties.

Hoewel de voorgaande algebraïsche gevolgtrekking niet wezenlijk verschilt van die van de klassieke ASE-analyse, is het perspectief niettemin zinvol. Niet alleen is de impact van hybridisatie, HR, conceptueel onderscheiden van hoe cis en trans varianten dragen bij aan ouderlijke divergentie, maar Eqn Eqn 1 presenteert ook een methode om te kwantificeren hoe inter-subgenoominteracties elke homoeoloog differentieel reguleren ten opzichte van intra-subgenoominteracties (advertentie/aa vs da/dd). Zoals samengevat in Fig. 1 (c), de omvang van significante hybridisatie-impact (wanneer) HR ≠ 0, 4e kolom van links) zal naar verwachting variëren tussen plantensystemen, wat lijkt te correleren met de mate van verschillen in expressie tussen oudersoorten (2e kolom). Een histogram van niet-nul HR, zoals geïllustreerd voor katoen (Yoo et al., 2013), is indicatief voor asymmetrische regulatie door cross-genoominteracties, dat wil zeggen dat inter-subgenoominteracties een sterker relatief effect hebben op het ene genoom dan op het andere, in dit geval het At in plaats van het Dt-subgenoom. Dit besef vestigt de aandacht op inter-subgenoominteracties, die het meest relevant zijn voor genexpressieverandering die gepaard gaat met hybridisatie per se.


Resultaten

Allelische expressie-analyse van transcriptomen van katoenvezels

In totaal werden 27 vezel-RNA-seq-bibliotheken gesequenced, bestaande uit twee tijdpunten elk van de G. hirsutum cultivar Acala Maxxa (vier replica's), het wilde ras Yucatanense TX2094 (3-4 replica's), en hun wederzijdse F1 hybriden (elk drie replica's) Maxxa × TX2094 (M × T) en TX2094 × Maxxa (T × M Fig. 1a Aanvullende tabel 1). Om Maxxa- en TX2094-allelen in de F . te onderscheiden1 hybriden, werden ouderlijke uitlezingen gebruikt om een ​​diagnostische SNP-tabel te genereren, die 91.017 SNP's omvatte verdeeld over 27.816 genmodellen (13.462 A-genoom-homeologen, 14.060 D-genoom-homeologen en 294 op scaffolds zonder chromosoomaanduiding). Van een totaal van 150 miljoen F1 reads toegewezen aan het referentiegenoom, 7,5% en 7,7% zijn verantwoordelijk voor allel-specifieke reads die ondubbelzinnig werden toegewezen aan respectievelijk Maxxa- en TX2094-allelen. Deze verhoudingen zijn consistent over de twaalf F1 monsters en tussen de wederzijdse hybriden M × T en T × M (aanvullende tabel 2). Er werden dus meer TX2094-specifieke uitlezingen dan Maxxa-specifieke uitlezingen teruggevonden, waarschijnlijk als gevolg van een hoger niveau van heterozygotie bij de voormalige toetreding. Deze vooringenomenheid werd gecorrigeerd door normalisatie van de leestelling bij het berekenen van allelische expressieniveaus in de volgende analyses.

Categorisering van verschillen in regelgeving onder domesticatie

In vergelijkingen tussen Maxxa en TX2094 werden 6883- en 4829-genen differentieel tot expressie gebracht in twee belangrijke ontwikkelingsstadia van vezels, d.w.z. 10 en 20 dagen na anthesis (dpa), respectievelijk vertegenwoordigde de vereniging hiervan 15% van het vezeltranscriptoom in G. hirsutum. Zoals geïllustreerd in Fig. 1 veranderen deze uitdrukkingen onder domesticatie, zoals gemeten door de log2 verhouding van Maxxa:TX2094 ouderlijke leestellingen (EEN), weerspiegelen een combinatie van cis- en trans-regulerende effecten. onder de gemeenschappelijke trans omgeving van de F1 hybriden konden we meten cis effecten als het logboek2 verhouding van Maxxa tot TX2094 allelspecifieke leestellingen (B), voor de 27.816 genen die allelische SNP's in de transcriptsequenties bevatten. Overeenkomstig, trans effecten werden gemeten als het verschil tussen de ouderlijke en F1 expressie divergentie (EEN-B). Wanneer dezelfde ASE-metingen werden gebruikt voor: B en vervolgens EEN-B, werd een sterke negatieve correlatie gevonden tussen de cis en trans effecten met Pearson's R = -0,78 tot -0,80 (aanvullende gegevens 1). Zoals onlangs is opgemerkt 33 , is deze standaardmethode intrinsiek bevooroordeeld en overschat ze de negatieve correlatie, maar als alternatief kan een kruislingse replicatiebenadering deze vertekening elimineren door verschillende biologische replica's te gebruiken voor het schatten van cis en trans effecten afzonderlijk (zie Methoden). De resulterende correlaties (R = −0,29 tot −0,34, P < 0,05 Aanvullende gegevens 1) waren zwakker dan die van de standaardmethode, maar bleven significant.

Op basis van de statistische tests van EEN, B, en EEN tegen B, genen werden toegewezen aan een van de zeven regulerende categorieën (figuur 1a). In alle vier F1 monsters (M × T en T × M elk op 10 en 20 dpa), werden meer dan 90% genen geclassificeerd in de categorieën geconserveerde (VI) en ambigue (VII) expressie. Van genen die verschillen in ouderlijke expressie vertoonden (EEN ≠ 0, categorieën I tot IV Fig. 2a),

80% werd gekarakteriseerd als het gevolg van variatie die inwerkt op cis alleen (ik) of in trans alleen (II), waar consequent een hoger aandeel van I dan II werd waargenomen (figuren 1a en 2a). Wanneer cis en trans effecten werden beide gedetecteerd, genen werden verder verdeeld op basis van hoe regulerende varianten elk bijdroegen aan expressieveranderingen, in termen van hun richting van actie. Het aantal genen dat het tegenovergestelde vertoont: cis en trans effecten (compenserende categorie IV) waren 7 tot 20 keer groter dan die met beide effecten in dezelfde richting (verhogende categorie III). Dit overschot van cis en trans veranderingen die in oppositie werkten, werden ook bewezen door de genen die compenserende regulatie vertoonden (categorie V, Fig. 1a), wanneer er geen differentiële expressie werd gevonden tussen de ouders, maar toch werd differentiële allelische expressie afgeleid in de F1 hybriden. Dus de cis en trans varianten in de ouders werken antagonistisch om vergelijkbare expressie te produceren (d.w.z. ze zijn compenserend). Deze categorie is de op twee na grootste (Fig. 1b) na de geconserveerde en dubbelzinnige categorieën, ongeacht de strengheid van overeenkomstige statistische tests (zie Methoden). Samen met de negatieve correlaties tussen de cis en trans effecten die hierboven direct zijn gemeten, suggereerden deze waarnemingen dat de antagonistische werking van cis en trans effecten komt veel vaker voor dan het versterken van veranderingen, in overeenstemming met eerdere ASE-onderzoeken 34 .

categorisering van cis en trans regelgevende divergentie. een Regelgevende categorieën I-IV die ouderlijke divergentie vertoonden (EEN 0). In 10 en 20 dpa vezels van de wederzijdse F1 hybriden M × T en T × M, genaantallen en relatieve percentages van deze vier categorieën werden getoond. B Aandeel van cis regelgevende bijdrage aan divergentie van ouderlijke expressie. Genen werden weggegooid door absolute ouderlijke divergentie |EEN| in x-as, en de hoeveelheid absolute totale uitdrukkingsdivergentie als gevolg van cis effecten |B|/(|B| + |EENB|) wordt weergegeven op de ja-as met foutbalken die 95% betrouwbaarheidsintervallen weergeven. CF Boxplots die de omvang en richting van divergentie van ouderlijke expressie tonen en cis regelgevende divergentie, zoals samengevat door gepoolde M × T- en T × M-gegevens in zowel de ontwikkelingsstadia van 10 als 20 dpa. Boxplot-elementen: middellijn-mediaan box-limieten-bovenste (Q3) en onderste (Q1) kwartielen snorharen-kleinste en grootste niet-uitbijterpunten-uitbijters. Y-aswaarden boven nul in NS, F wijzen op een voorkeur voor respectievelijk hogere ouderlijke en allelische Maxxa-expressie, onder nul duidt op een voorkeur voor TX2094. De significante afwijkingen van nul, zoals aangegeven door het gouden stersymbool (*), werden afgeleid door Student's t-toets (P < 0,05). Overeenkomstige plots voor elke F1 hybride in beide fasen worden getoond in aanvullende figuur 2. Brongegevens worden geleverd als een brongegevensbestand.

Vervolgens vroegen we of de kruisingsrichting van hybridisatie effecten heeft op de inferentie van reguleringsdivergentie. Omdat de maat van EEN was gebruikelijk voor M × T- en T × M-hybriden, terwijl elk van hun B waarden afzonderlijk werd afgeleid, was de ASE-inferentie niet volledig onafhankelijk tussen de wederzijdse hybriden. We merken op dat meer dan 93% van de genen (26.041 en 26.106 van 27.816 genen bij respectievelijk 10 en 20 dpa) consistent werden toegewezen aan dezelfde regulerende categorieën in de twee wederzijdse F1s. Exclusief die genen die ambigue regulatie vertonen vanwege statistische incongruentie in F1 hybride nam deze overlap toe tot meer dan 99% (aanvullende figuur 1). Dus de overlappende genen toegewezen aan categorieën I tot V elk op 10 en 20 dpa (respectievelijk 1321 en 923 genen) werden geacht regulatoire divergentie (RD) te vertonen onder divergentie en domesticatie, en hun vereniging resulteerde in een lijst van 1655 RD-genen . Hiervan vertoonden 513 genen cis alleen divergentie, 301 genen tentoongesteld trans alleen divergentie, en de overige 841 genen vertoonden beide cis en trans divergentie (aanvullende gegevens 2).

Cis en trans bijdragen aan meningsverschillen

Ondanks het hogere aantal cis alleen (ik) versus trans alleen (II) genen (Fig. 2a), minder dan de helft van de regulatoire divergentie tussen TX2094 en Maxxa was te wijten aan cis effecten, gemeten aan de hand van hun relatieve bijdrage bij het beschouwen van alle genen (standaardmethode 46-48%, cross-repliceren 36-45% aanvullende gegevens 1). Een aanzienlijk hogere totale omvang van trans dan cis divergentie in de regelgeving werd consequent gevonden (|trans| > |cis|, Wilcoxon rangsomtest P < 0,05 Aanvullende gegevens 1). Bovendien, over het algemeen trans Regelgevingsdivergentie correleerde sterker met expressieverschillen dan deed cis divergentie in de regelgeving (Pearson's correlatie) R = 0,36–0,51 voor trans, R = 0,17-0,27 voor cis Aanvullende gegevens 1). Hoewel de cis proporties lijken toe te nemen met de grootte van de divergentie van de ouderlijke expressie (absoluut log2(M/T)-ratio's van 1 tot 4), waren de Pearson-correlaties nogal zwak (R = −0,02 tot −0,08, P < 0,01 Afb. 2b).

Overeenkomend met de grootte van de divergentie van de ouderlijke expressie, zoals berekend door |EEN| (Fig. 2c zie ook Aanvullende Fig. 2 voor elke F1 hybride in beide vezelfasen), vertoonde de categorie van versterkende regulatie het hoogste niveau van expressieveranderingen, gevolgd door de cis alleen en trans only categories (III > I > II Wilcoxon rank sum test, P < 0,05). Thus, when cis en trans effects acted in the same direction, the highest magnitude of parental expression change was observed, as may be expected. With respect to the direction of regulatory change, as calculated by EEN (Fig. 2d), categories of cis only and compensating regulation were biased toward up-regulating gene expression in Maxxa versus TX2094 (EEN > 0 for I and IV, Student’s t-test P < 0.05), with no significant directional bias detected for other categories. Considering all categories together, 2715 and 1916 genes exhibited EEN > 0 at 10 and 20 dpa, significantly higher than the 2453 and 1612 genes that exhibited EEN < 0, respectively (Supplementary Table 3 Chi-squared test P < 0,05).

Because the magnitude of cis divergence in F1 hybrids is defined and estimated by |B| (Fig. 2e), values above zero were observed for genes assigned to categories of cis only, enhancing, compensating and compensatory regulation as expected, trans only genes exhibited near zero magnitude of cis effect. In comparison with the compensating and compensatory regulation, a much lower level was found for the category of enhancing regulation (IV or V > III Wilcoxon rank sum test P < 0,05). Regarding the direction of cis divergence (Fig. 2f), higher expression of Maxxa alleles was preferentially observed for cis only genes (B > 0, Student’s t-test P < 0.05), consistent with the pattern of their parental divergence shown in Fig. 2d (EEN > 0). In contrast, genes categorized as displaying antagonistic cis en trans regulation exhibited lower expression of Maxxa alleles than TX2094 alleles (B < 0 for IV and V, Student’s t-test P < 0,05). Considering all categories together, a significant bias toward lower expression of Maxxa alleles was observed with approximately twice as many B < 0 genes than B > 0 genes (Supplementary Table 3 Chi-squared test P < 0,05). The foregoing results collectively suggest that cis evolutionary change was biased toward favoring lower expression during domestication (B < 0), whereas trans evolution acted antagonistically even to a larger extent to reverse this directional bias (EEN > 0).

Regulatory divergence is associated with mode of inheritance

To investigate the inheritance patterns of regulatory divergence under domestication, we classified the genes that exhibited parental expression change (EEN ≠ 0) into the following inheritance categories: additive (where expression in the F1 hybrid is equivalent to the average of that of the two parents), dominant (where expression in the hybrid is equivalent to the expression of only one parent), and transgressive (where expression in the hybrid is outside the range of the two parental expression values). Overall, the majority of genes showed additive and dominant expression inheritance patterns (62% and 34%, respectively), with 1% of genes exhibiting transgressive up- or down-regulated expression, leaving about 3% that could not be assigned due to statistically conflicting patterns (Fig. 3a). A significant association was found between regulatory mechanism and the mode of expression inheritance (Chi-square test of independence, P < 0.05), with cis only regulation being enriched for additive inheritance and depleted of dominance, while both trans only and compensating regulation were enriched for genes that displayed dominance in their regulatory evolution. Interestingly, we observed a significant enrichment of transgressive inheritance in those genes exhibiting compensating regulation. No significant correspondence was detected for genes exhibiting enhancing cis en trans regulation probably due to the small size of this category.

Relationships between regulatory mechanism and mode of inheritance. een For each combination of inheritance (rows) and cis/trans regulatory (columns) categories, the color shows the magnitude of gene enrichment (blue) and depletion (red) based on residuals of Pearson’s Chi-square test of independence. Blue indicates a positive residual when more genes were observed than expected under the null model of independence, and red indicates fewer genes than expected. Statistical significance was derived from Fisher’s exact test, as indicated by *P < 0.05, **P < 0.01, ***P < 0.001. B Within the category of dominance, percentages of Maxxa-dominant genes are shown for each regulatory category on the x-axis. C Within the category of transgression, the percentage of over-expressed genes are shown for each regulatory category on the x-axis. Source data are provided as a Source Data file.

Within the inheritance category of dominant expression, genes were further divided into patterns of Maxxa-dominant and TX2094-dominant, defined as whether the F1 expression is equivalent to the expression of Maxxa or TX2094, respectively. If there is no preference of either pattern, a 50:50 proportion of gene numbers is expected. In 20 dpa fibers, more Maxxa-dominant than TX2094-dominant genes were generally found except for the enhancing category (Fig. 3b, blue points above 50%), whereas the opposite pattern was observed in 10 dpa fibers (red points mostly below 50%). These results do not support a general trend of dominant inheritance, which however, was dependent on developmental stage. Within the inheritance category of transgression, more transgressive up-regulated than down-regulated expressions were consistently found (Fig. 3c and Supplementary Data 3).

Homoeolog expression changes by regulatory variation

Expression divergence among homoeologous genes, or homoeolog expression bias, has been extensively characterized in plant allopolyploids 35 . To study the extent and variation of homoeolog expression bias (as opposed to ASE of individual homoeologs, discussed up until now) in fibers during domestication, we measured the relative expression of homoeologs (At/Dt) for a total of 22,394 duplicate gene pairs. About one third of these pairs exhibited unequal, or biased, homoeolog expression in either 10 dpa or 20 dpa fibers (8655 pairs in Maxxa and 8042 pairs in TX2094 Fig. 4a, columns of “Homoeolog expression bias”). Consistent with a previous study 30 , more pairs exhibited expression bias at 10 (30–33%) than at 20 dpa (19–20%) in both accessions. Comparing homoeolog ratios between Maxxa and TX2094 identified domestication changes for only 6.2% and 3.0% of gene pairs at 10 and 20 dpa, respectively, suggesting that the relative contribution of homoeologs was mostly conserved under domestication. In addition, the totaal expression for each homoeolog pair (At + Dt) was also compared between Maxxa and TX2094, resulting in 13.4% and 9.5% of gene pairs with significant changes at 10 and 20 dpa, respectively (Fig. 4a, columns of “Domestication change”). Thus, expression changes of individual genes appear to have a larger impact on the totaal expression of homoeologs than their relative ratios.

Regulatory evolution and homoeolog expression. een The extent of homoeolog expression bias (1st and 2nd columns) and expression changes under domestication (ratios, At/Dt, and total expression, At + Dt 3rd and 4th columns, respectively) were measured for 22,394 homoeologous gene pairs. B Contingency tables between cis en trans regulatory divergence and homoeolog bias. A pair of homoeologous genes was considered to exhibit regulatory divergence (RD) if at least one homoeolog was found to be a RD gene (1st row). Homoeolog expression bias was characterized each within TX2094 and Maxxa (columns). Cells displaying significant over-representation (Fisher’s exact test P < 0.05) are highlighted. C Cross-tabulation of regulatory evolution for 952 RD homoeolog pairs, indicating predominance of cis en trans effects. Cell color indicates the magnitude of significant over-representation based on −log10(P-value) of Fisher’s exact test (i.e., P = 0.05 is converted to 1.3). NS Boxplot of homoeolog expression ratio changes under domestication for RD homoeolog pairs. Black triangles indicate significant deviation from zero (Student’s t-test P < 0.05), and the asterisk (*) denotes a significantly different ratio between At and Dt homoeologs. Boxplot elements: center line–median box limits–upper (Q3) and lower (Q1) quartiles whiskers–smallest and largest non-outlier points–outliers. The source data underlying Fig. 4d are provided as a Source Data file.

To evaluate how cis en trans regulatory variation underlies the dynamics of homoeolog expression patterns, a total of 8036 homoeolog gene pairs were extracted from the 27,816 genes diagnosed with Maxxa/TX2094 SNPs. First, we asked whether the occurrence of regulatory changes under domestication is associated with divergent expression between homoeologous genes. Of 952 homoeolog pairs detected with regulatory changes in at least one homoeolog (i.e., one or both homoeologs belong to the list of 1655 RD genes see above), about 65% exhibited homoeolog expression bias (613 pairs in Maxxa and 622 pairs in TX2094 fibers Fig. 4b), significantly higher than the overall percentages of homoeolog bias (50% and 48% out of 8036 pairs, respectively Fisher’s exact test P < 0,05). This suggests that fiber genes that already exhibited homoeolog expression bias in wild cotton were more likely to be modified during domestication. Such regulatory evolution either increased or decreased At/Dt ratios during domestication without significant preference.

Next, we compared regulatory changes in the two co-resident (At and Dt) subgenomes. It has been proposed that allopolyploid cotton G. hirsutum has been under asymmetric subgenome selection for improved fiber quality, with more signals of selection detected in the Dt than At subgenome 27 . Under this model, we expected to observe more Dt than At regulatory changes. In contrast, 518 At and 525 Dt genes were observed with regulatory divergence, which are statistically equivalent numbers that counter the earlier study based on genomic scanning for potential selective signals (74 Mb At and 104 Mb Dt region). Here we find that cis- and trans- regulatory evolution mostly occurred in only one homoeolog from each pair (Fig. 4c note that for 861 of 952 pairs, regulatory changes were observed for either but not both of the At and Dt homoeologs). In general, changes in the relative At/Dt ratios and totaal At + Dt homoeolog expression (Supplementary Fig. 3) were unremarkable, except for a small bias toward reduced Maxxa expression when the At homoeologs exhibit no regulatory divergence and the Dt homoeologs exhibit cis-only divergence.

Changes in At/Dt ratios were further compared directly between At and Dt regulatory variants (Fig. 4d). Cis-only divergence of either homoeolog led to the most pronounced changes in At/Dt ratio (i.e. variability indicated by box size), followed by trans-only, and then cis + trans and no divergence. Significant deviation from zero ratio change was inferred for the cis-only effects on Dt (Fig. 4d, black triangle below zero reflecting an increased contribution of Dt versus At homoeolog expression), the trans-only effects on At (triangle above zero reflecting an increased expression contribution of At), and the cis + trans on Dt (above zero). Only the ratio changes associated with trans-only effects were significantly different for At and Dt homoeologs (marked by asterisk symbol). These data suggest that the increased expression contribution of At is more associated with trans-only regulatory category, while the increased expression contribution of Dt is more associated the cis-only regulatory change.

Elevated sequence divergence with cis regulatory divergence

To understand the genetic basis of cis divergence, we examined sequence variation and found that RD genes exhibiting cis-only variants generally evolve faster with a higher substitution rate in both promoter and coding regions (Supplementary Note 1). As shown in Supplementary Fig. 4, RD genes with cis divergence contain more promoter SNPs and indels (within a 2-kb promoter region upstream of the transcription start site) than do genes without cis regulatory divergence (cis-only or cis + trans > trans-only Duncan’s multiple range test P < 0.05) both cis-only and trans-only genes tend to display higher substitution rate (dS = 0.0063–0.0070 and dN = 0.0028–0.0037) than those exhibiting cis + trans divergence and non-RD genes (dS = 0.0029–0.0035 and dN = 0.0019–0.0021 Duncan’s multiple range test P < 0,05). Between At and Dt homoeologs, comparable amounts of sequence variation were observed except that Dt promoters accumulated more SNPs than did At promoters (6.4 vs. 5.7 SNPs Student’s t-test P < 0,05).

Co-expression network and functional analyses

In biological networks, highly connected genes, or hubs, are thought to have high pleiotropic effects and play essential roles in gene regulation and function. Changes in hub genes are expected to have larger biological impacts than those occurring in genes in the network periphery. To explore the network localization of domestication-related regulatory variations as represented by RD genes, we used the weighted gene co-expression network analysis (WGCNA) to generate the separate wild and domesticated networks from 13 TX2094 and 16 Maxxa fiber RNA-seq datasets (Supplementary Table 1), respectively. Within each network, ranking all genes by either whole network connectivity (kTotaal) or intramodular connectivity (kWithin), gene set enrichment analysis was applied to determine whether the RD gene sets (cis-only, trans-only and cis + trans) were randomly distributed throughout the ranked gene list, or primarily found as network hubs. The TX2094 network exhibited significant enrichment of all RD gene sets (FDR < 0.05) amongst the most highly connected genes, suggesting that regulatory changes under domestication were biased toward targeting genes that were highly connected in wild fiber developmental networks. Likely as a result of these regulatory changes, the network properties of these RD genes were altered to be not enriched as hubs in the Maxxa network. In both networks, the network density (i.e., the connected portion of all possible connections) of RD genes was significantly higher than the same number of randomly selected genes (permutation test P < 0.001 by sampling 100 times). As shown in Supplementary Table 4, the subnetwork of trans-only genes was consistently denser than the subnetworks of cis-only genes (subnetwork density of 0.031 vs. 0.019 in TX2094, and 0.013 vs. 0.008 in Maxxa). One possible explanation is that these trans variations may represent genetic or expression changes of a small number of common upstream regulators, so that trans affected genes are more functionally associated and interconnected than are the cis-only genes, whose cis variations are relatively independent. Interestingly, the density of cis + trans genes is similar to that of cis-only genes in TX2094, but in Maxxa it was more similar to the trans-only genes (Supplementary Table 4 0.018 in TX2094 and 0.011 in Maxxa).

Functional enrichment analysis revealed that catalytic activity, DNA metabolic process, and cellular protein localization were the most enriched gene ontology (GO) classifications for fiber expressed genes (the union of 55,551 with read depth above 5 at either stage among 66,610 genes Supplementary Data 4 adjusted P < 0.05). For the differentially expressed genes between Maxxa and TX2094 fibers, catalytic and metabolic activities such as oxidoreductase and steroid dehydrogenase activity were enriched at both developmental stages of 10 and 20 dpa, whereas cytoskeleton-related molecular function and biological processes were specifically enriched in 20 dpa fibers (Supplementary Data 5 adjusted P < 0.05). Against the reference list of 27,816 genes containing diagnostic SNPs between Maxxa and TX2094 alleles (Supplementary Data 6 adjusted P < 0.05), genes exhibiting regulatory divergence under domestication (1655 RD genes) are mainly associated with heme binding, oxidoreductase and transferase activity, as well as the cellular components of cytoskeleton, cell wall, and clathrin coat. Among these, 188 RD genes were identified as candidate fiber domestication genes from a recent QTL study of Maxxa versus TX2094 28 , representing a significant overlap between these two gene lists (Fisher’s exact test P < 0.05 Fig. 5a and Supplementary Data 2 column of “fiber QTL genes”). With respect to different categories of regulatory divergence, cis-only genes were specifically enriched for oxidoreductase activity and clathrin-coated vesicle, trans-only genes were specifically enriched for xyloglucan:xyloglucosyl transferase activity, lipid biosynthetic process, and cellular components including cell wall, cytoskeleton, microtubule and kinesin complex, and the cis + trans genes are mainly involved in the regulation of signal transduction and response to stimuli (Supplementary Fig. 5 and Supplementary Data 6 adjusted P < 0.05).

Predicted GRNs of TX2094 and Maxxa fibers. een Number of candidate genes within the fiber QTL confidence intervals 28 , from a curated list of cell wall-related genes, and those annotated as TFs. For the total of 53 TFs that belong to the list of 1655 regulatory divergent (RD) genes (see annotation in Supplementary Data 2), a GRN was each inferred for TX2094 (B) and Maxxa (C) by Genie3 and visualized using Cytoscape. Edge direction represents the regulatory interaction from TF to target TG genes. Node shape represents the categorization of RD patterns. Node size is proportional to number of target genes (i.e., out-degree). Nodes color represents the membership of consensus co-expression gene modules inferred by WGCNA (see Methods and Supplementary Data 2). TFs marked by asterisk (node 3, 32, and 50) and and (48) were found within the confidence intervals of fiber QTLs and related to cell wall synthesis, respectively. The source data underlying Figs. 5b, c are provided as a Source Data file.

Exploiting gene regulatory networks for functional discovery

To further explore the potential for functional discovery during fiber domestication, we constructed gene regulatory networks (GRNs) of TX2094 and Maxxa using Genie3 36 , which predicts directed regulatory links from transcription factors (TFs) to their target genes (TGs). Among a total of 1518 TFs included for GRN construction, 53 were detected with regulatory variation, including 12 cis-only, 26 cis + trans, and 15 trans-only RD genes (Fig. 5a and Supplementary Data 2). Because more TGs were predicted for these RD TFs than the non-RD TFs in both fiber networks (Wilcoxon test P < 0.05), it is reasonable to speculate that RD TFs act as causal transcriptional regulators involved in fiber domestication. As visualized by Cytoscape 37 , the TX2094 subnetwork of these 53 RD TFs is composed of four disconnected clusters of genes (Fig. 5b), whereas the majority of Maxxa nodes were connected into one large cluster in the network (Fig. 5c). This increased level of interconnectivity in domesticated vs. wild cotton is consistent with the previous report in seed development 31 , as well as a separate study of fiber co-expression networks (unpublished). Functional implications of specific TFs and their network properties were detailed in Supplementary Note 2.


Simulation Methods

Target Gene Expression.

The expression level of a target gene is determined by the probability that an RNA polymerase (RNAP) complex binds to its promoter through interaction with a bound transcriptional activator (28). Despite several factors that would affect this probability, we restrict our attention, for the sake of simplicity, to evolutionary changes in the concentration of an activator ([T]) and its dissociation constant to the cis-binding element (K), keeping all other variables constant. The concentration [T] has a logistic form

where [T]max is the maximum possible level of concentration achieved when F = ∞, τ designates the concentration achieved when F = 0, and F represents an evolving variable that is the direct target of mutational changes (see below). The dissociation constant K is determined by a difference between the two numbers, each assigned to the activator and cis-regulatory element (een en C, respectively) (13):

where κ designates the smallest dissociation constant achieved when een = C. We assume that the binding affinity of a transcriptional activator to its cis-regulatory element can be quantified by the inverse of the dissociation constant (1/K) (Fig. 1). In the simulations, we set [T]max = κ and τ = κ (2/15). Hence, assuming that the binding probability of the activator to the cis-regulatory element is given by (29), the upper bound of this probability would be 0.5 (achieved when F = ∞ and een = C), whereas the lower bound would be 0 (achieved when F = −∞ or eenC = ± ∞) it becomes 2/17 at a fitness optimum given by F = een = C = 0.

In each strain, the expression level is kept near the optimum under so-called Gaussian stabilizing selection, meaning that the fitness of an individual with an expression level Z is given by met wie(Z) = exp[−s (Z − θ) 2 ]. Here, θ denotes the optimum level of gene expression, whereas s is a constant measuring the strength of selection larger (smaller) s implies stronger (weaker) stabilizing selection on the target gene expression level.

In the present formulation, the RNAP promoter binding probability for each allele in the parental homozygous strain l (zP(l)) is given by

Here, [Pol] and KPol are the concentration and dissociation constant of the RNAP complex, respectively ω is a cooperativity factor between the bound activator and the RNAP complex (28). Assuming a diploid autosomal locus and additivity of the two alleles, the expression level of an individual is obtained by Z = 2zP(l).

We also assume that the allele-specific concentration of the activator [Tl] is halved in hybrids. Hence, the corresponding probability for allele l in the hybrid between strains l en J (zH(l)) is given by

Hier, Kik is a dissociation constant of the activator from strain k naar de cis-binding element in strain l, waar k ∈ <l, J>. The expression level of a hybrid individual is again obtained by adding the probabilities for the two alleles: Z = zH(l) + zH(J). Throughout the simulations, we set [Pol]/KPol = 1/50 and ω = 20 (28).

Mutation.

Each mutation affects only one of the evolving properties F, een, en C. Mutations that increase or decrease F by an amount NSF occur at rate vF per generation. Mutation effect and rate for een are ±NSeen en veen, respectively, whereas the effect and rate for C are ±NSC en vC, respectievelijk. Because of the difference in the mutation target size, we assume vFveen, vC.

Simulating Evolutionary Dynamics.

At the fitness optimum (Z = θ), any mutational change is necessarily deleterious, and its fixation entails a degradation of population fitness. Subsequent to this substitution event, the next mutation may bring back the population to the fitness peak by compensating for the deleterious effect of the first mutation otherwise, population fitness may decay even more substantially by fixing mutations that shift the population farther away from the optimum. Previous work on compensatory evolution has found that, when selection against deleterious intermediates is weak and linkage between interacting loci is loose, evolution proceeds by sequentially accumulating independent substitutions in a stepwise manner (30). To simulate the process of evolution by successive fixation of mutant alleles in an otherwise monomorphic (homogeneous) background, the present analysis makes a simplifying assumption that only a single locus at most can be polymorphic at any time. The stochastic effect of random genetic drift is incorporated into the simulations by assuming a finite panmictic population of constant size N = 100,000. Then, the fixation probability of a new mutation at the polymorphic locus is computed based on its fitness effect conditional on other loci being monomorphic (31). If fixed, the mutation moves the population to a new state, from which the fixation probability of the next mutation is computed.

By repeating this substitution process, the evolutionary divergence in 10,000 pairs of orthologous genes is simulated based on the relative probabilities of possible substitution events that may potentially occur in the next step. The time interval between consecutive substitution events is also determined based on the total rate of substitution at each step. Starting from a fitness optimum given by F = een = C = 0, each round of simulations is initiated by a burn-in period of 10 7 /U generations (where UvF + veen + vC designates the total mutation rate), after which a single panmictic population starts to diverge by splitting into two isolated populations that evolve independently thereafter.

Regressing the Relative Allelic Expression in F1 Hybrids on the Expression Difference Between Parental Strains.

We follow ref. 4 and study the simulated linear regression of the (log2-transformed) relative allelic expression (log2[zH(l)/zH(J)]) in F1 hybrids on the (log2-transformed) relative expression difference (log2[zP(l)/zP(J)]) between parental strains l en J. We study two cases in particular. In the first case, een is a constant (veen = 0), and only C mutates consequently, eenC compensation does not occur. In the second case, both een en C are allowed to mutate, and therefore eenC compensation may occur together with K-[T] compensation.

Pleiotropy of an Activator with Two Target Genes.

We also consider a system with two genes (denoted G1 en G2) that are pleiotropically affected by a single activator. As in the above model with a single target, the expression of gene G1 is jointly regulated by the concentration of the transcriptional activator [T] and its dissociation constant to the cis-binding element of G1, which is given by κ exp[(eenC1) 2 ]. Similarly, the level of G2 expression is regulated by three variables, [T], een, en C2, in which the dissociation constant to the cis-binding element of G2 is κ exp[(eenC2) 2 ]. Together, these properties determine the expression levels of the two target genes (denoted Z1 en Z2), which, in turn, influence the fitness of an individual in a multiplicative manner: met wie(Z1, Z2) = exp[−s1 (Z1 − θ1) 2 − s2 (Z2 − θ2) 2 ]. Hier, sl quantifies the strength of stabilizing selection on the level of Gl expression as the deviation of Zl from its optimum θl (l ∈ <1, 2>). Note that, by setting s2 = 0, we recover the model without pleiotropy, with the fitness function given by met wie(Z1) = exp[−s1 (Z1 − θ1) 2 ]. Wanneer s1, s2 > 0, mutational changes in [T] or een may have detrimental pleiotropic effects, because mutations that minimize |Z1 − θ1| may inflate the deviation of Z2 from θ2. Although only two target genes are explicitly modeled in the present analysis, we expect that, as long as we focus on the regulation of G1 expression, situations with a larger number of simultaneously regulated targets can be studied by assigning a larger value of s2 in the simulations.


Discussie

We have identified a wing-specific cis-regulatory element for the gene knot. This regulatory element is activated in the wing by direct input from Ci and is repressed in the haltere by direct input from UBX. The regulatory sequences governing activation and repression are physically separable, and the repression element was found not to be shared with D. pseudoobscura. We identified a distinct functional repression element in D. pseudoobscura that is shared with D. melanogaster,indicating that the entire knot wing regulatory region in D. melanogaster contains two apparently redundant repressor elements. One element appears to have been acquired in the course of the evolution of the D. melanogaster lineage. Our results suggest that complete functional cis-regulatory elements, the units of function that selection is operating upon, may be larger and more diffuse than the minimal functional sequences typically defined by molecular dissection.

Mechanism of UBX repression

Owing to their low DNA-binding specificity and paucity of known direct targets, mechanisms for the selection of specific target genes by Hox proteins remain to be fully explained. Much work has focused on the role of co-factors in increasing the binding specificity of their Hox partners. When Hox proteins interact with PBC and MEIS proteins, represented in Drosophila by EXD and HTH (Chan et al., 1997 Gebelein et al., 2002 Ryoo and Mann, 1999 Ryoo et al., 1999), the resulting compound-binding sites are of sufficient size and information content so as not to appear by random chance at high frequency in the genome. However, neither EXD nor HTH are necessary for development of the haltere, so the action of UBX in this tissue must be independent of these co-factors(Azpiazu and Morata, 1998 Azpiazu and Morata, 2000). Repression of spalt gene expression by UBX in the haltere depends upon multiple individual UBX monomer-binding sites,(Galant et al., 2002) rather than compound binding sites. In addition, a DNA sequence that binds neither Hox proteins nor Hox-PBC dimers determines specificity of Deformed or Labial regulation of a Deformed autoregulatory element, but the identity of this co-factor is unknown (Li et al.,1999).

Our functional analysis of the knot regulatory element is consistent with UBX repression occurring through monomer sites. UBX-binding sites in the sal1.1 en knot minimal enhancers cannot be aligned beyond the TAAT core, and so neither suggest the role of a common DNA binding co-factor. However, mutation of the identified UBX binding sites alone did not result in full de-repression of the knot minimal element in the haltere. Rather, full de-repression required mutation of additional sites not bound by UBX. This sequence may bind either a bona fide co-repressor that interacts with UBX to repress target genes or a protein that independently,but additively, contributes to repression. Omdat kn Mel 701-1835 drives a higher level of expression in the wing than kn Mel 701-1991, this putative repressor may act in both the wing and the haltere.

Analyses of both the sal en knot regulatory regions suggest that UBX may be a weak repressor that requires the collaboration of other factors, which may act in the wing and haltere to regulate other features of these tissues, in order to mediate full repression. However, as mutation of UBX sites alone in kn Mel 2499-2722 is sufficient for de-repression, UBX may, in some contexts, be able to mediate full regulatory activity on its own. Flexibility in the organization of UBX-responsive enhancers may be due to the unsystematic, undesigned assembly of regulatory elements during evolution.

Regulatory elements that are cobbled together, incorporating binding sites for multiple collaborating transcription factors to take advantage of an existing landscape of developmental regulators, appear to be common. In the developing Drosophila embryo, both UBX and ABD-A repress the target gene Distalless (Dll) in abdominal segments, limiting leg development to the thoracic segments(Gebelein et al., 2002 Vachon et al., 1992). Repression of Dll also requires the action of the compartment-specific regulators, Engrailed and Sloppy-paired(Gebelein et al., 2004), in collaboration with the Hox proteins. In addition, the Hox protein Labial interacts with the Decapentaplegic (Dpp) signaling pathway to direct appropriate expression of the lab550 autoregulatory enhancer element in the Drosophila embryo (Marty et al.,2001), and Abdominal-A similarly collaborates with Dpp signaling to regulate wingless expression(Grienenberger et al., 2003). Collaboration may be a common requirement for Hox-regulated enhancers. Thus,rather than being highly potent regulators, Hox proteins may be weak regulators that employ a variety of collaborative factors in order to perform their function. The ability of Hox proteins to act as either repressors or activators of target genes may be regulated by interactions with different collaborators (Li and McGinnis,1999 Li et al.,1999).

Furthermore, the weak activity of UBX and the potential requirement for collaborators for Hox repression of target genes may help to explain why it has not been possible to impart UBX regulation to a naïve cis-regulatory element by the addition of UBX monomer binding sites. Extensive efforts in this laboratory have placed multiple UBX-binding sites in various positions in cis-regulatory elements active in the wing and haltere, but with no effect (C. M. Walsh and S.B.C., unpublished). The separability of Ci activator binding sites from UBX repressor binding sites in the knot regulatory element demonstrates that in this enhancer UBX does not repress by direct competition for activator binding sites, and suggests that distance of UBX-binding sites from activator binding sites is not the cause for this failure. If UBX is such a weak repressor that UBX-binding sites alone, even in multiple copies, are not sufficient to impart repression, then the proximity of binding sites for collaborating repressor proteins may be a crucial determinant.

Conservation, redundancy, and the unit of selection in cis-regulatory elements

To better understand how UBX regulates morphology, we would ideally like to know all target genes on which it acts and the DNA regulatory sequences through which it exerts this control. Characterization of these regulatory sequences would elucidate the rules governing transcriptional regulation and how modification of regulatory sequences can occur during evolution. Our knowledge of the organizational constraints on regulatory sequences and how evolution operates within those constraints to maintain enhancer function is limited. Several analyses indicate that sequence within regulatory elements can vary even when function is maintained(Hancock et al., 1999 Ludwig et al., 1998 McGregor et al., 2001 Shaw et al., 2002). Nevertheless, sequence conservation between related organisms can successfully identify regulatory sequences in some lineages(Wasserman et al., 2000 Yuh et al., 2002). However,98% of non-exonic multi-species conserved sequences within mammals do not correspond to known regulatory elements(Thomas et al., 2003). We can either suppose that these sequences primarily represent regulatory elements yet to be functionally characterized or that sequence conservation alone is not an indicator of regulatory function.

Our dissection of the knot regulatory region provides examples of apparently redundant binding sites for individual transcription factors,apparently redundant functional repressor elements, and sequence conservation without obvious biological function. For example, of three conserved putative Ci-binding sites, each contained within larger blocks of sequence conservation, only Ci1680 is necessary for activation of knot in the wing field. This observation suggests several possible interpretations. First,the other Ci sites may be functioning in a different context – a different tissue, for example – than examined in our assay, and selection has maintained these sites for that additional role. However, even the large 6.8 kb knot regulatory fragment did not appear to drive lacZ reporter expression in a limited set of additional tissues surveyed (data not shown), so we do not have any positive evidence supporting its role elsewhere in development. Similarly, the conserved blocks could represent binding sites for other factors, with conservation a consequence of maintaining those regulatory sites rather than the Ci sites. Next, it is possible that the evolutionary distance between D. melanogaster en D. pseudoobscura is not appropriate for addressing the relationship between sequence conservation and functional consequence. However, as this distance is approximately equivalent to the distance of the human-mouse comparison, we must then infer significant differences in the dynamics of sequence evolution within these two lineages. Finally, the additional Ci sites may contribute to regulation in the context of the wing to a degree that we are unable to detect, but that purifying selection does act upon, and it is this view that we favor.

The apparent redundancy of UBX repressor elements in the D. melanogaster knot regulatory region also requires explanation. The accretion of UBX sites in the knot regulatory region in our sample of species phylogenetically intermediate to D. pseudoobscura en D. melanogaster suggests that a novel UBX-responsive element has evolved. Given the presence of a pre-existing, functional sequence that is maintained in both D. melanogaster en D. pseudoobscura, how has selection maintained the conserved element and allowed expansion of the novel element? Dissection of the vooravond stripe 2 regulatory element in both D. melanogaster en D. pseudoobscura demonstrated that compensatory evolution could lead to turnover of individual binding sites,resulting in a regulatory element with conserved function in the absence of sequence conservation (Ludwig et al.,1998 Ludwig et al.,2000). However, compensatory evolution that maintains repression of knot in the haltere does not seem to be the solution, as the downstream element is still present and therefore presumably capable of repressing knot expression. We conclude that the minimal element we identified in our functional assay is not necessarily identical to the functional unit upon which selection acts. That is, selection can detect and select for organismal-level effects of regulatory changes that are not obvious in our functional assay. Therefore, minimal functional regulatory elements defined by molecular dissection may not reflect the full, complete enhancers that selection has built. In plaats van scherp begrensd en discreet te zijn, kunnen regulerende elementen meer diffuse verzamelingen van transcriptiefactorinvoer zijn.

Vanuit evolutionair oogpunt lijkt een dergelijke diffuse, flexibele regelgevingsarchitectuur een noodzaak. Als specifieke precieze rangschikkingen van transcriptiefactorbindingsplaatsen vereist zijn om een ​​transcriptionele output te produceren, is de kans op het ontwikkelen van een nieuw functioneel regulerend element door puntmutatie uitzonderlijk laag. Als in plaats daarvan een zwakke regelaar, zoals UBX lijkt te zijn, samenwerkt met een factor die al op een versterker werkt, kan een nieuwe output worden gegenereerd die door selectie kan worden versterkt. Deze versterking kan uiteindelijk resulteren in een nauwkeurigere, geoptimaliseerde rangschikking van bindingsplaatsen en een robuustere regulerende output.


Bekijk de video: Wikipedia trans-1,2-Diaminocyclohexane (Januari- 2022).