Informatie

Hoe beïnvloedt de grootte van de insert de snelheid van homologe recombinatie in gist?


Wanneer genetische knock-outs in gist worden uitgevoerd met behulp van homologe recombinatie om een ​​doelgensequentie te vervangen via een vector-DNA, moet het gebied tussen de flankerende gebieden in de vector dan dezelfde lengte hebben als de plaats van recombinatie in het gen van de gastheercel?


Zoals aangegeven door aandreev, hoe groter de grootte van het inzetstuk ten opzichte van de flanken, hoe lager de recombinatiesnelheid. Dit komt omdat het donor-DNA in wezen niet-homoloog wordt. Zie onderstaande figuren:

Figuur 1: effect van de grootte van de wisselplaat op de recombinatie-efficiëntie. Kung et al. (2013) Appl Environ Microbiol. maart;79(5):1712-7

Figuur 2: effect van flankgrootte op recombinatie-efficiëntie. Kung et al. (2013) Appl Environ Microbiol. maart;79(5):1712-7

U zei echter dat u gen-knockouts wilt maken. In dit geval hoeft u slechts een kleine mutatie aan te brengen (bijvoorbeeld het inbrengen van een voortijdig stopcodon).

Het gebruik van genome editing tools zoals Crispr-Cas, ZFN en TALEN verhogen de snelheid van transgenese door de introductie van dubbelstrengs DNA-breuk.

Deze kunnen ook worden gebruikt voor het maken van knock-outs wanneer NHEJ over HR domineert als het DNA-reparatiemechanisme. NHEJ is foutgevoelig en kan indels veroorzaken die de genfunctie kunnen verstoren.


Naar mijn mening is er een direct verband tussen de kans op recombinatie en de grootte van de insert. Kleinere inzetstukken met grotere flanken worden gemakkelijker opgenomen. Dat begrijp ik uit het beoordelen van onderzoeken op basis van het Cas9/CRISPR-systeem. Hetzelfde zou moeten staan ​​voor HR-mutagenese in gist.

Het korte antwoord is dus: kortere inserts zijn efficiënter. Ik kon echter geen onderzoek vinden naar de relatie tussen recombinatie-efficiëntie en het gebruik van kleinere inserts dan target, of een relatie tussen de grootte van target en insert. Cas9 / CRISPR-systeem werd gebruikt om de loxP-site (34nt) in te voegen in plaats van ~ 10 bp in ES-cellen van muizen. Mensen proberen meestal GFP of iets dergelijks in te voegen in plaats van kortere genomische sequenties.


Agrarische en gerelateerde biotechnologie

4.32.2.4 Steigers met behulp van gekoppelde BAC-eindvolgorde

BAC-eindsequenties worden gegenereerd door single-pass sequencing van BAC-klonen van beide uiteinden. Hoewel single-pass sequencing korte uitlezingen van 600-800 bp kan genereren met behulp van Sanger-sequencing, is de steigercapaciteit van dergelijke uitlezingen groot omdat de grootte van BAC-kloon-inserts groot is, meestal meer dan 150 kb. De twee uitlezingen van de uiteinden van het BAC-insert van elke BAC-kloon zijn verbonden met een fysieke scheiding van het BAC-insert. Contigs van genoomsequenties kunnen tot steigers worden geassembleerd met behulp van partner-gepaarde BAC-eindsequenties. Zoals geïllustreerd in Fig. 1 kunnen, als de eindsequenties van dezelfde BAC-kloon in twee contigs vallen, deze twee contigs in de enkele scaffold worden gebracht.

Figuur 1 . Steigers met behulp van gepaarde BAC-eindsequenties.

Er zijn op BAC gebaseerde fysieke kaarten gemaakt voor een aantal aquacultuursoorten, waaronder meervallen. Van de BAC's die zijn gebruikt voor de constructie van fysieke kaarten van meervallen, zijn meer dan 61 Mb BAC-eindsequenties gegenereerd met behulp van Sanger-sequencing (6% van het meervalgenoom) met 103.000 BAC-eindsequenties van de twee meerval-BAC-bibliotheken ( Liu et al., 2009 Xu et al., 2006 ongepubliceerde gegevens). De totale BAC-eindsequenties vertegenwoordigen gemiddeld één sequentietag per 9,7 kb van het meervalgenoom. De meerderheid van de BAC-eindsequenties (88.000 sequenties van 44.000 BAC-klonen) waren gepaarde paren en waren dus zeer nuttig voor het assisteren bij de steiger van de gehele genoomassemblage.


Invoering

Recombinante DNA-technieken zijn onmisbaar in elk modern laboratorium dat vertrouwt op moleculair-biologische methoden. Traditioneel is moleculaire klonering afhankelijk van restrictie-endonucleasen om lineaire vectoren en inserts te produceren die worden gefuseerd door het DNA-ligase [1]. Recombinant-DNA-technologie is ook enorm vergemakkelijkt door het gebruik van Polymerase Chain Reaction (PCR). Een standaard DNA-kloneringspraktijk is het amplificeren van een van belang zijnd DNA met oligonucleotiden die 5'-staarten bevatten die endonucleaseherkenningsplaatsen specificeren. Deze maken daaropvolgende splitsing en insertie van PCR-fragmenten in elke gewenste kloneringsvector mogelijk. Ondanks de universaliteit van deze traditionele kloneringsbenaderingen, omvat de bereiding van reactantmoleculen met restrictie-enzymen en hun combinatie door DNA-ligase vele stappen, die niet alleen arbeidsintensief zijn, maar vaak ook magere of frustrerende resultaten opleveren. Om dergelijke beperkingen te overwinnen, hebben verschillende op PCR gebaseerde kloneringsprotocollen voorgesteld om het gebruik van DNA-ligase over te slaan en ook de noodzaak voor restrictie-endonucleasen [1] af te schaffen. Onder hen maken op homologie gebaseerde methoden gebruik van PCR-producten die aan beide zijden worden geflankeerd door 15 tot 60 bp lange sequenties die perfect overeenkomen met de uiteinden van een lineaire vector [1]. Dit wordt vergemakkelijkt door PCR-amplificatie van fragmenten met oligonucleotiden die 5'-aanhangsels bevatten die homoloog zijn aan het kloneringsplasmide. Na fragmentbereiding kan de kloneringsreactie worden aangestuurd in vitro door enzymatisch ondersteunde recombinatie tussen de vector en de PCR-inserts (bijv. SLiCE [2] en Gateway [3] methoden). Als alternatief kunnen de PCR-fragmenten en het lineaire plasmide enzymatisch worden behandeld om enkelstrengs DNA (ssDNA) op hun uiteinden te genereren (bijv. SLIC [4] en USER [5] methoden). De resulterende overhangende vector en insertie zijn complementair en hybridiseren in een dubbelstrengs DNA (dsDNA) formatie die een inkeping bevat. Tijdens transformatie in E. coli, de nick is gerepareerd in vivo, het verzegelen van een perfect circulair recombinant plasmide. Andere op homologie gebaseerde kloneringsprocedures zijn afhankelijk van een typische PCR-instelling waarin de primers zijn weggelaten (bijv. OEC [6] en CPEC [7]-methoden). Na de warmtedenaturatiestap kunnen overlappende vrije uiteinden van vector- en PCR-fragmenten versmelten door complementariteit van basenparen. De hybride regio's dienen dan als "megaprimers" in de verlengingsstap gekatalyseerd door het DNA-polymerase. Als resultaat wordt een geknikt recombinant plasmide gegenereerd dat wordt gerepareerd in vivo in E. coli. Naast deze recente innovaties, is traditionele gap-repair in gist een van de meest effectieve op homologie gebaseerde kloonbenaderingen [8,9]. Deze procedure bestaat uit het louter co-transformeren van gistcellen met een mengsel van de lineaire vector en PCR-fragmenten, die beide gemeenschappelijke flankerende sequenties hebben. Na transformatie is de gist-DNA-reparatiemachine zeer effectief om vector te recombineren en homologe uiteinden in te voegen, waardoor een gesloten plasmide wordt gegenereerd.

Interessant, een analoge in vivo gap-repair kloonmethode in E. coli werd al in 1993 door twee groepen beschreven [10,11]. Het principe van deze kloonbenadering E. coli is net zo eenvoudig als in gist. Door co-transformatie van een lineaire vector en PCR-fragmenten die homologe uiteinden bevatten, kunnen verschillende E. coli laboratoriumstammen zijn in staat om de reactanten te recombineren in vivo, waardoor een gesloten propagatief plasmide wordt gegenereerd. Hoewel deze techniek eenvoudiger is dan traditioneel ligase-afhankelijk klonen, zijn er slechts enkele gepubliceerde rapporten die gap-repair klonen gebruiken in E. coli bestaan ​​[12-17]. Sommige studies werken dit kloneringsprincipe uit in hyperrecombinogene E. coli stammen waarin de RecE- en RecT-homologe recombinatieroute tot overexpressie wordt gebracht (de ET-kloneringsmethode) [12]. Een paar andere gepubliceerde rapporten stellen specifieke toepassingen voor voor gap-repair klonen in E. coli. Homologe recombinatie werd bijvoorbeeld met succes gebruikt voor het klonen met hoge doorvoer van 1302 ORF's geamplificeerd uit de Campylobacter jejuni genoom [13]. De strategie was om PCR-fragmenten te leveren met flanken van 21 bp die identiek zijn aan de uiteinden van een kloneringsvector die is bereid met restrictie-enzymen. Evenzo, Klok et al. beschreef de gap-repair-klonering van 448 volledige en 2143 afgeknotte ORF's uit 30 verschillende bacteriële bronnen [14]. In dit geval werden echter zowel de vector als de ORF's geamplificeerd door middel van PCR. De auteurs stelden voor dat een ander mechanisme dan in vivo homologe recombinatie verklaarde de verkregen resultaten. Er werd gesuggereerd dat bij normale PCR-reacties een groot deel van de geamplificeerde fragmenten ssDNA-uitrekkingen hebben op beide uiteinden als gevolg van onvolledige primerverlenging tijdens de PCR-verlengingsstap (daarom werd de methode PIPE genoemd, Polymerase Incomplete Primer Extension) [14]. Na mengsel, vector en insert complementaire ssDNA-regio's annealen en een enkel recombinant DNA-molecuul wordt verzegeld in vivo volgende transformatie in E. coli. De werkzaamheid van gap-repair klonen via het PIPE-protocol is onlangs bevestigd in een onderzoek waarin deze procedure werd vergeleken met de SLIC- en OEC-technieken [15]. De FastCloning-methode is een andere door recombinatie gemedieerde benadering die sterk lijkt op het PIPE-protocol [16]. Het beschrijft een snelle en efficiënte manier om PCR-fragmenten te kloneren die flankerende gebieden van 16 bp bevatten die de uiteinden van een lineaire kloneringsvector overlappen. Zowel fragmenten als vectoren worden eerst verkregen door PCR. Een mengsel van vector en insert wordt vervolgens behandeld met DpnI om de achtergrond van de templateplasmiden te elimineren en vervolgens gemakkelijk getransformeerd in E. coli om de gewenste klonen te verkrijgen. In overeenstemming met de PIPE-beschrijving speculeren de auteurs van het FastCloning-protocol dat het kloneringsmechanisme afhankelijk is van vector en inserts met complementaire ssDNA-overhangen die toevallig worden gegenereerd door de DNA-polymerase 3'- tot 5'-exonuclease-activiteit [16].

De hierboven beschreven voorbeelden illustreren dat recombinatie klonen in E. coli is een zeer efficiënte techniek die opmerkelijke voordelen biedt ten opzichte van conventioneel klonen met restrictie-endonucleasen en DNA-ligase. Het is echter een raadsel dat dit principe van moleculaire klonering tot dusver is genegeerd door een grotere gemeenschap van moleculair biologen. Niet alleen is het aantal publicaties dat melding maakt van het gebruik van gap-repair in E. coli heel weinig, maar de interpretatie van het kloonmechanisme zelf was tegenstrijdig [10,11,14,16]. In een poging om die verschillende rapporten te verenigen en recombinatie klonen populair te maken in E. coli als praktische methode presenteren we hier een studie van de verschillende parameters die de efficiëntie van deze techniek moduleren. We leveren ook bewijs dat de aanname verwerpt dat complementaire ssDNA-kanalen, zogenaamd gegenereerd op de vector en inserts door DNA-polymerase onvolledige primerverlenging [14] of exonuclease-activiteit [16], van cruciaal belang zijn voor gap-repair-klonering in E. coli. Ten slotte, om het idee te ondersteunen dat recombinatieklonen in E. coli de voorkeursmethode zou kunnen zijn voor het assembleren van enkele en dubbele PCR-fragmenten in een plasmide, hebben we de kloneringsparameters geoptimaliseerd om 94% efficiëntie te verkrijgen tijdens de constructie van vijf verschillende recombinante DNA's.


Referenties

Lee, S.E. et al. Saccharomyces Ku70-, Mre11/Rad50- en RPA-eiwitten reguleren de aanpassing aan G2/M-stop DNA-schade. Cel 94, 399–409 (1998)

Toczyski, D.P., Galgoczy, D.J. & Hartwell, L.H. CDC5 en CKII regelen de aanpassing aan het controlepunt voor gist-DNA-schade. Cel 90, 1097–1106 (1997)

Pellicioli, A., Lee, S.E., Lucca, C., Foiani, M. & Haber, J.E. Regulering van Saccharomyces Rad53 checkpoint kinase tijdens aanpassing van G2/M arrestatie. Mol. Cel 7, 293–300 (2001)

Sugawara, N., Wang, X. & Haber, J.E. In vivo rollen van Rad52-, Rad54- en Rad55-eiwitten in door Rad51 gemedieerde recombinatie. Mol. Cel 12, 209–219 (2003)

Vaze, M.B. et al. Herstel van checkpoint-gemedieerde arrestatie na reparatie van een dubbelstrengige breuk vereist Srs2-helicase. Mol. Cel 10, 373–385 (2002)

Wang, X. & Haber, J.E. Rol van Saccharomyces enkelstrengs DNA-bindend eiwit RPA in de strenginvasiestap van dubbelstrengs breukherstel. PLoS Biol. 2, 104–111 (2004)

Bishop, A.C. et al. Een chemische schakelaar voor remmergevoelige allelen van een proteïnekinase. Natuur 407, 395–401 (2000)

Ubersax, J.A. et al. Doelen van het cycline-afhankelijke kinase Cdk1. Natuur 425, 859–864 (2003)

Zou, L. & Elledge, S. J. DNA-schade detecteren door ATRIP-herkenning van RPA-ssDNA-complexen. Wetenschap 300, 1542–1548 (2003)

Nasmyth, K. In het hart van de ontluikende gistcelcyclus. Trends Genet. 12, 405–412 (1996)

Pellicioli, A. et al. Activering van Rad53-kinase als reactie op DNA-schade en het effect ervan bij het moduleren van fosforylering van het achterblijvende DNA-polymerase. EMBO J. 18, 6561–6572 (1999)

Naiki, T., Wakayama, T., Nakada, D., Matsumoto, K. & Sugimoto, K. Associatie van Rad9 met dubbelstrengige breuken door een Mec1-afhankelijk mechanisme. Mol. Cel. Biol. 24, 3277–3285 (2004)

Diede, S. J. & Gottschling, D. E. Exonuclease-activiteit is vereist voor sequentietoevoeging en Cdc13p-lading bij een de novo telomeer. Curr. Biol. 11, 1336–1340 (2001)

Caspari, T., Murray, J. M. & Carr, A. M. Cdc2-cycline B-kinase-activiteit verbindt Crb2 en Rqh1-topoisomerase III. Genen Dev. 16, 1195–1208 (2002)

Grenon, M., Gilbert, C. & Lowndes, N.F. Checkpoint-activering als reactie op dubbelstrengige breuken vereist het Mre11/Rad50/Xrs2-complex. Natuur Cel Biol. 3, 844–847 (2001)

D'Amours, D. & Jackson, S. P. Het gist Xrs2-complex functioneert in S-fasecontrolepuntregulatie. Genen Dev. 15, 2238–2249 (2001)

Moore, J.K. & Haber, J.E. Celcyclus en genetische vereisten van twee routes van niet-homologe end-joining reparatie van dubbelstrengs breuken in Saccharomyces cerevisiae. Mol. Cel. Biol. 16, 2164–2173 (1996)

Frank-Vaillant, M. & Marcand, S. Transiënte stabiliteit van DNA-uiteinden zorgt ervoor dat niet-homologe eindverbinding aan homologe recombinatie voorafgaat. Mol. Cel 10, 1189–1199 (2002)

Karathanasis, E. & Wilson, T.E. Verbetering van Saccharomyces cerevisiae end-join efficiëntie door celgroeistadium maar niet door verslechtering van recombinatie. Genetica 161, 1015–1027 (2002)

Liberi, G. et al. Srs2 DNA-helicase is betrokken bij checkpoint-respons en de regulatie ervan vereist een functionele Mec1-afhankelijke route en Cdk1-activiteit. EMBO J. 19, 5027–5038 (2000)

Sogo, J. M., Lopes, M. & Foiani, M. Fork-omkering en ssDNA-accumulatie bij vastgelopen replicatievorken als gevolg van checkpoint-defecten. Wetenschap 297, 599–602 (2002)

Foiani, M., Liberi, G., Lucchini, G. & Plevani, P. Celcyclus-afhankelijke fosforylering en defosforylering van de gist-DNA-polymerase α-primase B-subeenheid. Mol. Cel. Biol. 15, 883–891 (1995)

Lisby, M., Mortensen, U.H. & Rothstein, R. Colocalisatie van meerdere dubbelstrengige DNA-breuken in een enkel Rad52-reparatiecentrum. Natuur Cel Biol. 5, 572–577 (2003)

Rothkamm, K., Kruger, I., Thompson, L.H. & Lobrich, M. Pathways of DNA dubbelstrengs breukherstel tijdens de zoogdiercelcyclus. Mol. Cel. Biol. 23, 5706–5715 (2003)

Lee, J. & Desiderio, S. Cyclin A / CDK2 reguleert V (D) J-recombinatie door RAG-2-accumulatie en DNA-herstel te coördineren. Immuniteit 11, 771–781 (1999)

Toh, G.W. &. Lowndes, N.F. De rol van de Saccharomyces cerevisiae Rad9-eiwit in het detecteren en reageren op DNA-schade. Biochem. soc. Trans. 31, 242–246 (2003)

Masumoto, H., Muramatsu, S., Kamimura, Y. & Araki, H. S-Cdk-afhankelijke fosforylering van Sld2 essentieel voor chromosomale DNA-replicatie in ontluikende gist. Natuur 415, 651–655 (2002)

D'Amours, D. & Jackson, S. P. Het Mre11-complex: op het kruispunt van DNA-reparatie en controlepuntsignalering. Natuur Ds. Mol. Cel Biol. 3, 317–327 (2002)

Chen, L., Trujillo, K., Ramos, W., Sung, P. & Tomkinson, A.E. Promotie van Dnl4-gekatalyseerde DNA-eindverbinding door de Rad50/Mre11/Xrs2- en Hdf1/Hdf2-complexen. Mol. Cel 8, 1105–1115 (2001)


Materialen en methodes

Plasmiden en stammen

Alle plasmiden waren afgeleid van het L1.1-plasmide. Dit plasmide is een derivaat van het pt92-plasmide en bevat de (poly1) substitutie van de ARG4 promotorsequentie (� bp tot � bp) eerder beschreven door de Massy en Nicolas (1993). In dit onderzoek werden twee soorten grote inserts gebruikt: de MS (microsatelliet) insert,XbaIk ben 2013PstI fragment van de bacteriofaag M13mp19(CA/GT)39 met een reeks van 39 CA/GT-herhalingen (Dutreix 1997) de RS-insert, een willekeurige reeks die overeenkomt met de PvuII–PstI-fragment van het puc18-plasmide. MS- en RS-sequenties werden ingevoegd (buiten het frame) in de EcoRV (𫉢 door) site in de ARG4-coderingsgebied van L1.1. In de MS-constructies is de BstZ171 en LeeftijdI restrictieplaatsen werden gemodificeerd door insertie van 2 en 4 bp. de gewijzigde ARG4 regio's werden geïntroduceerd op de ARG4 locus op chromosoom VIII van de stammen ORD11-4B en ORD17-47C. Sequenties van de constructies werden gecontroleerd door PCR-amplificatie en sequencing met behulp van een ABI PRISM-systeem. Het poly(CA/GT)-kanaal was zodanig georiënteerd dat de poly(CA)-herhalingen zich op de getranscribeerde streng bevonden.

De S. cerevisiae stammen die in dit onderzoek zijn gebruikt, zijn afgeleid van de stammen ORD11-4B [Matα ARG4� ura3-52 trpl-28 leu2-3 ade2-10 dup KV(DED82-Arg(ΔHpaI)-YSC83] en ORD17-47C[MATeen ARG4� zijn3㥁 DED82::URA3 ORF83::TRP1 dupKV(DED82-ArgΔHpaI)-YSC83] (Lichten et al. 1990). Deze stammen zijn derivaten van de stam S288c (N. Schultes, niet gepubliceerd). DED82::URA3 en YSC83::TRP1 en komen overeen met een 1,5 kb EcoRI TRP1 fragment en een 1,2 kb hihidIII URA3 fragment ingevoegd in de DED82 BamHI-site en de YSC83 BglII-site, respectievelijk. Om tekortkomingen aan te vullen die zijn ontstaan ​​​​bij verstoring van de essentiële genen DED82 en YSC83, werd een fragment van 12 kb ingevoegd in ApaIk ben 2013Stuik van de URA3 gen op zijn normale chromosomale positie op chromosoom V. Deze insert, ontworpen bij dupKV (DED82-Arg(ΔHpaI)-YSC83), bevat een ApaIk ben 2013SnaBI-fragment van de ARG4 regio verwijderd van een fragment van 2 kb van � bp tot � bp dat de ARG4 gen (�). Alle stammen die in deze studie werden gebruikt, dragen de poly(I)-substitutie. De rad50sK181 mutatie werd geïntroduceerd in verschillende stammen door kruisingen met de stammen ORT329 (MATeen ARG4� ura3-52 trp1-289 ade2-101 zijn3㥁 rad50s::URA3) en ORT324 (Mat α ARG4� ura3-52 trp1-289 leu2-3 rad50s::URA3) (de Massy en Nicolas 1993).

Media, kweekomstandigheden en genetische analyse

Groei en sporulatie van gistcellen werden uitgevoerd met standaardmethoden (deMassy en Nicolas 1993). Cellen werden gekweekt in YPD-media. Voor sporulatie werden cellen bij 30°C in presporulatiemedia (SPS) gekweekt tot een concentratie van 2 ×� 7 tot 4 ×� 7 cellen/ml, gewassen in water en geïncubeerd bij dezelfde dichtheid in sporulatiemedium (1% kaliumacetaat aangevuld met de benodigde aminozuren) bij 30°C. De distributie en frequenties van meiotische recombinatie waarbij de markergenen betrokken zijn (URA3 en TRP1) en genconversiegebeurtenissen in de ARG4 gen werden bestudeerd door tetrad-analyse. De segregatie van ARG4, URA3, TRP1 en ten minste vier extra markeringen (LEU2, HIS3, ADE2, en het paringstype locus MAT) werden onderzocht. Alle tetrads die niet-Mendeliaanse segregatie vertonen voor URA3, TRP1, of ARG4 werden getest op alle markers, met behulp van grotere stukken cellen.

Analyse van de segregatie van de restrictie sites

De segregatie van de BstZ171 en LeeftijdI-sites werden bestudeerd door de polymerasekettingreactie met primers die complementair waren aan de posities ʸ bp en 𫜰 bp. DNA werd direct geamplificeerd uit kolonies die voortkwamen uit individuele sporen. De PCR-producten werden verteerd met de BstZ171 of LeeftijdI restrictie-enzymen en geanalyseerd door agarosegelelektroforese op 2% NuSieve GTG (FMS BioProducts, Rockland, Maine) agarosegels.

Analyse van de lengte van repetitieve  tracts

De lengtes van de sporen in de sporen werden bepaald door PCR-amplificatie direct op kolonies met primers die de herhaalde stukken flankeren (posities -<<<<<<<<<<<<<<<<<<< tot tot 198 bp tot +<0002b432 bp). De PCR-producten werden gelopen op 6'' denaturerende polyacrylamidegels met controle-DNA-monsters die poly(GT)-kanalen van 38 en 39 bp bevatten en overgebracht op een nylonmembraan (Amersham, N'0002b). Membranen werden 2 uur voorgehybridiseerd en 12 uur bij 42 °C gehybridiseerd met een 20-door poly(CA)-labelprobe. Probes werden gelabeld door 3′ end-labeling (terminal transferase Boehringer Mannheim) met 50 㯌i van [α-32 P巜TP, 3000 mCi/mmol voor 100 ng DNA-fragment. Niet-opgenomen nucleotiden werden gescheiden door filtratie op een ProbeQuant G-50 Micro-kolom (Amersham). De belichtingstijden waren van 20 tot 50 minuten.

Detectie van meiotische DSB's en  kwantificering

Cellen (200 ml) werden gekweekt in sporulatiemedium en op de juiste tijdstippen (0, 4, 8, 10 en 24 uur) werden porties van 25 ml gemengd met 25 ml ethanol (100'00025 bij �' x000b0C) en 1,25 ml 0,5 m EDTA en bewaard bij �ଌ. Chromosomaal DNA werd geëxtraheerd en 1,5 μg DNA werd verteerd door SnaBI-restrictie-enzym (5 U/μg DNA tweemaal gedurende 3 uur bij 37°C), gescheiden op een 1,2-agarosegel en onder vacuüm overgebracht (LKB 2016 VACUGENE Pharmacia) op een nylonmembraan (Amersham, Hybond N& #x0002b). Membranen werden 2 uur voorgehybridiseerd en 24 uur bij 65°C gehybridiseerd met de gelabelde probe (20 ng/ml). Probes werden gelabeld door willekeurige priming (Readyprime Kit Amersham) met [α-32 P巜TP, 3000 mCi/mmol, 110 TBq/mmol (Amersham). Niet-opgenomen nucleotiden werden gescheiden door filtratie op een ProbeQuant G-50 Micro-kolom. De probe die bij de hybridisatie werd gebruikt als het 707-bp PCR-product (primers complementair aan posities ʸ bp en 𫜕 bp) intern aan de ARG4- coderende regio. Kwantificering van DSB-signalen werd uitgevoerd zoals eerder beschreven (de Massy en Nicolas 1993) met behulp van een PhosphorImager (Molecular Dynamics, STORM 860) en het ImageQuant-programma.

Statistische analyse

Alle resultaten werden getest door statistische analyse. Fisher's exact-variant van de chikwadraattoets werd gebruikt voor de meeste vergelijkingen en a P waarde van π.05 werd als statistisch significant beschouwd.


Op homologie gerichte herstelpaden

HDR kan zowel niet-conservatief als conservatief optreden. De niet-conservatieve methode is samengesteld uit de single-strand annealing (SSA) route en is foutgevoeliger. conservatieve methoden, gekenmerkt door de nauwkeurige reparatie van de DSB door middel van een homologe donor (bijv. zusterchromatide, plasmide, enz.), zijn samengesteld uit drie routes: de klassieke dubbelstrengs breukreparatie (DSBR), synthese-afhankelijke streng-annealing ( SDSA) en door breuk veroorzaakte reparatie (BIR).

Klassieke dubbelstrengs breukreparatie (DSBR)

In de klassieke DSBR-route vallen de 3'-uiteinden een intact homoloog sjabloon binnen om als primer te dienen voor de synthese van DNA-reparatie, wat uiteindelijk leidt tot de vorming van dubbele Holliday-juncties (dHJ's). dHJ's zijn vertakte structuren met vier strengen die zich vormen wanneer verlenging van de invasieve streng "vangt" en DNA van het tweede DSB-uiteinde synthetiseert. De individuele HJ's worden op twee manieren opgelost via splitsing. Kijkend naar de linker tak van de onderstaande figuur, kan elke junctieresolutie plaatsvinden op de kruisende streng (horizontaal bij de paarse pijlen) of op de niet-kruisende streng (verticaal bij de oranje pijlen). Indien ongelijk opgelost (bijv. één knooppunt wordt opgelost op de kruisende streng en de andere op de niet-kruisende streng), zal echter een crossover-gebeurtenis optreden, als beide HJ's op dezelfde manier worden opgelost, resulteert dit in een niet-crossover-gebeurtenis. DSBR is semi-conservatief, aangezien crossover-gebeurtenissen het meest voorkomen. Deze animatie illustreert mooi het DSBR-pad.

Synthese-afhankelijke streng-annealing (SDSA) pad

Zoals geïllustreerd in de rechtertak van de bovenstaande figuur, is SDSA conservatief en resulteert het uitsluitend in niet-crossover-gebeurtenissen. Dit betekent dat alle nieuw gesynthetiseerde sequenties op hetzelfde molecuul aanwezig zijn. In tegenstelling tot DSBR, wordt na strenginvasie en D-lusvorming in SDSA het nieuw gesynthetiseerde deel van de invasieve streng verplaatst van de sjabloon en teruggevoerd naar het verwerkte uiteinde van de niet-invasieve streng aan het andere DSB-uiteinde. Het 3'-uiteinde van de niet-invasieve streng is langwerpig en geligeerd om de opening te vullen, waardoor SDSA wordt voltooid.

Break-geïnduceerde reparatie (BIR) route

BIR is niet zo goed gekarakteriseerd als DSBR of SDSA, maar een centraal kenmerk van deze route is de aanwezigheid van slechts één invasief uiteinde bij een DSB dat kan worden gebruikt voor reparatie. Deze enkele invasieve streng dringt een homologe sequentie binnen en initieert zowel leidende als achterblijvende strengsynthese, wat resulteert in de vorming van één HJ. Deze HJ wordt opgelost door splitsing van de gekruiste streng. Hoewel deze route mogelijk niet onmiddellijk toepasbaar is bij DSB-geïnduceerde gentargeting of relevant is voor op plasmiden gebaseerde genoomengineering, kan deze van biologisch belang zijn voor het herstel van chromosoomuiteinden die geen tweede uiteinde hebben dat DSBR of SDSA mogelijk zou maken.


Heeft de chromosoomgrootte invloed op de kaartafstand en genetische interferentie in ontluikende gist?

De hypothese dat de chromosoomgrootte de snelheid en distributie van meiotische cross-overs in ontluikende gist beïnvloedt, werd getest. Kaartafstand en interferentie werden gemeten in dezelfde genetische intervallen die aanwezig waren op respectievelijk kleine (340 en 508 kb) of grote (917 en 1085 kb) chromosomen. Er werden geen verschillen waargenomen.

TIJDENS de meiose creëren cross-overs tussen homologe chromosomen, in combinatie met zusterchromatide-cohesie, fysieke verbindingen die de nauwkeurige scheiding van chromosomen naar tegenovergestelde polen bij de eerste meiotische deling bevorderen (B ascom -S ontbreken et al. 1997 Petronczki et al. 2003). Genetische interferentie is een fenomeen waarbij een crossover in één interval de kans verkleint dat er in de buurt nog meer crossovers zullen plaatsvinden. De verdeling van cross-overs door interferentie is gepostuleerd om ervoor te zorgen dat elk paar homologen er minstens één ontvangt. De mate van interferentie en het aantal cross-overs per meiose varieert tussen organismen. Bij nematoden is de interferentie bijvoorbeeld sterk, zodat elk chromosoompaar slechts een enkele cross-over ondergaat (H illers en V illeneuve 2003). In splijtingsgist daarentegen is er geen interferentie, maar omdat er een groot aantal cross-overs is en slechts drie chromosomen, is de kans dat elk chromosoom een ​​cross-over krijgt groot (M unz 1994). In ontluikende gist zijn er ∼90 cross-overs per meiose (M ortimer et al. 1991). Er zijn 16 homologenparen en deze chromosomen variëren in grootte van 230 tot 1530 kb (Saccharomyces Genoomdatabase). Mutaties die interferentie opheffen, verhogen bij voorkeur de non-disjunctie van kleine chromosomen, in overeenstemming met het idee dat cross-overs worden gedistribueerd om ervoor te zorgen dat alle chromosomen er ten minste één ontvangen (Sym en Roeder 1994). Studies in de literatuur met behulp van gehalveerde en getransloceerde chromosomen suggereren dat de chromosoomgrootte belangrijk is bij het bepalen van de recombinatiesnelheid (in centimorganen per kilobase) en de mate van interferentie (K aback et al. 1992, 1999). We hebben geprobeerd deze hypothese te testen door de kaartafstand en interferentiewaarden te vergelijken die zijn verkregen uit dezelfde genetische intervallen die aanwezig zijn op kleine of grote chromosomen. In tegenstelling tot wat eerder is gemeld, zagen we geen effect van de chromosoomgrootte op een van deze parameters. We concluderen daarom dat verschillen in de snelheid van recombinatie en waargenomen interferentie tussen chromosomen in ontluikende gist, althans voor sommige intervallen, een functie zijn van hun DNA-sequentie in tegenstelling tot de grootte van het chromosoom.

Om een ​​directe vergelijking tussen dezelfde DNA-sequenties op chromosomen van verschillende grootte mogelijk te maken, werd ectopische recombinatie gebruikt om een ​​wederzijdse translocatie te maken die de rechterarm van chromosoom VII verwisselt voor de laatste ∼8 kb van de rechterarm van chromosoom III en vice versa, met behulp van de aanpak beschreven in B volgorde et al. (2000) (Figuur 1, A en B). Recombinatie tussen ade2 truncatie-allelen op chromosomen III en VII genereerden Ade+-cellen die werden gescreend door polymerasekettingreactie (PCR) en Southern-blot-analyse om de aanwezigheid van de translocatie te bevestigen (Figuur 1B). Drie intervallen op chromosomen III en VII werden vervolgens geanalyseerd op ofwel een kort chromosoom (respectievelijk 340 en 508 kb) of een lang chromosoom (respectievelijk 917 en 1085). De isogene diploïden, NH598 (die de natieve chromosomen bevat) en NH607 (die de translocatiechromosomen bevatten), werden gesporuleerd en ontleed. Meer dan 1000 tetrads werden geanalyseerd voor elke diploïde. De kaartafstand van elk interval werd niet beïnvloed door de verandering in chromosoomgrootte (tabel 1). Genconversie werd ook niet beïnvloed (gegevens niet getoond). Om interferentie te controleren, werd de verhouding berekend van waargenomen niet-ouderlijke ditypes (of NPD's, die voortkomen uit vierstrengige dubbele crossovers) tot die welke verwacht worden zonder interferentie. Een NPD-ratio van 1 geeft geen interferentie aan, terwijl een NPD-ratio van 0 volledige interferentie aangeeft (S nu 1979). Hoewel er verschillen in NPD-ratio werden waargenomen, zijn deze verschillen waarschijnlijk niet significant aangezien de standaarddeviaties van alle intervallen elkaar overlappen, met uitzondering van de LEU2-THR4 interval (waarbij ten minste 48 NPD's werden gescoord voor elke diploïde tabel 1). In de LEU2-THR4 interval is de NPD-ratio verhoogd in de translocatie-diploïde, in tegenstelling tot wat uit de literatuur werd verwacht. De voorspelling was dat het verplaatsen van dit interval van een klein chromosoom naar een groot chromosoom de hoeveelheid interferentie zou verhogen (d.w.z., verlaag de NPD-ratio).

Constructie van een wederzijdse translocatie tussen chromosoom III en VII door ectopische recombinatie. (A) overzicht van de translocatiestrategie op schaal getekend. Een cassette met een afknotting van het 3′-uiteinde van de ADE2 gen, URA3, en zijnG werd geïntegreerd op 680 bp van het centromeer op chromosoom VII. Een cassette met zijnG, URA3, en een 5′ afknotting van ADE2 werd geïntegreerd op 7,6 kb van de telomeer van de rechterarm van chromosoom III. Recombinatie tussen de twee afgeknotte ade2 allelen produceren Ade+-kolonies die twee wederzijdse translocatiechromosomen bevatten (B-orde et al. 2000). Massieve ovalen vertegenwoordigen centromeren, rechthoeken vertegenwoordigen ade2 cassettes geeft de gestippelde balk chromosoom VII-sequenties aan, terwijl de open balk chromosoom III vertegenwoordigt. (B) Uitgebreide weergave van de ade2 truncatiecassettes en hun recombinatieproducten (niet op schaal getekend). H, zijnG jij, URA3 gestippelde balk, de regio van ADE2 gedeeld tussen de twee truncatiecassettes geven de pijl en de asterisk de 3′ en 5′ uiteinden van de . aan ADE2 gen, respectievelijk. Om de stammen te maken, werd een fragment van 576 bp van chromosoom III (coördinaten 308386–308962 van de Saccharomyces Genoomdatabase, gelegen tussen PAU3 en ADH7) en een fragment van 583-bp van chromosoom VII (coördinaten 497716-498299, waarvan één uiteinde binnen YGR001c) werden geamplificeerd en gekloneerd in pVZ1. Site-directed mutagenese werd gebruikt om een sphoik en een XhoI-plaats in respectievelijk de III- en VII-sequenties. Een 4,9 kb sphoI-fragment van pMJ436 dat de bevat zijnG-URA3-ade2-5′Δ cassette is gekloond in de sphoI-site om pTS93 te genereren. Een 5,3 kb XhoI-fragment van pMJ437 dat de bevat ade2-3-URA3-hisG cassette is in de XhoIk plaats om pTS87 te maken. BamHOI/SacI-verteerd pTS93 en sphoL/SacI-verteerd pTS87 werden gebruikt om te transformeren MATeen en MATα derivaten van twee SK1-stammen van complementaire genotypen (G1 en G2) met behulp van URA3 als de selecteerbare markering. Om G1- en G2-stammen te genereren die beide truncatiecassettes bevatten, is de G1 VII:ade2-3′Δ haploïde werd gekruist met de G1 III::ade2-5haploïde. Het diploïde werd gesporuleerd en ontleed en Ura+-segreganten werden gescreend door middel van Southern-blot-analyse op de aanwezigheid van beide cassettes. De G2-stammen werden op dezelfde manier behandeld. G1- en G2-haploïden die beide dragen ade2 truncaties werden gekruist om de niet-translocatie diploïde, NH598, te creëren. Deze diploïde werd omgezet in Ade + door transformatie van an ADE2 fragment. Om de translocaties te genereren, werden G1- en G2-haploïden die beide cassettes droegen uitgeplaat op SD-ade-medium. Ade + kolonies ontstonden met een frequentie van 2-4 × 10 −7. De Ade+-kolonies werden gescreend op de VII-III-translocatie met behulp van gistkolonie-PCR (zie http:://www.fhcrc.org/labs/hahn/methods/mol_bio_meth/per_yeast_colony.html). De aanwezigheid van deze translocatie werd aangegeven door de vorming van een fragment van 706 bp wanneer de TL3- en TL4-primers werden gebruikt voor amplificatie en het gelijktijdige verlies van de fragmenten van 850 en 970 bp verkregen met behulp van de TL4/TL2- en TL1/TL3-primer combinaties resp. Primers worden aangegeven met pijlpunten. Primer sequences were TL1, 5′-TTCCGCCATACTGGAGGC-3′ TL2, 5′-ATGGATTCTAGAACAGTTGG-3′ TL3: 5′-ATACACACATAAGTAGGCAC-3′ TL4, 5′-CGGTTTCATTAAGATGTAAG-3′). A G1 translocation haploid was mated to a G2 translocation haploid to make the diploid NH607. Strain genotypes are as follows:

(C) Southern blot confirming the formation of the translocation chromosomes. NH598 and NH607 were grown to stationary phase in YEPD and cell plugs were made as described in B orde et al. (1999). The chromosomes were fractionated on a contour-clamped homogeneous electric field gel, transferred to a nylon membrane and probed with either the chromosome III or the chromosome VII amplified fragments. The chromosome III fragment was observed to cross-hybridize with a second chromosome indicated by an asterisk.


Y.B.C. and S.I.J. collected tissue samples, performed extractions, designed and conducted experiments, analyzed and interpreted data, and drafted results L.O.V. designed approaches, obtained funding, led and coordinated the project, interpreted and analyzed data, drafted sections, and edited the manuscript.

Bestandsnaam Beschrijving
pld3162-sup-0001-FigureS1-S5TableS1.pdfPDF document, 837.1 KB
pld3162-sup-0002-DatasetS1.xlsxapplication/excel, 16 KB
pld3162-sup-0003-DatasetS2.xlsxapplication/excel, 15.4 KB
pld3162-sup-0004-DatasetS3.xlsxapplication/excel, 622.3 KB
pld3162-sup-0005-DatasetS4.xlsxapplication/excel, 64 KB
pld3162-sup-0006-reviewercomments.pdfPDF document, 74.9 KB

Let op: De uitgever is niet verantwoordelijk voor de inhoud of functionaliteit van eventuele ondersteunende informatie die door de auteurs wordt aangeleverd. Alle vragen (behalve ontbrekende inhoud) moeten worden gericht aan de corresponderende auteur van het artikel.


MATERIALEN EN METHODES

Yeast strain constructions

A complete list of yeast strains is provided in Supplementary Table S1 . All haploid strains were derived from SJR3659 and SJR3782 [strains MC42-2d and HKL1-42-1c, respectively, in ( 37)], both of which are RAD5 CAN1 derivatives of W303 [rad5-535 leu2-3,112 his3-11,15 ura3-1 ade2-1 trp1-1 can1-100 ( 38)]. The recombination system in experimental strains contained three components: an I-SceI-cleavable lys2 recipient allele (hisG-lys2-6Amut::ISceI allele) at the endogenous LYS2 locus on chromosome II a galactose-inducible I-SceI gene (his3Δ::hph-pGAL-ISceI) bij de HIS3 locus on chromosome XV and a diverged or identical lys2Δ3-donor allele at the CAN1 locus on chromosome V. The diverged donor allele contained a mutated (non-cleavable) I-SceI site and shared 98% sequence identity with the recipient allele (can1::lys2Δ3-98%,ISceInc-URA3-hisG). Strains with the 98%-identical donor were used to determine recombination frequencies, CO/NCO proportions, and hetDNA profiles. Strains containing a 100%-identical donor allele (can1::lys2Δ3-100%,ISceInc-URA3-hisG) were used to determine recombination frequencies and CO/NCO proportions.

De hisG-lys2-6Amut::I-SceI recipient allele (abbreviated hisG/recipient) was a derivative of the recipient allele used in an earlier study [strain SJR 3714 ( 39)]. First, a 6A run near the I-SceI cleavage site was mutated ( Supplementary Figure S1 ) to reduce the occurrence of polymerase slippage events in mismatch repair (MMR)-defective backgrounds. To introduce this modification, a CORE-UK cassette ( 40) was inserted close to the I-SceI cut site of SJR3714, yielding SJR4015. Replacement of the CORE-UK cassette converted the 6A run to AATCAA (SJR4194). Next, a copy of the bacterial hisG gene was inserted immediately upstream of the recipient allele to allow phenotypic distinction between CO and NCO products. To insert the hisG allele, SJR4194 was transformed with a PCR-amplified hisG-URA3-hisG fragment from pNKY51 ( 41). Following selection of Ura + transformants, segregants that lost the URA3 marker during subsequent non-selective growth were identified on 5-FOA medium (SJR4195).

The sequence of the donor component of can1::lys2Δ3-98%,I-SceInc-URA3-hisG donor allele (hereafter referred to as 98% donor/hisG) was the same as that used in a previous study ( 39). The allele was modified, however, by inserting a URA3-hisG cassette amplified from pNKY51 ( 41) immediately downstream of the donor allele. The resulting strain (SJR4031) was crossed with SJR4195 and a haploid segregant with both the recipient and 98% donor alleles was obtained (SJR4196). Eindelijk, een his3Δ::hph-pGAL-ISceI (afgekort als I-SceI) fragment amplified from pGSHU ( 40) was transformed into SJR4196, thereby creating a strain with all three components of the 98% recombination system (SJR4258). To preserve the hetDNA footprint in Lys + colonies MLH1 (SJR4535), MSH6 (SJR4691) or both MLH1 en MSH6 (SJR4982) were deleted from SJR4258. MLH1 was replaced with an mlh1Δ:loxP-TRP1-loxP fragment amplified from pSR954, a loxP-TRP1-loxP plasmid constructed by replacing the kanamycin-resistance marker of pUG6 ( 42) with a TRP1 marker from pFA6-TRP1 ( 43). De MSH6 gene was replaced with an msh6Δ::loxP-kanMX-loxP fragment amplified from pUG6.

The first step in construction of the can1::lys2Δ3-100%,I-SceInc-URA3-hisG (100% donor/hisG) allele was the PCR-mediated assembly of a fragment containing a mutated 6A run and a noncleavable I-SceI cut site using high-fidelity Phusion polymerase (New England BioLabs) and the recipient allele in SJR3714 as a template. The mutated 6A run and noncleavable I-SceI site were introduced using primers 5′-GGGCGCTCCCATTCGCCATTCAGGCTGCGCTTTGGAAAAGGCAAAACTATCGAAGG and 5′ ACAACTGAGGGGTCCTTTCCAGATCTAGGGATAAATAACAGGGTAATTGATCTTGGCAACTTTGAA TTGATT CAGCTAGC, generating an 2.3 kb fragment containing the first half of the eventual donor allele. A 2.0 kb amplicon containing the downstream portion of the incipient donor allele was generated using primers 5′-CCCTAGATCTGGAAAGGACCCCTCAGTTGT and 5′-CTGGAAAGCGGGCAGTGAAAGGAAGGCCCATGAGGCCCAGATCTTTTCTTTAAGAAAGTC. The amplicons shared 30 bp of sequence overlap and were assembled into a single fragment by PCR. The resultant amplicon contained a 100% lys2Δ3′ donor allele that was then inserted into the MscI-digested pSR797 ( 39), which contains nucleotides 20-1141 of the CAN1 volgorde. The resulting plasmid (pSR1154) was digested with PshAI-XcmI and used to transform SJR4195. Selection for canavanine resistance yielded SJR5000, which contained both the recipient and 100%-identical donor alleles. EEN URA3-hisG cassette amplified from pNKY51 was then inserted downstream of the donor allele, generating SJR5003. SJR5003 was crossed with SJR4535 to obtain SJR5007, which contained the hisG/recipient and 100% donor/hisG alleles in an mlh1Δ background. SJR5007 was then crossed with SJR4691 to produce haploid segregants that contained the three recombination components (hisG/recipient, 100% donor/hisG, and galactose regulated I-SceI) in an MMR-proficient (SJR5036), mlh1Δ (SJR5037), msh6Δ (SJR5038), or mlh1Δ msh6Δ (SJR5039) background.

Media and growth conditions

Strains stored at −80°C were streaked onto YEPD (1% Bacto-yeast extract, 2% peptone, 2% dextrose 1.5% agar for plates) supplemented with 500 μg/ml adenine hemisulfate. All growth was at 30°C. Cells were pre-grown in YEPR liquid medium (2% dextrose replaced with 2% raffinose) prior to addition of galactose. Following galactose induction, cells were plated nonselectively on YEPD medium to determine the total number of viable cells. Lys + recombinants were selected on synthetic complete (SC) medium lacking lysine and containing 2% dextrose as a carbon source (SC-lys). 5-FOA medium (SC-uracil supplemented with 2% dextrose, 0.5 g uracil and 1 g 5-fluoroorotic acid per liter) was used to select Ura − segregants.

L-SceI induction and determination of recombination frequencies

Individual YEPR liquid cultures were inoculated with yeast colonies grown for two days on YEPD plates. Following overnight expansion, cells were diluted to an optical density (OD) of 0.2 in fresh YEPR medium. To ensure experiments were performed using exponentially growing cells, diluted cultures were re-grown to an OD of 0.8–1 before galactose addition (final concentration of 0.1%). As previously determined, induction with 0.1% galactose for 45 minutes generally resulted in cleavage of only one sister chromatid ( 39). Following I-SceI induction, appropriate dilutions were plated on YEPD and SC-lys plates. After 2 days of growth, recombination frequencies were calculated by dividing the total number of Lys + colonies by the total number of viable cells. For each genetic background, recombination frequency was determined using data obtained using multiple biological replicates from each of at least three separate days. The average Lys + frequency and 95% confidence interval were calculated for each strain and then normalized to the Lys + frequency obtained with the 98% substrates in the WT background.

Determination of CO-NCO proportions and frequencies

The CO-NCO distribution among Lys + colonies was determined using two procedures: stability of the URA3 marker downstream of the donor allele and PCR using primer pairs diagnostic of CO and NCO products. Lys + colonies were directly inoculated (without colony purification) into SC-lys medium in 96-well plates. After overnight expansion, 3 μl were spotted onto YEPD medium and plates were incubated overnight. Cells were then replica plated onto SC-lys, SC-ura and 5-FOA media. COs were scored based on frequent loss (more than five colonies on 5-FOA medium) of the URA3 marker flanked by hisG direct repeats in the V:II translocation product. Genomic DNA was extracted from the remaining cells and aliquots were used for CO-NCO partitioning by PCR the remainder was used for hetDNA analysis (see below). NCO-specific primers (5′-ATGGTTGGGAAGTCATGGAA and 5′-TTGGGAGTTGGGAATTGAAG) detected the full-length LYS2 allele on chromosome II CO-specific primers (5′-ATGGTTGGGAAGTCATGGAA and 5′-TCACTTTTGCCCTGGAACTT) amplified the truncated allele of the V:II translocation product.

As expected, most replica-plated patches of cells were Lys + Ura + and produced either no or many colonies on 5-FOA plates. A small number of patches, however, had confluent growth on 5-FOA and were Ura − on SD-ura plates ( Supplementary Figure S2A ). This suggested complete loss of the lys2Δ3′ allele and URA3 marker on the V:II translocation product by a second recombination event between the flanking hisG repeats, which leaves behind a single copy of hisG. In addition to this anomaly, PCR analysis revealed in a small number of colonies the presence of the V:II translocation product, which carries the lys2Δ3′ allele, as well as a copy of chromosome II. Subsequent Southern analysis ( Supplementary Figure S2B ) revealed that these colonies were of two types: (1) those containing two normal plus two translocation chromosomes and (2) those containing only a normal chromosome II and the V:II translocation. These can be explained by cleavage of both chromosome II sister chromatids by I-SceI, with one break repaired as an NCO and the other as a CO ( Supplementary Figure S3 ). The breakage of both sisters could reflect either replication of a chromosome cleaved by I-SceI in G1 ( 44), or the cleavage of both chromatids following replication. Random segregation of the resulting chromatids has two predicted outcomes. If the reciprocal translocation products segregate into the same daughter cell, then half of the Lys + colony is expected to contain CO chromosomes and the other half to contain NCO chromosomes. If the translocation products segregate into different cells, however, one cell will contain chromosomes V and II:V and the other will contain chromosomes II and V:II. The former will be inviable due to the loss of essential information from chromosome II, but the latter will survive because the CAN1-distal end of chromosome V is not required for viability ( 45). Because the CO-specific V:II translocation contains the lys2 truncation allele, a NCO-generated LYS2 allele residing on chromosome II is required to confer the Lys + phenotype.

There were four types of Lys + colonies based on phenotypic and physical criteria: (i) colonies that reflected an NCO event, (ii) colonies containing only CO chromosomes, (iii) colonies containing both CO and NCO chromosomes and (iv) a CO event followed by additional recombination between the CO-generated hisG direct repeats. When crossing over occurs between nonhomologous chromosomes in a haploid background, random chromosome segregation predicts that only half of the events will be recoverable as Lys + colonies ( 46). We thus doubled the sum of the CO-only and Ura − colonies to obtain a partially corrected number of CO events. Those colonies that contained both CO and NCO products and hence had two independent events, were then added to both the NCO and CO-only classes (all COs were recovered in this case) to obtain the final numbers of NCO and CO events. The raw and corrected numbers as well as the corrected proportions of NCO and CO events are in Supplementary Table S2 . In the main text, the corrected proportions are given. NCO and CO frequencies were calculated by multiplying the corrected proportions and the corresponding total Lys + frequency.

Southern analysis

Representative colonies corresponding to CO and/or NCO outcomes based on phenotype and PCR analysis were analyzed by Southern blots. Cells was grown in 5 ml YEPD medium overnight prior to genomic DNA extraction. Approximately 2 μg of genomic DNA were digested with XhoI and fragments were separated on a 1% agarose gel run at 40 volts at 4°C for 15–17 h. Following electrophoresis, fragments were denatured and transferred to a positively charged nylon membrane (Roche) via capillary action. The membrane was then hybridized to ∼600 bp LYS2 probes labeled with digoxigenin (DIG)-dUTP using primers 5′-TGAAGCCTTCCCAGAGAGAA and 5′-GCCAAGGAAAAATGTCTACCA (Roche DIG DNA Labeling and Detection Kit). Due to the presence of SNPs between the donor and recipient alleles, two probes were synthesized using pSR1045 and pSR1072 [lys2::ISceI recipient and lys2::I-SceInc,98% donor alleles, respectively ( 39)] as templates and were mixed in equal proportions for the hybridization. Hybridization of the DIG probe to the membrane was detected by chemiluminescence using an anti-DIG antibody conjugated to alkaline phosphatase. xhoI-digested chromosomes II, V, II:V and V:II generate 10 kb, 14 kb, 9 kb, and 15 kb fragments, respectively.

HetDNA analysis

The ∼4 kb hetDNA profiles for NCOs recovered from MMR-deficient strains as well as the gene conversion profile for the MMR-proficient strain were obtained using single-molecule real-time (SMRT) sequencing as previously described ( 39, 47). NCO recipient alleles were amplified from genomic DNA using Phusion polymerase (New England Biolabs). Forward (5′-ATGGTTGGGAAGTCATGGAAGTCG) and reverse (5′-GCTTGGGAGTTGGGAATTGAAGTT) primers were conjugated to 16-nt barcodes so that each NCO was amplified using a unique primer pair. The full list of unique barcodes used is available at https://github.com/PacificBiosciences/Bioinformatics-Training/blob/master/barcoding/pacbio_384_barcodes.fasta. ImageJ (https://imagej.nih.gov/ij/) was utilized to determine amplicon concentrations and equivalent amounts of individual amplicons were pooled and purified using the GeneJet PCR Purification Kit (Thermo Scientific). SMRT library construction and sequencing (PacBio RSII system) was done at the Duke Center for Genomic and Computational Biology.

PacBio-generated circular consensus sequence (CCS) reads in FASTA format were sorted by unique barcode pairs using a previously described pipeline ( 48). The donor and recipient reference sequences used for sequence alignment and hetDNA calling are in Supplementary Figure S1 . hetDNA was defined as regions that contained both the recipient and donor SNPs, with the minor species constituting at least 10% of the total informative reads only barcode pairs for which there were at least 20 CCS reads were further considered. In addition, those colonies that contained 3–4 distinct species of CCS reads were not included in the analyses, as these presumably represented two independent NCO events. For the MMR-defective strains, Lys + colonies that lacked hetDNA were excluded. For the WT strain, Lys + colonies with a gene conversion tract (39/268 colonies) that did not extend beyond the most break-proximal SNP [which most often reflects activity of the Pol δ exonuclease activity ( 39)] were not considered when assigning tract directionality. Tract lengths were calculated as previously described ( 47).

Statistische analyse

Three types of statistical tests were used during data analysis. First, the frequency data in Figure 3A were analyzed using one-way ANOVA (P < 0.001) prior to performing post-hoc unpaired Student's t-tests between pairs of strains. Second, hetDNA length distributions were tested using the Kruskal–Wallis test (P < 0.01) prior to performing post-hoc Mann–Whitney U tests. Obtaining a significant value in an omnibus test (ANOVA or the Kruskal–Wallis test) before proceeding to pairwise comparisons eliminated the need to correct for multiple comparisons. Finally, the distributions of CO-NCO and unidirectional-bidirectional hetDNA tracts in NCOs were compared using contingency Chi-square tests and the significance level for p values was adjusted using the Bonferroni correction. In the case of CO-NCO distribution, five comparisons were done and this shifted the significance level from P = 0.05 to P = 0.01. For the unidirectional-bidirectional hetDNA distributions in NCOs, three comparisons were done and the P-value for significance was reduced from 0.05 to 0.017.

When combining Lys + frequencies and CO/NCO distributions to calculate CO/NCO frequencies, the 95% confidence interval (CI) of each derived frequency was calculated by taking into account the 95% CI of the component Lys + frequency and of the CO/NCO proportion (vassarstats.net). The errors of both measurements were combined to obtain the upper and lower bounds for the derived 95% CI through the right triangle rule ( 49). The CIs thus calculated were used in the relevant figures.


How does the size of insert affects the rate of Homologous Recombination in yeast? - Biologie

DOI: https://doi.org/10.15368/theses.2014.40
Available at: https://digitalcommons.calpoly.edu/theses/1193

Date of Award

Degree Name

MS in Biological Sciences

Department/Program

Advisor

Abstract

Meiosis is a specialized type of cell division characterized by a single round of DNA replication and two rounds of chromosome segregation, ultimately resulting in four haploid cells. During meiosis I, chromosomes align and reciprocal recombination results in the formation of a crossover, creating the tension required to properly segregate homologs during the first round of meiosis.

Two mechanisms involved in regulating the occurrence of crossing over are assurance and interference. Crossover assurance describes the phenomenon that at least one crossover will form between each pair of homologous chromosomes during prophase I. Crossover interference, on the other hand, describes the nonrandom placement of crossovers between homologs, increasing the probability that a second crossover will occur at a discrete distance away from the first one.

In addition to assurance and interference, chromosome size may play a role in the rate of meiotic recombination during prophase I. As a result of crossover assurance, small chromosomes receive a minimum of one crossover, the obligate crossover. Assuming chromosome size does not influence the rate of recombination, pairs of large chromosomes should experience the same number of crossovers per base pair as small chromosomes. Previous studies have been inconsistent: Kaback et al. (1999) saw decreased rates of crossing over between large chromosomes relative to small ones, suggesting that crossover interference acts across a larger distance on large chromosomes. Turney et al. (2004), however, saw no such effect, suggesting that these findings may be site- or sequence-specific.

The current study used the Cre-loxP system to create translocated chromosomes, decreasing the size of chromosome VIII from 562 kb to 125 kb. The rate of crossing over was evaluated using nutrient marker genes that were inserted on the left arm of chromosome VIII to facilitate phenotypic detection of crossing over between homologous translocated chromosomes in comparison to crossing over between homologous nontranslocated chromosomes.

Translocated strains were attempted, though further testing suggests that the translocation itself may be lethal. In the future, we plan to further investigate the potential lethal nature of the translocation.

We also experienced difficulty in curing yeast cells of the Cre expression plasmid: as pSH47 was removed, translocated chromosomes reverted to nontranslocated chromosomes. In addition, crossing over in nontranslocated yeast, along with subsequent molecular analysis, revealed that one of the marker genes presumed to be on the left arm of chromosome VIII is, in fact, located on a different chromosome, preventing analysis of crossing over in this region. As a result, we were unable to proceed with current experimentation.


Dankbetuigingen

A.D. and M.H. contributed equally to this work. We thank M. Vulic, F. Taddei, F. Dionisio, and M. Radman for helpful discussions and for communicating results before publication. We also thank J. Majewski and F. Cohan for sharing their data before publication. This work was supported by National Institutes of Health Grant GM38464 to S.J.-R. A.D. was partially supported by the Graduate Division of Biological and Biomedical Sciences, Emory University M.L. was supported by National Institutes of Health Grant GM33782 to Bruce R. Levin.