Informatie

Grote effecten op cellen gekweekt met 5% FBS aangevulde media in plaats van 10% FBS?


Ik onderhoud een paar cellijnen in het laboratorium (industriële R&D) die ik regelmatig gebruik voor experimenten. Ik realiseerde me vandaag dat de media die ik voor de week op maandag had voorbereid, alleen waren aangevuld met 50 ml FBS in 1 L DMEM, in plaats van de gebruikelijke 100 ml die ik gewoonlijk doe. Ik had haast en voegde verstrooid de waarde van de tweede autopipettor van 50 ml niet toe.

Mijn cellen zijn morfologisch in orde, maar ik denk dat ze iets langzamer groeien dan normaal, ik vermoed dat dit te wijten is aan de 1/2 concentratie van alle FBS-groeifactoren, enz. Zijn er nog andere effecten die hierin duidelijk zouden zijn?

Ik begrijp dat het appels met peren zal zijn om de resultaten met deze cellen te vergelijken met, laten we zeggen, een experiment gedaan met een batch cellen gekweekt in volledige (10% FBS aangevuld) media.


Als u een op flow gebaseerde levensvatbaarheidstest zou uitvoeren (annexine V, levende/dode fixeerbare kleurstoffen, 7-AAD) of dubbele fluorescentietelling (zoals acridine-oranje/propidiumjodide, de laatste tijd populaire methode), macht vinden dat meer cellen apoptose ondergaan, of een toename van dode cellen. Ik zeg dit omdat trypanblauw de levensvatbaarheid vaak overschat. Uw meest uitgesproken effect zou gewoon een vermindering van levensvatbare cellen of een langzamere groeicurve moeten zijn als u die gegevenspunten neemt. Anders zou je een test moeten uitvoeren (eerlijk voorbeeld).

Het probleem is dat deze waarnemingen enorm variëren, afhankelijk van de cellijn die u gebruikt, de variabiliteit van partij tot partij van het serum en de hantering van het reagens. Het serum was bijvoorbeeld op onjuiste wijze door hitte geïnactiveerd, het medium was afgebroken, een slechte hoeveelheid serum, enzovoort. Neem dit dus als een generalisatie en een goede reden om uw serumpartijen te valideren.


Effecten van foetaal runderserumdeprivatie in celculturen op de productie van Anticarsia gematalis Multinucleopolyhedrovirus

Anticarsia gematalis is een plaag in de sojaboongewassen in Zuid-Amerika, die kan worden bestreden door het Multinucleopolyhedrovirus van A. gemmatalis (AgMNPV). Momenteel is de commerciële productie gebaseerd op geïnfecteerde larven. De mogelijkheid om gemodificeerde baculovirussen te gebruiken in Integrated Pest Management-programma's heeft echter de interesse gewekt om alternatieve vermenigvuldigingsprocessen te ontwikkelen. Deze studie evalueerde de AgMNPV-productie in UFL-Ag-286-cellen die eerder foetaal runderserum hadden onthouden.

Resultaten

Kweekmedia met 1% FBS gedurende de afgelopen 48 uur bereikten een gesynchroniseerde toestand waarbij 90% van de cellen werd gevonden in G0/G1 stadium, waaruit de aanwezigheid van niet-filamenteuze actine blijkt. Alle kenmerken werden geschat op basis van cellulaire levensvatbaarheidstesten, celactinedetectieonderzoeken en flowcytometer-celcyclusanalyse. AgMNPV-productie werd getest door transcriptstudies en ontluikende virussen (BV's) en occlusielichamen (OB's) leverden kwantificering op. De resultaten toonden aan dat de productiviteit in FBS-arme cellen 9,8 keer meer was in BV's en 3,8 keer meer in OB's met betrekking tot niet-behandelde cellen.

Conclusies

UFL-Ag-286-cellen die eerder in FBS waren beroofd, bleken een betere gastheer te zijn voor AgMNPV-vermeerdering, waardoor de bruikbaarheid voor beide toeneemt in vitro productie van bioinsecticide en toepassingen zoals recombinante eiwitexpressie of genafgifte.


Achtergrond

De menselijke placenta bestaat uit trofoblastcellen. De juiste ontwikkeling van het embryo hangt af van de trofoblastfunctie. Deze cellen dringen de baarmoeder binnen en hermodelleren de spiraalvormige slagaders van de moeder. De intra-uteriene omgeving van het eerste trimester speelt een belangrijke rol bij de regulatie van de trofoblastfunctie en -capaciteiten [1]. Trofoblastcellen delen verschillende vaardigheden met kankercellen, wat leidt tot de beschrijvingen zoals "pseudo-kwaadaardig" of "fysiologische metastase" ondanks hun ruimtelijke en temporele regulatie [2].

Er zijn verschillende trofoblastcellijnen ontwikkeld om de trofoblastfunctie in vitro te bestuderen. Een voorbeeld is de vereeuwigde extravilleuze trofoblast HTR-8/SVneo-cellijn, die oorspronkelijk werd verkregen uit een menselijke placenta in het eerste trimester.

Foetaal runderserum (FBS) wordt traditioneel gebruikt om menselijke fysiologische omstandigheden te simuleren, omdat het veel van de juiste voedingsstoffen en signaalmoleculen bevat. Hoewel de samenstelling verschilt van menselijk serum, kunnen menselijke cellen dankzij hun homologie reageren op rundereiwitten. FBS wordt gebruikt als een aanvulling op celkweekmedia, waardoor celgroei mogelijk wordt, en het variëren van de dosis kan worden gebruikt om pathologische of behandelingsomstandigheden te simuleren.

Serumdepletie kan het door straling geïnduceerde doden van pancreaskankercellen beïnvloeden [3], de dexamethason-gemedieerde differentiatie van neuroblastoomcellen mogelijk maken [4], en aanleiding geven tot groeiremming, differentiatie en interleukine-1-receptorexpressie in leukemiecellen [5]. Het effect van serumdepletie op de trofoblastfunctie blijft echter onbekend.

De micro-omgeving van de tumor beïnvloedt de progressie van kanker [6] op dezelfde manier als hoe de intra-uteriene omgeving de placenta-functie beïnvloedt [1]. Het is bekend dat FBS de proliferatie, migratie en invasie van HTR-8/SVneo-trofoblastcellen in vitro [7-9] kan stimuleren, hoewel het eiwitexpressieprofiel onder deze omstandigheden nog moet worden onderzocht. In deze studie hebben we het effect van serumdepletie op de expressie en het profiel van trofoblasteiwitten onderzocht met als doel de impact op de overleving van trofoblasten te bepalen. Door 10% FBS aan te wijzen als het controleniveau (het model van fysiologische groei) en 0,5 of 0% FBS als gedeeltelijk of volledig uitgeputte toestanden, voerden we twee proteomische onderzoeken uit met onsterfelijk gemaakte menselijke HTR-8/SVneo trofoblastische cellen. De proteomen werden gescheiden via tweedimensionale gelelektroforese (2DE), en eiwitvlekken werden geïdentificeerd via tandemmassaspectrometrie (MS/MS) en verrijkingsannotatie en eiwitinteractienetwerkanalyses. Inzicht in het profiel van eiwitten die differentieel tot expressie worden gebracht, kan belangrijke informatie opleveren over de relatie tussen trofoblastcellen en de beschikbaarheid van voedingsstoffen, de omgeving en de functionaliteit.


Adoptieve T-celtherapie (CAR-T)

Het concept van chimere antigeenreceptor T-cellen (CAR-T) werd voor het eerst beschreven in 1989 door Eshhar et al 2 , en jaren later werd de eerste door de FDA goedgekeurde therapie ontwikkeld door de Universiteit van Pennsylvania. De commerciële belangstelling voor T-cel-gemedieerde therapieën is recent sterk toegenomen dankzij de FDA-goedkeuringen van twee CAR-T-therapieën in 2017, Kymriah® en Yescarta™ voor de behandeling van acute lymfatische leukemie en lymfoom. In het huidige CAR-T-productieproces worden T-cellen die van de patiënt zijn geoogst (autoloog) genetisch gemanipuleerd om chimere antigeenreceptoren (CAR's) tot expressie te brengen die specifiek zijn voor de kankercellen. Deze gemodificeerde cellen worden vervolgens in cultuur uitgebreid en opnieuw toegediend aan de patiënt in een proces dat adoptieve celoverdracht (ACT) wordt genoemd.


Ontmoet de uitvinders

De uitvinders van menselijk plasma-achtig medium zijn Jason R. Cantor en David M. Sabatini.

Als postdoc in het laboratorium van David M. Sabatini aan het Whitehead Institute/MIT in Cambridge, ging Jason op zoek naar het creëren van wat een menselijk plasma-achtig medium (HPLM) zou worden, een fysiologisch medium dat ontworpen is om de metabolische samenstelling van de mens beter te weerspiegelen. bloed, waardoor de studie van gekweekte cellen in biochemische omstandigheden met grotere relevantie voor de menselijke fysiologie mogelijk wordt.

Cantor en Sabatini rapporteerden uiteindelijk begin 2017 hun ontwikkeling en eerste studies met HPLM (Cell). Lees hier hun publicatie, Physiologic Medium herleidt cellulair metabolisme en onthult urinezuur als een endogene remmer van UMP-synthase.

We zijn trots om met Jason en David samen te werken om deze innovatie op de markt te brengen, en we zijn enthousiast over de enorme mogelijkheden die HPLM zou kunnen bieden in verschillende gebieden van de wetenschappelijke gemeenschap. Zoals Jason opmerkt: "De recente ontwikkeling van fysiologische media heeft, net als andere pogingen om de modelleringscapaciteit van celcultuur aan te pakken, een enorm potentieel om het begrip en de interpretatie van diverse biologische en farmacologische onderzoeken te verbeteren." Lees hier meer van zijn commentaar uit 2019: The Rise of Physiologic Media.

Jason en David zijn uitvinders van een octrooiaanvraag voor HPLM die is toegewezen aan het Whitehead Institute.


Materialen en methodes

Genetische constructies en cellijnen

Het genetische construct αGFPnb-TRPV1-T2A-eGFP-FtD (Fig. 1a (i)) werd gesynthetiseerd met behulp van de methode beschreven door Stanley et al.. 15 . De Ca2+-afhankelijke SEAP-reporter (CaR-SEAP) was gebaseerd op de Ca2+-afhankelijke proinsuline-reporter door Stanley et al.. 15 . Het proinsuline-gen werd verwijderd uit het construct tussen het Ca2+-afhankelijke minimale promotiesysteem en de SV40-poly(A)-sequentie met behulp van HindIII/NdeI-restrictie-enzymen en vervangen door een SEAP-cDNA-sequentie. Voor alle onderzoeken werden menselijke embryonale niercellen (HEK-293T ATCC, CRL-3216) gebruikt. Stabiele klonale HEK-293T-cellijnen voor elk van de MSCV-constructen werden gegenereerd en geselecteerd op sterke expressie met behulp van fluorescentie-geactiveerde celsortering. De stabiele klonale cellijnen voor het volledige systeem (nbV1/FtD) en de voorloper eGFP-FtD-constructen worden respectievelijk HEK-nbV1/FtD en HEK-FtD genoemd. Voor alle cellen werd SEAP-productie geïntroduceerd met behulp van tijdelijke transfectie van het CaR-SEAP-construct.

Ferritine-immunoprecipitatie

HEK-FtD-cellen werden gesubkweekt in weefselkweekschalen van 10 cm met een lage dichtheid (2-3 x 104 cellen∙cm −2) in 15 ml Dulbecco's Modified Eagle Medium (DMEM Gibco) aangevuld met 10% foetaal runderserum (FBS Gibco ) bij 37 °C in een vochtige 5% CO2 broedmachine. Na 28-32 uur werd het medium veranderd in DMEM aangevuld met 1 of 10% FBS, 0 of 2 mg mL −1 holo-transferrine (HTF Sigma-Aldrich) en 0 of 500 μM ijzercitraat (FeC Sigma-Aldrich ). Na 24 uur werden de cellen geoogst op hun ferritine met behulp van op Tris-gebufferde zoutoplossing (TBS) gebaseerde lysisbuffer met proteaseremmers en geen metaalionchelatoren. Gelyseerde cellen werden verzameld, 30 minuten bij 4 ° C bij 250 rpm geschud en vervolgens bij 20.000x gecentrifugeerdG en 4 ° C gedurende 20 min.

Om eGFP-gelabeld chimeer ferritine te zuiveren, werd de FLAG-tag (DYKDDDDK) linker van de eGFP-FtD gebruikt als een doelwit voor immunoprecipitatie. Monoklonale ANTI-FLAG M2-antilichamen geconjugeerd aan agarosekorrels (αFLAG-kralen Sigma-Aldrich) werden gebruikt voor affiniteitsvangst van het FLAG-gelabelde ferritine volgens het door Sigma aanbevolen protocol met de vermelde uitzonderingen. Voor binding werd elk lysaat gedurende 3 uur bij 4 ° C geroerd bij 250 rpm op een oscillerende shaker met αFLAG-beads-slurrymengsel om αFLAG-gelabeld ferritine te vangen. Eenmaal gebonden, werd de kolom met αFLAG-kralen gevormd en driemaal gewassen met koude TBS. FLAG-gelabeld ferritine werd uit de kolom geëlueerd met vijf wassingen van 200 g∙mL −1 3xFLAG-peptide (APExBIO) in koude TBS. De geëlueerde mengsels van αFLAG-gelabeld ferritine (> 480 kDa), niet-geassembleerd eGFP-FtD (71,5 kDa) en overmaat 3xFLAG-peptiden (2,9 kDa) in TBS werden vervolgens gescheiden door centrifugaalfilters met een molecuulgewicht van 100 kDa (Millipore, gecentrifugeerd bij 14.000xG gedurende 15-20 min bij 4 ° C) om een ​​gezuiverde oplossing van FLAG-gelabelde ferritine te verkrijgen. Monsters werden vervolgens opnieuw gesuspendeerd in koude TBS, gekwantificeerd met behulp van de Micro BCA-eiwittest (Pierce) en bewaard bij 4 ° C tot ze werden gekarakteriseerd.

Ferritine karakterisering

Het gezuiverde eGFP-gelabelde ferritine werd gekenmerkt door transmissie-elektronenmicroscopie (TEM) en hoge resolutie (HR) TEM (JEM-2100F, JEOL) om respectievelijk de kerngrootte en kristalstructuur te beoordelen. Monsters werden buffer uitgewisseld van TBS met gedeïoniseerd water om zout te verwijderen en verdund tot 5-50 g∙mL −1 eGFP-ferritine-eiwit. Verdunde monsters werden vervolgens druppelgegoten op koperen roosters en gedroogd voorafgaand aan TEM en HRTEM. Om de grootte van de corona van ferritine-eiwit te visualiseren en te meten, werd negatieve kleuring met 1% (w/v) fosfowolfraamzuur gebruikt met TEM. TEM-afbeeldingen werden geanalyseerd op kern- en eiwitgrootte met behulp van de ImageJ FIJI (National Institute of Health) deeltjesanalysefunctie. HRTEM-afbeeldingen werden geanalyseerd met behulp van de snelle Fourier-transformatie (FFT) -functie in ImageJ FIJI om elektronendiffractie (ED) -patronen te genereren.

AMF-stimulatiesysteem

Er werd een W-5/500 krachtcentrale met HS-8 warmtecentrale gebruikt met een op maat gemaakte 2-turn inductiespoel (L ≈ 0,34 μH), verwisselbare condensatoren en instelbare transformator om AMF's van . te genereren

350-500 kHz (UltraFlex-vermogenstechnologieën). Er werd een op maat gemaakte geïsoleerde monsterhouder geconstrueerd om vier monsters binnen dezelfde volumetrische posities van de spoel in alle experimenten te houden (zie aanvullende figuur 3a). Capaciteiten van 0,3, 0,4, 0,5 en 0,6 F werden gebruikt om frequenties van respectievelijk 500-502, 435-436, 387-388 en 353-354 kHz te genereren. De warmteontwikkeling werd geregeld door koud water door de holle buis van de inductiespoel te leiden. De temperatuur voor elke AMF-stimulatieconditie werd bepaald door de spoel 60-90 minuten voor te verwarmen en vervolgens periodiek de temperatuur van de behandelingsbuffer in elke geïsoleerde houder te meten totdat evenwicht was bereikt. Een niet-CO2 incubator werd ingesteld op de evenwichtstemperatuur van de spoel om de overeenkomstige AMF−-temperatuurregelingsconditie te creëren.

AMF-onderzoek naar stimulatie, potentiëring en remming

HEK-293T- en HEK-nbV1/FtD-cellen werden gekweekt in DMEM aangevuld met 10% FBS in T75-kolven bij 37 ° C in een vochtige 5% CO2 incubator (hetzelfde voor alle stappen, tenzij anders vermeld). HEK-nbV1/FtD-cellen werden gesubkweekt op dekglaasjes nr. 2 met een diameter van 12 mm in platen met 24 putjes. Alle dekglaasjes werden voorbehandeld met fibronectine (Sigma-Aldrich 10 μg∙mL −1 in DPBS) om de celadhesie te verbeteren. Cellen werden uitgeplaat op de dekglaasjes bij lage dichtheid (

2,1 x 104 cellen cm 2) in 500 μL DMEM aangevuld met 10% FBS. Na 28-30 uur werden HEK-nbV1/FtD-cellen getransfecteerd met het CaR-SEAP-construct (248 ng∙well −1) met behulp van Lipofectamine 2000 (2,5 ng:1 ng DNA Invitrogen) in Opti-MEM (OMEM Gibco) aangevuld met 2 mg∙mL −1 HTF volgens een standaard Lipofectamine 2000 transfectieprotocol. Evenzo werden HEK-293T-cellen getransfecteerd met een molaire verhouding van 1:2 van het nbV1/FtD-construct (252 ng-putje 1) tot het CaR-SEAP-construct (248 ng-putje 1) volgens hetzelfde Lipofectamine 2000-protocol. Het medium werd 16-18 uur na transfectie veranderd in 500 L OMEM aangevuld met 1% FBS en 500 μM FeC. Na 8 uur groei bij 37 ° C werd de temperatuur 16-18 uur verlaagd tot 32 ° C ter voorbereiding op AMF-stimulatie.

Cellen op dekglaasjes werden overgebracht naar 400 μL Ca2+-verrijkt (met behulp van CaCl2 Sigma-Aldrich) OMEM (base Ca2+-concentratie van 0,9 mM) tot een eindconcentratie van 2,5 mM (Ca-OMEM). AMF-agonist-potentiëringsexperimenten gebruikten 1,0 M capsaïcine (Tocris) in Ca-OMEM. Voor AMF-remmingsonderzoeken werd Ca-OMEM aangevuld met ofwel 100 nM AMG-21629 (3-amino-5-[[2-[(2-methoxyethyl)amino]-6-[4-(trifluormethyl)fenyl]-4- pyrimidinyl]oxy]-2(1H)-chinoxalinone Tocris), 100 M apocynine (4-hydroxy-3-methoxyacetofenon Sigma-Aldrich), of 5,0 mM N-acetylcysteïne (NAC Sigma-Aldrich). Er werden combinatorische mediumcondities gecreëerd tussen capsaïcine en elk van de remmers (Inhib) om vier condities te creëren om AMF-activering te bestuderen: basaal (Cap−/Inhib−), potentiëring (Cap+/Inhib−), remmend (Cap−/Inhib+) en remde potentiëring (Cap+/Inhib+). HEK-nbV1/FtD-cellen werden gebruikt voor alle AMF-onderzoeken, behalve de apocynine- en NAC-remmingsonderzoeken, die HEK-293T-cellen gebruikten die tijdelijk het nbV1/FtD-platform tot expressie brachten.

De geïsoleerde monsterhouder werd vervolgens vastgezet in de spoel, afgedekt en blootgesteld aan continue AMF bij ingestelde veldsterkten (gecontroleerd door aangelegde stroom) en frequenties (ingesteld door capaciteit) gedurende 15-120 minuten, afhankelijk van de experimentele conditie. De AMF−-controles werden behandeld in een identieke geïsoleerde monsterhouder met 400 μL aangevuld Ca-OMEM in de niet-CO2 broedstoof bij de evenwichtstemperatuur van de spoel. Na de behandeling werden dekglaasjes terug overgebracht naar 500 μL DMEM met 10% FBS, 2 uur geïncubeerd (bij 32 ° C in een 5% CO2 incubator) en getest met 3-(4,5-dimethyl-2-thiazolyl)-2,5-difenyl-2H-tetrazoliumbromide (MTT Sigma-Aldrich) met behulp van een standaard MTT-assay om het celaantal te bepalen. Het Ca-OMEM-supernatant werd verzameld, gecentrifugeerd om celmateriaal te verwijderen en bij 4 ° C bewaard totdat het werd getest op SEAP-productie. SEAP-productie werd getest door middel van de conversiekinetiek van para-nitrofenylfosfaat (pNPP Sigma-Aldrich 1 mg∙mL −1) naar para-nitrofenol (pNP) in 1 M diethanolaminebuffer (SeraCare pH 9,8) door absorptiemetingen van de plaatlezer bij 405 nm. Elk biologisch replicaat werd in drievoud getest, vergeleken met alkalische fosfatase (AP Roche)-standaarden om de absorptie bij 405 nm om te zetten in een SEAP-concentratie (mU∙mL -1 ), en vervolgens genormaliseerd naar het aantal cellen bepaald door de MTT-assay (mU SEAP per 106 cellen).

Statistieken

Alle statistieken werden berekend met behulp van GraphPad Prism 7-software. Gegevens werden eerst gecontroleerd op uitbijters met behulp van de robuuste regressie- en uitbijterverwijderingsmethode (ROUT) met een foutief ontdekkingspercentage ingesteld door Q = 1%. Na het verwijderen van uitbijters, werden alle gegevens getest op Gauss-verdeling en variantie met behulp van de D'Agostino-Pearson omnibus-normaliteitstest (N ≥ 8) of de Shapiro-Wilk normaliteitstest (N < 8). Voor vergelijkingen met één interactie werd de statistische significantie van normaal verdeelde gegevens berekend met behulp van eenrichtings-ANOVA met de meervoudige vergelijkingstest van Šídák, terwijl voor niet-normaal verdeelde gegevens de niet-parametrische test van Kruskal-Wallis met de meervoudige vergelijkingstest van Dunn werd gebruikt. Voor vergelijkingen van meerdere interacties werden tweeweg- of drieweg-ANOVA's met Tukey's meervoudige vergelijkingstest gebruikt om de significantie te berekenen voor zowel normaal als niet-normaal verdeelde gegevens. De statistische significantie voor alle meervoudige vergelijkingstests werd bepaald met behulp van een tweezijdige, familiegewijze significantie van 0,05 (95% betrouwbaarheidsinterval). Statistische analysemethode, gegevenspresentatie, totaal aantal monsters in elke groep (N), en P-waarden zijn zoals aangegeven op elke figuur en/of binnen elke figuurlegenda.

Ethische uitspraak

Alle methoden zijn uitgevoerd in overeenstemming met de relevante richtlijnen en voorschriften. Er waren geen dieren direct bij het onderzoek betrokken.


Achtergrond

Loiasis is een parasitaire ziekte veroorzaakt door de filarial nematode Loa loa die wordt overgedragen door de beet van een geïnfecteerde Chrysops vlieg. Loiasis is endemisch in de regenwouden van West- en Centraal-Afrika [1]. De algemene klinische symptomen van loiasis zijn de subconjunctivale migratie van de volwassen worm, voor het eerst gerapporteerd door Mongin in 1770 [2], Calabar Zwelling, pruritis, oedemen en artralgie. Interesse in deze filariale soort, die lange tijd als minder pathogeen werd beschouwd dan verwante soorten [3], kwam van verschillende rapporten in Kameroen die erop wezen dat hoge microfilariëmie van L. loa wordt geassocieerd met ernstige en soms fatale encefalopathische reacties bij patiënten die ivermectine hadden gebruikt voor de behandeling van onchocerciasis [4,5,6,7]. Loiasis is een verwaarloosde tropische ziekte (NTD) die slechts beperkte aandacht heeft gekregen in het onderzoek en de ontwikkeling van geneesmiddelen. Afgezien van chirurgische verwijdering van volwassen wormen die onder de huid of over het oog bewegen, wat kan worden gedaan om angst te verlichten, zijn er sinds de vorige eeuw slechts twee medicijnen gebruikt voor klinische gevallen, namelijk diethylcarbamazine (DEC) en albendazol. Dit laatste wordt soms gebruikt bij patiënten die niet genezen zijn met meerdere DEC-behandelingen. Verschillende gevallen van hersenontsteking, coma en overlijden zijn gemeld bij mensen met zware infecties die werden behandeld met DEC [8, 9]. Het risico op bijwerkingen heeft de inzet van massale toediening van geneesmiddelen van ivermectine beperkt in gebieden waar de L. loa de prevalentie is hoger dan 20% [10,11,12], wat de doelstellingen van het African Program for Onchocerciasis Control (APOC) in gebieden met co-endemiciteit in de weg staat. Vooruitgang in het onderzoek naar en de ontwikkeling van geneesmiddelen voor loiasis vereist geschikte screeningsystemen, zowel op in vitro en in vivo niveaus. Hoewel recentelijk innovaties in filariale diermodellen zijn bereikt [13, 14], in vitro onderhoudssystemen van de verschillende stadia van L. loa niet zijn vastgesteld. Het huidige onderzoek was gericht op het ontwerpen van geschikte in vitro kweeksystemen voor het screenen van geneesmiddelen tegen zowel infectieuze larven (L3) als microfilariae (mf) van L. loa.


Referenties

Ahmed NH (2014) Teelt van parasieten. Tropische parasitologie 4:80-89

Ali SA, Iqbal J, Ahmad B, Masoom M (1998) Een semisynthetisch foetaal kalfsserumvrij vloeibaar medium voor in vitro kweek van Leishmania promastigoten. The American Journal of Tropical Medicine and Hygiene 59:163-165

Barker RDJ (1999) Biotechnologie: een laboratoriumcursus (2e druk) door Becker JM, Caldwell GA en Zachgo EA. blz. 261. Academic Press, San Diego, 1996.

El-Bahy MM, Khalifa MM, Méabed EM (2018) Toxoplasma gondii: langdurig in vitro onderhoud van virulente tachyzoïeten in vloeibare media bij lage temperaturen. Alexandria Journal of Medicine 54:511-515

Fakhar M, Habibi P, Motazedian M (2006) Evaluatie van hydatidcystevloeistof als vervanging voor foetaal runderserum (FRS) in kweek van leishmania major. Zahedan Journal of Research in Medical Sciences 8:47-52

Faridnia R, Kalani H, Fakhar M, Akhtari J (2018) Onderzoek naar in vitro anti-leishmanial effecten van silibinine en silymarine op Leishmania major. Annalen van parasitologie 64:29-35

Feizi S, Soheili ZS, Bagheri A, Balagholi S, Mohammadian A, Rezaei-Kanavi M, Ahmadieh H, Samiei S, Negahban K (2014) Effect van vruchtwater op de in vitro kweek van menselijke cornea-endotheelcellen. Experimenteel oogonderzoek 122:132-140

Helgason CD, Miller CL (2005) Basisprotocollen voor celcultuur. Totowa, NJ: Humana Press.

Hui L, Bianchi D (2011) Celvrije foetale nucleïnezuren in vruchtwater. Menselijke reproductie-update 17:362-371

Jochems CE, Van Der Valk JB, Stafleu FR, Baumans V (2002) Het gebruik van foetaal runderserum: ethisch of wetenschappelijk probleem? Alternatieven voor proefdieren 30:219–227

Kalani H et al (2016a) Vergelijking van acht celvrije media voor het onderhoud van Toxoplasma gondii-tachyzoïeten. Iraans tijdschrift voor parasitologie 11:104-109

Kalani H, Shahreza HK, Daryani A, Yousefi HA, Pestechian N, Mansouri V (2016b) Het genexpressieniveau van IFN-γR1 en IFN-γR2 in een muizenmodel behandeld met Toxoplasma gondii en zijn producten. Gastro-enterologie en hepatologie van bed tot bank 9:124-131

Kamath-Rayne BD, Smith HC, Muglia LJ, Morrow AL (2014) Vruchtwater: het gebruik van hoogdimensionale biologie om het welzijn van de foetus te begrijpen. Reproductieve wetenschappen 21:6-19

Limoncu M, Özbilgin A, Balcioḡlu İ, Özbel Y (2004) Evaluatie van drie nieuwe kweekmedia voor de teelt en isolatie van Leishmania-parasieten. Journal of Basic Microbiology: een internationaal tijdschrift over biochemie, fysiologie, genetica, morfologie en ecologie van micro-organismen 44: 197-202

Muniraj M, Lal C, Kumar S, Sinha P, Das P (2007) Melk van koe (Bos taurus), buffel (Bubalus bubalis) en geit (Capra hircus): een beter alternatief dan foetaal runderserum in media voor primaire isolatie , in vitro kweken en onderhoud van Leishmania donovani promastigoten. Tijdschrift voor klinische microbiologie 45:1353-1356

Newman C (2003) Serumvrije celcultuur Biomedische wetenschapper 47:941-943

Sandle T (2014) Beoordeling van kweekmedia in farmaceutische microbiologie American Pharmaceutical Review [En línea] Beschikbaar op: http://www americanpharmaceuticalreview com/Featured-Articles/163589-Assessmentof-Culture-Media-in-Pharmaceutical-Microbiology/Recopilado 15 :2017

Tong XL, Wang L, Gao TB, Qin YG, Qi YQ, Xu YP (2009) Potentiële functie van vruchtwater in de ontwikkeling van de foetus - nieuwe inzichten door de samenstelling van menselijk vruchtwater te vergelijken met navelstreng en moederserum tijdens de midden- en late zwangerschap . Tijdschrift van de Chinese Medische Vereniging 72:368-373

Visvesvara GS, Garcia LS (2002) Cultuur van protozoaire parasieten. Klinische microbiologische beoordelingen 15:327-328

Walker DM, Oghumu S, Gupta G, McGwire BS, Drew ME, Satoskar AR (2014) Mechanismen van cellulaire invasie door intracellulaire parasieten. Cellulaire en moleculaire levenswetenschappen 71:1245-1263


Materialen en methodes

Cel cultuur.

CCE WT embryonale stamcellen, gekweekt in monolaagcultuur, werden in DMEM gehouden, aangevuld met 10'00025 FCS, 2 mM glutamine, 1 mM MEM niet-essentiële aminozuren (Life Technologies, Grand Island, NY), 10 mM pyruvaat, 0,0008'00025 2-mercapto-ethanol, 1.000 eenheden/ml penicilline en 1.000 μg/ml streptomycine. Vier dagen voor toevoeging van het radiolabel werden cellen getrypsiniseerd en gezaaid met een dichtheid van ongeveer 5 - 104 cellen - schaal van 60 mm met of zonder 1.000 eenheden LIF (Life Technologies). Elke 24 uur werd er nieuwe LIF aan de “+LIF” culturen toegevoegd.

Na 96 uur werd het medium verwijderd en 2 ml radioactief labelend medium, bestaande uit aangevuld DME plus 5% FCS en 50 nM [ 3H]retinol (specifieke activiteit, 35,2 㯌i/nmol 1Ci = 37 GBq) of 100 nM [ 3H]retinol en 900 nM niet-gelabeld retinol (totale retinolconcentratie van 1 μM) werden toegevoegd. Een controle van labelingsmedium zonder cellen was ook inbegrepen. Cel- en mediamonsters (0,5 ml) werden op verschillende tijdstippen geoogst zoals beschreven (16). Alle monsters werden bij �ଌ ingevroren tot extractie, en alle retinoïde manipulaties werden uitgevoerd onder gedempt licht. Het aantal cellen voor elke behandeling werd tijdens de incubatieperiode bepaald uit duplicaatschalen.

Voor de fotodiode-array-experimenten om de endogene retinoïden in de cellen te onderzoeken, werden CCE WT-cellen uitgeplaat met een dichtheid van 1 × 106 cellen𯅐-mm schaaltje in aangevuld medium met of zonder 1.000 eenheden/ml LIF. Vierentwintig uur later werd vers medium aan alle platen toegevoegd. LIF werd gedurende de volgende 72 uur elke 24 uur aan de juiste platen toegevoegd. Na 96 uur werd het medium verwisseld en werden de cellen gedurende 16 uur geïncubeerd met aangevuld DME, dat 5'0025 FCS en 1'00bcM niet-gelabeld retinol bevatte.

Retinoïde-extractie en HPLC-analyse.

Retinoïden werden geëxtraheerd met de eerder beschreven methode (16, 24). Retinoïden werden gescheiden met behulp van een Waters Millennium System. De monsters (100 °x003bcl) werden geladen op een analytische omgekeerde fase C-18-kolom van 5 °C-18 (Vydac, Hesperia, CA) met een stroomsnelheid van 1,5 ml fmin. De retinoïden werden gescheiden door gebruik te maken van een gradiënt van 100'00025 15 mM ammoniumacetaat in water, pH 6,5, tot 100'00025 acetonitril gedurende 60 minuten. De elutie van de niet-gelabelde retinoïdestandaarden die in de monsters waren opgenomen, werd gevolgd bij 340 nm, en een Packard A-500 radiochromatografiedetector werd gebruikt om radioactief gemerkte retinoïden te detecteren. De identiteit van de retinoïden werd bepaald door co-elutie van de radioactief gelabelde monsters met de bekende retinoïdestandaarden die in de monsters waren opgenomen en UV-absorptiespectravergelijking van niet-radioactief gelabelde monsters, geanalyseerd via PDA, met bekende standaarden. Om het retinolmetabolisme kwantitatief te beoordelen, werd elke piek (retinol) of groep van pieken (polaire metabolieten) geïntegreerd en werd de totale retinoïdeconcentratie berekend zoals beschreven (16).

Diazomethaanbehandeling van geëxtraheerde mediummonsters.

Een mediummonster van CCE ES-cellen, 96 uur gekweekt zonder LIF en 16 uur gekweekt in aanwezigheid van 50 nM [ 3H]retinol zoals hierboven beschreven, werd gemengd met een standaard van niet-radioactief 4-oxoRA in een concentratie van 40 μM. Dit monster werd vervolgens verdeeld en diazomethaan (10 μl) werd toegevoegd aan de helft van het monster (250 μl) totdat het monster geel werd. De andere helft van het monster werd onbehandeld gelaten. Beide monsters werden vervolgens geanalyseerd met HPLC.

Klonering van het volledige CYP26-cDNA.

Expressed Sequence Tag (EST)-klonen die gedeeltelijk coderen voor het enzym CYP26 (25) werden gebruikt om een ​​cDNA-bibliotheek te screenen die is bereid uit mRNA dat is geïsoleerd uit muizen-F9-cellen die zijn gekweekt met RA, cAMP en theofylline en geligeerd in een λgt10-vector (26) . Een kloon die alle behalve de eerste 24 basen van het 5'02032 meest segment van het cDNA dat codeert voor CYP26 (RA-hydroxylase) bevatte, werd verkregen uit de bibliotheek en gesubkloneerd in pBluescript. De cDNA-kloon van volledige lengte werd gesynthetiseerd met behulp van PCR om het resterende 5′ deel van het cDNA te hechten. De stroomopwaartse primer was 5′-AAAAAAGGATCCGAATTCATGGGGCTCCCGGCGCTGCTGGCCAGTGCGCTCTGCACCTTCGTGCTGCCGCTGCTG (EcoRI en BamHI-plaatsen gevolgd door nucleotiden 1�). De stroomafwaartse primer was GCTCGCCGCAGCTTAGCCACTGCTCCA (inverse complement aan nucleotiden 491�). Tien nanogram plasmide dat de onvolledige kloon van CYP26 in pBluescript bevat, werd geïncubeerd met 1 μg/μl stroomopwaartse primer, 0,5 μg/μl stroomafwaartse primer, NTP's en 2,5 eenheden Amplitaq DNA-polymerase in 1& #x000d7 reactiebuffer. Het reactieproduct van ongeveer 500 bp werd geïsoleerd en geligeerd in de BamHI-plaats van de vector en de interne BlpI-plaats in CYP26 en de DNA-sequentie ervan werd bevestigd (27).

RNA-isolatie en Northern Blot-analyse.

Totaal RNA werd geïsoleerd uit cellen die waren gekweekt met en zonder LIF zoals hierboven beschreven. Na 96 uur werd het kweekmedium verwijderd en werd aangevuld medium, dat 5'0025 FBS en 50 nM of 1'00bcM retinol bevatte, toegevoegd. Na 16 uur werden cellen geoogst en werd het RNA geïsoleerd met behulp van RNA Stat-60 (Tel-Test, Friendswood, TX). Extra cellen werden geïncubeerd met aangevuld medium, dat 5'00025 FBS en 50 nM of 1'cM retinol en 2''cg'0002fml actinomycine D bevatte, gedurende 4 of 8 uur vóór de celoogst. RNA werd geëlektroforeerd door 1,2''agarose'x0002f2,2 M formamidegels, overgebracht naar nylonfilters en aan de filters verknoopt met een UV-Stratalinker (Stratagene). De cDNA-probes werden gelabeld via de willekeurige primermethode (Boehringer Mannheim) met [α-32 P巜TP. De gebruikte CYP26-probe werd geïsoleerd uit de hierboven beschreven screening van de cDNA-bibliotheek. De cDNA's die coderen voor muisfibroblastgroeifactor 4 (FGF-4) en FGF-5 werden verkregen van Gail Martin (28) en muis-GAPDH-cDNA werd verkregen van Ambion (Austin, TX).

Blots werden voorgehybridiseerd en overnacht gehybridiseerd bij 42ଌ in 50% (wt/vol) gedeïoniseerd formamide˰.2% BSA˰.2% polyvinylpyrrolidon˲% Ficoll (moleculair gewicht 400.000 g) #x0002f50 mM Tris⋅HCl, pH 7,5˰.1% natriumpyrofosfaat˱% SDS⼐% dextransulfaat𯄀 μg/ml zalmsperma DNA. Na hybridisatie werden de blots eenmaal gewassen bij 42 °C met 2´x000d7 SSC´x0002f0.1´x00025 SDS´x0002f0.8´x00025 natriumpyrofosfaat gedurende 15 min en bij 42´´C en 65´´C gedurende 20 min met 2´000d7 SSC˱% SDS. De laatste wassing werd uitgevoerd bij kamertemperatuur gedurende 15 minuten in 0,5''SCC. Alle autoradiogrammen werden gekwantificeerd met behulp van een PhosphorImager (Molecular Dynamics).

Voorbijgaande transfectie van CYP26 in COS-cellen.

Het CYP26-cDNA van volledige lengte werd vervolgens gesubkloneerd in de EcoRI-plaats van pSG5 voor expressie in COS-cellen. Een dag voor transfectie werden 2 x 106 COS-cellen uitgeplaat per schaal van 100 mm. On the day of transfection, 20 μg of pSG5 containing CYP26 was added to 1.9 ml of PBS. pSG5 lacking an insert (20 μg) was added to another 1.9 ml as a control. DEAE-dextran solution (100 μl of a 10-mg/ml stock) was added to the tubes, COS cells were rinsed with PBS, and the DNA was added to each plate. After a 30-min incubation at 37ଌ, medium containing 80 μM chloroquine was added to the cells for 2.5 h. New medium containing 10% DMSO then was added for 2.5 min at room temperature (29). This medium was removed and the cells were incubated with 50 nM [ 3 H]retinol for 1� h. The media and cell samples were processed for HPLC analysis as described above.


Voorkeuren

Institute of Pharmacology, Pharmacy and Toxicology, University of Leipzig, An den Tierkliniken 15, Leipzig, 04103, Germany

Jana Franke, Vanessa Abs & Getu Abraham

Division of Veterinary Pharmacology and Toxicology, Department of Veterinary Public Health, Faculty of Veterinary Medicine, University of Bari, Strada Prov.le per Casamassima, km 3, Valenzano, BA, 70010, Italy

U kunt deze auteur ook zoeken in PubMed Google Scholar

U kunt deze auteur ook zoeken in PubMed Google Scholar

U kunt deze auteur ook zoeken in PubMed Google Scholar

U kunt deze auteur ook zoeken in PubMed Google Scholar

Corresponding author


Bekijk de video: 1 FPS vs. 10 FPS vs. 30 FPS vs. 144 FPS vs. 999 FPS - FORTNITE (December 2021).