Informatie

RNA-isolatie - rol van pH


Waarom gaat RNA alleen in de waterige fase wanneer het wordt behandeld met fenol-chloroform bij een lagere pH? Bij een neutrale of basische pH zouden zowel DNA als RNA in de waterige fase ontsnappen. Dus hoe wordt DNA tegengehouden bij zure pH?


Het doel van extractie met zuurfenol is om selectief RNA in de waterige fase vast te houden, terwijl DNA zich naar de organische fase verdeelt of in de tussenfase samenvloeit. Ik heb veel mensen op internet gevonden die zeggen dat dit te wijten is aan protonering van DNA-fosfaten, terwijl RNA-fosfaten ionisch blijven, waardoor een verschillende oplosbaarheid ontstaat. Ik geloof deze uitleg niet omdat:

  • De pKa van de fosfodiestergroep is enkele ordes van grootte lager dan de pH die wordt gebruikt bij extracties van zure fenolen, en zou dus grotendeels moeten worden gedeprotoneerd.
  • Gezien hun vergelijkbare structuren lijkt het mij onwaarschijnlijk dat het drastische verschil in pKa tussen RNA en DNA dat nodig is om voorbereidend bruikbaar te zijn, onwaarschijnlijk is.
  • Ik vond dergelijke beweringen niet in de wetenschappelijke literatuur.

De eigenschappen van DNA en RNA die in je opkomen en die de differentiële oplosbaarheid kunnen verklaren zijn:

  • DNA wordt gedenatureerd in zuur als gevolg van protonering van de nucleobasen, wat een positieve lading geeft. Dit kon aggregatie te vergemakkelijken.
  • DNA is over het algemeen langer.
  • RNA heeft een 2'-hydroxylgroep die de polariteit van het molecuul verhoogt.

Dit wordt enigszins ondersteund door een FAQ van ThermoFisher:

De verdeling van de nucleïnezuren in fenol is pH-afhankelijk. Bij pH 7,0 of hoger verdelen zowel DNA als RNA zich in de waterige fase. Bij een zure pH (lager dan 7,0) wordt DNA gedenatureerd en gaat het naar de organische fase, maar het RNA blijft in de waterige fase.

De exacte biofysica ontgaat me. Ik realiseer me dat dit geen antwoord is, maar eerder een lange opmerking. Ik vond het belangrijk om iets aan te pakken wat naar mijn mening een misvatting zou kunnen zijn. Kritiek is welkom.


In dit geval zijn er twee eigenschappen die het gedrag van RNA bepalen:

  • Zijn polariteit;
  • Zijn zuurgraad.

Vanwege zijn polariteit heeft RNA de neiging om aan de fenol-clorophorm-fase te ontsnappen; eigenlijk het kan gaan in de waterige fase, zelfs als de pH neutraal is [1], maar met een lager rendement dan wanneer de pH zuur is. Hier komt de tweede eigenschap, RNA-zuurgraad. Daarom heeft RNA, wanneer het zich in een neutrale oplossing bevindt, een negatieve lading: de $-OH$s van de fosfaatgroep dissociëren tot $-O^-$ en $H^+$. Dit gebeurt echter niet in een zure oplossing, waar er al teveel $H^+$ zijn. Dus bij basische pH zijn de $-OH$ groepen intact en hebben ze een neutrale lading; dit stabiliseert het systeem.
Denk er eens over na: als de waterige fase een neutrale pH heeft en zich vult met negatief geladen RNA-moleculen, kunnen er na een tijdje geen negatieve moleculen meer in die oplossing komen. Aan de andere kant, als de RNA-moleculen die de waterige fase binnenkomen elektrostatisch neutraal blijven, zal het aantal moleculen dat in de oplossing gaat alleen beperkt worden door de beschikbaarheid van watermoleculen om ze op te lossen.

Daarom gebruik je zure* pH, het is gewoon een kwestie van efficiëntie.

Disclaimer: dit antwoord is gebaseerd op een opmerking van de OP onder de OQ.

[1] Je zou nooit een oplossing met een hoge pH gebruiken om RNA te extraheren, omdat een dergelijke toestand RNA hydrolyseert.


Zure guanidiniumthiocyanaat-fenol-chloroform extractie

Zure guanidiniumthiocyanaat-fenol-chloroform extractie (afgekort AGPC) is een vloeistof-vloeistofextractietechniek in de biochemie. Het wordt veel gebruikt in de moleculaire biologie voor het isoleren van RNA (evenals DNA en eiwit in sommige gevallen). Deze methode kan langer duren dan een op een kolom gebaseerd systeem zoals de op silica gebaseerde zuivering, maar heeft een hogere zuiverheid en het voordeel van een hoge terugwinning van RNA: [1] een RNA-kolom is doorgaans ongeschikt voor de zuivering van kort (<200 nucleotiden) RNA soorten, zoals siRNA, miRNA, gRNA en tRNA.

Het werd oorspronkelijk bedacht door Piotr Chomczynski en Nicoletta Sacchi, die hun protocol in 1987 publiceerden. [2] [3] Het reagens wordt door Sigma-Aldrich verkocht onder de naam TRI Reagent door Invitrogen onder de naam TRIzol door Bioline als Trisure en door Tel. -Test als STAT-60.


DNA-, RNA- en eiwitextractie: het verleden en het heden

Extractie van DNA, RNA en eiwit is de basismethode die wordt gebruikt in de moleculaire biologie. Deze biomoleculen kunnen worden geïsoleerd uit elk biologisch materiaal voor daaropvolgende stroomafwaartse processen, analytische of preparatieve doeleinden. In het verleden was het proces van extractie en zuivering van nucleïnezuren ingewikkeld, tijdrovend, arbeidsintensief en beperkt in termen van totale doorvoer. Momenteel zijn er veel gespecialiseerde methoden die kunnen worden gebruikt om pure biomoleculen te extraheren, zoals op oplossingen gebaseerde en op kolommen gebaseerde protocollen. De handmatige methode heeft in de loop van de tijd zeker een lange weg afgelegd met verschillende commerciële aanbiedingen die complete kits bevatten die de meeste componenten bevatten die nodig zijn om nucleïnezuur te isoleren, maar de meeste vereisen herhaalde centrifugatiestappen, gevolgd door verwijdering van supernatanten, afhankelijk van het type monster en extra mechanische behandeling. De vraag naar geautomatiseerde systemen voor middelgrote tot grote laboratoria is de afgelopen jaren toegenomen. Het is een alternatief voor arbeidsintensieve handmatige methoden. De technologie moet een hoge doorvoer van monsters mogelijk maken, de opbrengst, zuiverheid, reproduceerbaarheid en schaalbaarheid van de biomoleculen, evenals de snelheid, nauwkeurigheid en betrouwbaarheid van de test moeten maximaal zijn, terwijl het risico op kruisbesmetting wordt geminimaliseerd.


Zuivering van RNA met behulp van TRIzol (TRI-reagens)

TRIzol solubilisatie en extractie is een relatief recent ontwikkelde algemene methode voor het deproteïniseren van RNA. Deze methode is bijzonder voordelig in situaties waarin cellen of weefsels zijn verrijkt voor endogene RNasen of wanneer scheiding van cytoplasmatisch RNA van nucleair RNA onpraktisch is. TRIzol (of TRI-reagens) is een monofasische oplossing van fenol en guanidiniumisothiocyanaat die tegelijkertijd biologisch materiaal oplosbaar maakt en eiwit denatureert. Na solubilisatie veroorzaakt de toevoeging van chloroform fasescheiding (net zoals extractie met fenol:chloroform:isoamylalcohol), waarbij eiwit wordt geëxtraheerd naar de organische fase, DNA oplost aan het grensvlak en RNA in de waterige fase blijft. Daarom kunnen RNA, DNA en eiwit uit een enkel monster worden gezuiverd (vandaar de naam TRIzol). TRIzol-extractie is ook een effectieve methode voor het isoleren van kleine RNA's, zoals microRNA's, piwi-geassocieerde RNA's of endogene, kleine interfererende RNA's. TRIzol is echter duur en RNA-pellets kunnen moeilijk opnieuw worden gesuspendeerd. Daarom wordt het gebruik van TRIzol niet aanbevolen wanneer regelmatige fenolextractie praktisch is.


Nucleïnezuurextractiemethoden

Nucleische extractiemethoden kunnen op grote schaal worden gekarakteriseerd in twee verschillende typen:

Oplossingsgerichte methoden

Veel van de vroege methoden voor nucleïnezuurextractie waren afhankelijk van het malen van bevroren biologische monsters en deze vervolgens te mengen met oplossingen van chemicaliën die waren ontworpen om het mogelijk te maken om RNA en/of DNA te zuiveren.

1. Cesiumchloridegradiëntcentrifugeren (met ethidiumbromide)

Deze methode is gebaseerd op de verschijnselen van drijfvermogen en soortelijke dichtheid. Cesiumchloride (CsCl) is een extreem dicht zout. Wanneer oplossingen van dit zout worden onderworpen aan centrifugatie bij zeer hoge snelheden (typisch >100.000 rpm), stelt de CsCl een concentratiegradiënt in, waarbij het sterk geconcentreerd is aan het ene uiteinde of de zijkant van de centrifugebuis waarin het zich bevindt. , en veel minder geconcentreerd op de andere. Als het centrifugatieproces voorzichtig wordt beëindigd, terwijl de centrifuge langzaam vertraagt, zal de dichtere oplossing (met een hogere CsCl-concentratie) naar de bodem van de buis zakken, waarbij de concentratiegradiënt enige tijd wordt gehandhaafd. Andere moleculen die in de oplossing zijn opgelost, zullen zichzelf scheiden afhankelijk van hoe dicht ze zijn, waarbij de dichtere moleculen naar de bodem van de buis gaan en minder dichte moleculen naar de bovenkant. Wanneer DNA zich in de aanwezigheid van een molecuul bevindt dat ethidiumbromide wordt genoemd, zal het eraan binden en fluoresceren onder UV-licht. Het ethidiumbromide past ook de dichtheid van het DNA aan zodat het bij centrifugeren naar het midden van de buis beweegt. Verontreinigingen zullen naar verschillende posities bewegen en daarom worden gescheiden van het DNA, dat gemakkelijk kan worden gezien en teruggewonnen omdat het fluorescerend is. Daaropvolgende stappen zullen dan het DNA scheiden van de CsCl en ethidiumbromide. Deze techniek is met name effectief voor het scheiden van plasmiden - kleine DNA-strengen die bacteriën gebruiken om informatie over antibioticaresistentie met elkaar te delen, en mitochondriaal DNA en andere specifieke DNA-moleculen die binden aan karakteristieke hoeveelheden ethidiumbromide, en zullen daarom unieke dichtheden hebben. Het is gemakkelijk om mitochondriaal en plasmide-DNA te scheiden. Deze nucleïnezuren zijn gerangschikt in sterk opgerolde (supercoiled) cirkelvormige patronen. DNA dat niet supercoiled is (zoals veel langere chromosomale DNA-soorten) bindt aan verschillende hoeveelheden ethidiumbromide en heeft een verschillende dichtheid waardoor ze gemakkelijk te scheiden zijn van het plasmide-DNA.

2. Guanidinium Thiocyanaat-Fenol-Chloroform nucleïnezuur extractie

Een waterige oplossing van het zout guanidiniumthiocyanaat, wanneer gemengd met oplosmiddelen fenol en chloroform, zorgt voor een effectieve zuivering van RNA via een minimaal aantal stappen. Wanneer monsters worden vermalen en gemengd met chloroform, fenol, natriumacetaat en guanidiniumthiocyanaat en worden onderworpen aan centrifugatie, zal de zoutoplossing zich scheiden van de oplosmiddelen, waardoor een bovenste waterige fase en een onderste organische fase die uit de oplosmiddelen bestaat, ontstaat. RNA blijft in de waterige fase, terwijl eiwitten, andere nucleïnezuren en andere verontreinigingen naar de organische fase of naar het grensvlak tussen de twee fasen zullen gaan.

3. Cetyltrimethylammoniumbromide-nucleïnezuurextractie

Deze techniek wordt meestal gebruikt voor plantenmonsters en hun onderdelen zoals granen, zaden en bladeren. Het wordt ook gebruikt voor veel voedselmonsters. Nucleïnezuren en sommige andere polysachariden zijn onoplosbaar in oplossingen van 2% Cetyltrimethylammoniumbromide-nucleïnezuurextractie (CTAB), bij hoge pH. Neutrale polysachariden en eiwitten zijn oplosbaar. Dit biedt een gemakkelijke manier om veel moeilijke, op planten gebaseerde verontreinigingen te verwijderen voorafgaand aan verdere zuivering.

4. Chelex®-extractie

Deze techniek wordt gebruikt op het gebied van forensisch onderzoek voor DNA-extractie uit verschillende bronnen zoals mondswabs, bloedvlekkaarten en haar. Deze methode maakt gebruik van een hars (handelsnaam Chelex®, dat bindt aan veelvoorkomende remmers van het polymerasekettingreactieproces (PCR). Dit levert een vrij ruw monster op, maar wel een die DNA bewaart en bruikbaar maakt voor op PCR gebaseerde forensische analyse.

5. Alkalische extractie

Deze techniek wordt gebruikt voor isolatie van plasmide-DNA, op zichzelf voor relatief ruwe preparaten, of als de eerste stap in vrijwel alle plasmide-zuiveringsprocessen. Het omvat het oogsten van interessante bacteriën uit een kweekmedium en bijgevolg het blootstellen van de bacteriën aan een sterk alkalische oplossing. Dit wordt over het algemeen gevolgd door het mengen van het alkalische extract met het detergens Natriumdodecylsulfaat, dat eiwitten en de meeste andere verontreinigingen verwijdert. Een van de grootste voordelen van deze methode is dat, aangezien er veel eiwitten aan het grote chromosomale DNA zijn gebonden, dit DNA samen met de eiwitten wordt verwijderd. Aangezien moleculaire kloneringstechnieken afhankelijk zijn van het manipuleren van plasmide-DNA, is het verwijderen van het chromosomale DNA van cruciaal belang.

Nucleïnezuurextractie in vaste fase

Vaste-fase-extractiemethoden werken door ervoor te zorgen dat nucleïnezuren binden aan vaste dragers, zoals magnetische korrels die zijn gecoat met silica of andere materialen. De kralen (of andere dragers) worden vervolgens gewassen met alcohol om verontreinigingen te verwijderen. De drager wordt vervolgens gewassen met een vloeistof die de nucleïnezuren weer oplosbaar maakt, waardoor het DNA van de drager wordt bevrijd in een proces dat elutie wordt genoemd. Een eenvoudige methode is om een ​​oplossing met een chaotroop aan het ruwe nucleïnezuurextract toe te voegen. Chaotrope middelen zijn moleculen die het waterstofbindingsnetwerk tussen watermoleculen verstoren. In aanwezigheid van chaotropen zijn nucleïnezuren voorheen veel minder oplosbaar en zullen ze binden aan glas, met silica gecoate magnetische korrels en andere vaste dragers, waardoor ze gemakkelijk te scheiden zijn van verontreinigingen. Vastefase-extractiemethoden kunnen ook afhankelijk zijn van selectieve binding van DNA en RNA aan ionenuitwisselingsharsen of andere chemische stoffen.


Methoden:

Cel cultuur

MDCK-London-cellen 14 werden vermeerderd met behulp van DMEM (Mediatech, Inc.) aangevuld met 10% foetaal runderserum (Hyclone) en 2 mM glutamine. Infectie met influenzavirus (A/Brisbane/59/2007) werd uitgevoerd in een infectiemedium bestaande uit DMEM aangevuld met glutamine (2 mM), HEPES (25 mM), runderserumalbumine (0,2% A7888 Sigma) en TPCK-trypsine ( 1 g/ml T1426 Sigma). Voor experimenten waarbij gebruik werd gemaakt van een 24-puts celcultuurplaatformaat, werd een suspensie van getrypsiniseerde cellen (grondig gewassen om serum 300.000 cellen/putje te verwijderen) gemengd met virus (10.000 TCID50/putje) in infectiemedium (1 ml/putje). Men liet cellen hechten en cellysaten werden 6 uur na infectie bereid.

Bereiding van RT-qPCR-ready cellysaten

MDCK-London-cellen in platen met 24 putjes werden eenmaal gewassen met PBS (1 ml/putje). Cellysaten werden bereid door celmonolagen bloot te stellen aan 200 L / putje Bio-Rad iScript-monstervoorbereidingsreagens (aangeduid als Bio-Rad SPR 170-8898) of Cell-Lysis (CL) buffer. De uiteindelijke formulering van CL Buffer bestond uit 10 mM Tris-HCl pH 7,4, 0,25% Igepal CA-630 en 150 mM NaCl. CL Buffer werd vers bereid uit de volgende voorraadoplossingen op de dag van experiment: 1 M Tris-HCl (T2194 Sigma), 10% Igepal CA-630 (I8896 Sigma) en 5 M NaCl (351-036-100 Quality Biological, Inc. .). Alle reagentia waren van moleculair biologische kwaliteit en er werden verdunningen gemaakt met DEPC-behandeld water (351-068-721 Quality Biological, Inc.). Voor bepaalde experimenten bevatte CL Buffer ook MgCl2 (M1028 Sigma) of RNasin Plus RNase-remmer (N2615 Promega). Zowel Bio-Rad SPR als CL Buffer werden vóór gebruik op kamertemperatuur gebracht. Cellen werden blootgesteld gedurende de aangegeven tijden (typisch 2 min voor Bio-Rad SPR en 5 min voor CL Buffer). De resulterende lysaten werden zorgvuldig verzameld zonder de cel-monolaagresten te verstoren en ofwel onmiddellijk geanalyseerd of bevroren bewaard (-20°C of -80°C).

RT-qPCR-analyse van genexpressie van influenzavirusmatrix

De experimenten zijn ontworpen om te voldoen aan de MIQE-richtlijnen 15 . RT-qPCR-analyse werd uitgevoerd zoals beschreven in een eerder onderzoek 1 . PCR-primers (voorwaarts: AAGACCAATCCTGTCACCTCTGA omgekeerd: CAAAGCGTCTACGCTGCAGTCC) die een sterk geconserveerd gebied van 104 bp van het matrixgen van influenza A-virussen 16 amplificeren, werden gebruikt in éénstaps SYBR Green RT-qPCR. Elke reactie bevatte: sjabloon (1 μL cellysaat), 1 × iScript One-Step SYBR Green RT-PCR Supermix (170-8893 Bio-Rad), 600 nM van elke primer (gesynthetiseerd bij de Facility for Biotechnology Resources CBER, FDA Bethesda, MD) en nuclease-vrij water tot 10 L. Een CFX96 real-time PCR-instrument (Bio-Rad) werd gebruikt met het volgende protocol: 50°C gedurende 10 min (1×), 95°C gedurende 5 min (1×), 95°C gedurende 10 sec/61° C gedurende 15 sec/72°C gedurende 30 sec (40×) gegevensverzameling vond plaats na de 72 °C verlengingsstap. Totaal RNA gezuiverd uit MDCK-London-cellen die waren geïnfecteerd met de influenzavirusstam A/PR/8/34 werd gebruikt als een RT-qPCR-kwantificatiestandaard zoals eerder beschreven 1 . Voor elke RT-qPCR-run werd een 10-voudige verdunningsreeks van de standaard (met behulp van cellysaat bereid uit niet-geïnfecteerde cellen als verdunningsmiddel) in ten minste tweevoud beoordeeld om de RT-qPCR-prestaties te valideren en kwantificering te vergemakkelijken. Bovendien omvatte elke RT-qPCR-run negatieve controles (niet-geïnfecteerd lysaat als input) en controles zonder reverse transcriptie (initiële verdunning van de hierboven beschreven RNA-standaard als input). Deze controles resulteren doorgaans in geen amplificatie of niet-specifieke amplificaties op laag niveau. (gesuggereerd door smeltcurve-analyse) met CQ's > 36. Het is belangrijk op te merken dat er geen DNA-tussenproducten zijn in de levenscyclus van het influenzavirus.

Op microfluïdica gebaseerde beoordeling van RNA

Totaal RNA uit cellysaten werd gezuiverd met behulp van de RNeasy Mini-kit (Qiagen) volgens het "opruimings"-protocol dat bij de kit werd geleverd. Beginnend met

200 L cellysaat, 700 L Buffer RLT en 500 L ethanol werden toegevoegd en het mengsel werd door een RNeasy Mini-spinkolom geleid. Na de voorgeschreven wasstappen werd gezuiverd RNA geëlueerd in 30 L nucleasevrij water en bewaard bij -80 ° C tot beoordeling. Gezuiverde RNA-monsters (1 L) werden onderworpen aan op microfluïdica gebaseerde Experion RNA StdSens-elektroforese-analyse (Bio-Rad) volgens het protocol van de systeemfabrikant. Monster-RNA-concentraties, zoals gemeten door Experion, varieerden doorgaans van 100-300 ng/μL (binnen het aanbevolen concentratiebereik van 5-500 ng/μL voor de StdSens-chip).

Op RT-qPCR gebaseerde microneutralisatietest voor influenzavirus

Microneutralisatie van het griepvirus werd uitgevoerd zoals eerder beschreven 1 . Een monster van humaan serum 17 van een persoon met een voorgeschiedenis van griepvaccinatie werd verkregen van W. Wang en C. Weiss (Division of Viral Products, CBER, FDA). Het serummonster werd verkregen met schriftelijke geïnformeerde toestemming na ethische goedkeuring door het Research Involving Human Subjects Committee (RIHSC) van de Amerikaanse Food and Drug Administration. Het serummonster werd vóór gebruik door incubatie gedurende 30 minuten bij 56°C door warmte geïnactiveerd. Neutralisatie-experimenten werden uitgevoerd met behulp van infectiemedium. Virusinoculum (1000 TCID50/50 L) werd gemengd met een verdunning van serum (50 L) in een putje van een kweekplaat met 96 putjes. Na een incubatie gedurende 1 uur bij 37°C werd een suspensie van MDCK-London-cellen (30.000 cellen/100 ul) toegevoegd. Op 6 uur na infectie werden cellysaten bereid door de cellen eenmaal met PBS te wassen en 100 μL/putje Bio-Rad SPR of CL-buffer toe te voegen die op kamertemperatuur was geëquilibreerd, cellen werden gedurende 2 minuten blootgesteld (Bio-Rad SPR) of 5 minuten (CL-buffer). Lysaten werden verzameld en bevroren bewaard bij -20 ° C (Bio-Rad SPR-monsters) of -80 ° C (CL-buffermonsters) tot beoordeling. Virusreplicatie, zoals weerspiegeld door matrixgenexpressie, werd gekwantificeerd door lysaten (1 L) te onderwerpen aan analyse door RT-qPCR. De hoeveelheid RNA in elk experimenteel monster werd genormaliseerd tegen de gemiddelde waarde (n = 3) verkregen uit controleputjes waarin cellen waren geïnfecteerd in afwezigheid van neutraliserend serum (viruscontroleputjes). Neutralisatietiter werd bepaald als het omgekeerde van de hoogste serumverdunning (vóór de toevoeging van virus of cellen), resulterend in ten minste 90% remming van het RT-qPCR-signaal.


Beoordeling van de kwaliteit van nucleïnezuurmonsters

De procedures voor monsterbehandeling en nucleïnezuurextractie zijn variabel, daarom is het van cruciaal belang om een ​​betrouwbaar protocol te definiëren voor de analyse van de kwaliteit en kwantiteit van het monster en om details van deze analyse in publicaties op te nemen 2 . De hoeveelheid RNA wordt grotendeels bepaald door de opbrengst van rRNA, terwijl de kwaliteit van RNA wordt bepaald door de zuiverheid (afwezigheid van remmers) en de integriteit van de RNA-moleculen. Bij het meten van de kwaliteit van een monster beïnvloeden de zuiverheid en integriteit de resultaten echter moeilijk om de zuiverheid en integriteit van een monster met een lage concentratie te bepalen en de aanwezigheid van onzuiverheden kan de kwantificering verstoren. Er zijn een aantal technieken die kunnen worden gebruikt om de kwantiteit en kwaliteit van nucleïnezuur te beoordelen, maar geen van deze op zichzelf biedt alle informatie die nodig is om een ​​monster volledig te beschrijven. Daarom is het belangrijk om een ​​reeks opties te overwegen om ervoor te zorgen dat de kwaliteit van het monster de uiteindelijke analysegegevens niet beïnvloedt 1 .

Kwantificering van nucleïnezuur

UV-spectroscopie

Nucleïnezuren worden traditioneel gekwantificeerd door de UV-absorptie te meten met een spectrofotometer. De absorptie van een verdund DNA- of RNA-monster wordt afgelezen bij 260 nm en 280 nm. De optische dichtheid (OD) bij 260 nm wordt gebruikt om de RNA- of DNA-concentratie in een oplossing te bepalen met behulp van de wet van Beer-Lambert, die een lineaire correlatie tussen absorptie en concentratie voorspelt.

Wet Beer-Lambert

A = εbc
A = absorptie
b = weglengte van de cuvet in cm (typisch 1 cm)
c = analytconcentratie
ε = extinctiecoëfficiënt

Voor RNA, ε = 40 g/mL
Voor DNA, ε = 50 g/mL

Een OD bij 260 nm (A260) aflezing van 1,0 komt overeen met ongeveer 40 g/ml zuiver RNA en 50 μg/ml zuiver dubbelstrengs DNA. De wet van Beer-Lambert is echter alleen geldig voor OD-waarden tot 2 en de vermelde OD/concentratie-relatie is afhankelijk van de zuivere monsters. Het is duidelijk dat verontreinigende stoffen met absorptie bij 260 nm of 280 nm de geschatte OD-waarde beïnvloeden. Zuiver RNA heeft een A260/EEN280 van 2.1, terwijl puur DNA een A . zal hebben260/EEN280 van 1.8.

De OD van potentieel verontreinigende stoffen zoals eiwitten, chaotrofe zouten en fenol kan ook worden bepaald als de absorptie van het monster wordt gemeten bij 280 nm en 230 nm (A280 en een230, respectievelijk). Op deze manier wordt een verhouding van A260/EEN280 en een260/EEN230 kan worden gebruikt als een indicator voor de zuiverheid van het monster. Er moet echter worden opgemerkt dat de bepaling van eiwitverontreiniging in DNA bij deze benadering zeer ongevoelig is 4 .

Bovendien verstoren de pH en de ionsterkte van de buffer ook de OD-aflezing. Het is aangetoond dat er een significante variabiliteit is in de A260/EEN280 verhouding wanneer verschillende waterbronnen worden gebruikt om de spectrofotometrische bepalingen uit te voeren. Variatie in de pH van water tussen pH 5,4 en 7,5-8,5 gebruikt voor het suspenderen van RNA verhoogde bijvoorbeeld aanzienlijk RNA A260/EEN280 verhoudingen van ongeveer 1,5 tot 2,0 5 .

Het is belangrijk dat zowel de A260/EEN280 verhouding en de A260/EEN230 verhoudingen liggen dicht bij 2,0 (tabel 7.1).

TRIS, Ethanol en Isopropanol Contaminatie

Effect van TRIS-besmetting: TRIS-besmetting heeft geen significante invloed op het absorptiespectrum van RNA/DNA.

Effect van ethanolverontreiniging: Ethanol heeft geen significant effect op het absorptiespectrum van RNA/DNA, gemeten in TE pH 8,0. Wanneer de meting echter in zuiver water wordt gedaan, zal de A260/EEN280 verhouding kan worden verminderd en dus een verhouding lager dan 2,0 kan wijzen op ethanolverontreiniging.

Effect van isopropanolcontaminatie: Isopropanol heeft geen significant effect op het absorptiespectrum van RNA/DNA, gemeten in TE pH 8,0. Wanneer de meting echter in zuiver water wordt gedaan, zal de A260/EEN280 verhouding kan worden verminderd en dus kan een verhouding lager dan 2,0 wijzen op isopropanolverontreiniging.

Eiwit-, guanidine-isothiocyanaat- en fenolbesmetting

Effect van eiwitverontreiniging: Een monster met een verontreiniging van 0,01% BSA kan een bijna normaal absorptiespectrum vertonen, hoewel de A260/EEN280 verhouding kan dalen tot onder 1,9 (RNA) of 1,7 (DNA), wat een waarschuwing is dat iets het monster verontreinigt. Bij 0,5% BSA lijken de absorptiespectra abnormaal en dit is een duidelijke indicatie dat er een significant niveau van verontreiniging in het monster is. Daarom kunnen hoge eiwitconcentraties worden gedetecteerd door abnormale A260/EEN280 verhoudingen, maar lage en matige bedragen niet.

Effect van contaminatie met guanidine-isothiocyanaat: Guanidine isothiocyanaat heeft weinig invloed op de A260/EEN280 verhouding heeft guanidine-isothiocyanaat daarom een ​​klein effect op de kwantificering van RNA. De aanwezigheid van guanidine-isothiocyanaat heeft echter een zeer sterk effect op de A260/EEN230 verhouding bij een vervuiling van 0,5%, de A260/EEN230 ratio zakt onder 0,5. Monsters met vermoedelijke guanidinecontaminatie moeten worden vermeden, aangezien dit een schadelijk effect zou hebben op stroomafwaartse enzymatische reacties.

Effect van fenolverontreiniging: Fenol heeft een zeer sterk effect op de kwantificering van RNA. Bij 0,5% fenolverontreiniging van een RNA-monster bij 50 ng/μL is de gemeten concentratie meer dan drie keer hoger. Dit sterk storende effect van fenol op de kwantificering van RNA is te wijten aan de vervuilende absorptiepiek bij 270 nm. Bij zeer lage RNA-concentraties, lager dan 10 ng/μL, wordt deze verontreinigende piek vaak verward met RNA. De absorptie van RNA is echter altijd bij 260 nm en nooit bij 270 nm, dus als de piek bij 270 nm ligt, is dit te wijten aan een verontreiniging. Nadat RNA is geïsoleerd met een methode op basis van fenol, vormt de foutieve overschatting van de RNA-concentratie een serieus probleem. Dit is met name het geval wanneer het RNA een lage concentratie heeft.

Geautomatiseerde UV-spectrofotometrie

Terwijl conventionele UV-spectroforese metingen vereist met relatief grote monstervolumes, zijn er nu systemen zoals de NanoDrop ® 2000 UV-Vis-spectrofotometer die geautomatiseerd zijn en zeer nauwkeurige analyses van extreem kleine monstergroottes ondersteunen. De systemen voor het bewaren van monsters maken cuvetten en capillairen overbodig, waardoor de hoeveelheid geanalyseerde monsters tussen 0,5 L en 2 μL wordt verminderd. De NanoDrop biedt een scan van de absorptie van ongeveer 200 nm tot 350 nm, wat het relevante gebied is voor het bepalen van de RNA/DNA-concentratie en zuiverheid.

Op fluorescentie gebaseerde kwantificeringssystemen voor nucleïnezuur

Het gebruik van fluorescerende kleurstoffen om nucleïnezuren te kwantificeren is een alternatief voor absorptiespectrofotometrie 6,7. Bepaling van de nucleïnezuurconcentratie met behulp van fluorescentiemethoden maakt gebruik van de binding van kleine moleculen of kleurstoffen aan nucleïnezuren en meet de daaropvolgende veranderingen in fluorescentiekenmerken. Hoewel duurder dan absorptiespectrofotometrie, is op fluorescentie gebaseerde kwantificering gevoeliger, nauwkeuriger en kan specifiek zijn voor het nucleïnezuur van belang.

Aangezien fluorometers fluorescentie meten in relatieve in plaats van absolute eenheden, wordt de meting eerst gekalibreerd met een bekende concentratie van een standaard nucleïnezuuroplossing met kenmerken die vergelijkbaar zijn met het te meten monster. Na kalibratie kan een enkele meting de concentratie van nucleïnezuur in de oplossing vaststellen, maar doorgaans is een standaardcurve vereist om de lineariteit van de test in het gemeten bereik vast te stellen.

Geautomatiseerde systemen zoals de QuBit ® 2.0 fluorometer (Life Technologies) kunnen worden gebruikt met een reeks verschillende op fluorescentie gebaseerde kwantificatie-assays voor het meten van de nucleïnezuurconcentratie in oplossing. De assays demonstreren een breed dynamisch bereik voor detectie en zijn in staat om kleine monsters nauwkeurig te analyseren.

Het is van cruciaal belang op te merken dat de OD-aflezing een maatstaf voor absorptie is en niet kan worden gebruikt als een volledige evaluatie van de monsterkwaliteit. Evenzo bieden op fluorescentie gebaseerde systemen een maatstaf voor kwantiteit en niet voor kwaliteit. Deze kunnen bijvoorbeeld niet worden gebruikt als een test voor de integriteit van het monster en er moet ook een geschikte analyse worden uitgevoerd, zoals een capillaire elektroforese, gelresolutie of de 3'/5'-verhoudingsassay (zoals hieronder beschreven).


De stadia van de methode zijn lyseren, binden, wassen en elueren. [1] [2] Meer specifiek omvat dit de lysis van doelcellen om nucleïnezuren vrij te maken, selectieve binding van nucleïnezuur aan een silicamembraan, het wegwassen van deeltjes en remmers die niet aan het silicamembraan zijn gebonden, en elutie van het nucleïnezuur zuur, met als eindresultaat gezuiverd nucleïnezuur in een waterige oplossing.

Voor lysis moeten de cellen (bloed, weefsel, enz.) van het monster een behandeling ondergaan om het celmembraan te breken en het nucleïnezuur vrij te maken. Afhankelijk van het doelmateriaal kan dit het gebruik van detergens of andere buffers, proteïnasen of andere enzymen, verhitting tot verschillende tijden/temperaturen, of mechanische verstoring zoals snijden met een mes of homogenisator, met behulp van een vijzel en stamper, of kralen- kloppen met een kralenmolen.

Voor binding wordt vervolgens een bufferoplossing toegevoegd aan het gelyseerde monster samen met ethanol of isopropanol. Het monster in bindingsoplossing wordt vervolgens overgebracht naar een spinkolom en de kolom wordt ofwel in een centrifuge geplaatst of aan een vacuüm bevestigd. De centrifuge/vacuüm dwingt de oplossing door een silicamembraan dat zich in de spinkolom bevindt, waar onder de juiste ionische omstandigheden nucleïnezuren zich aan het silicamembraan zullen binden, terwijl de rest van de oplossing er doorheen gaat. Met het doelmateriaal gebonden, kan de doorstroming worden verwijderd.

Om te wassen wordt een nieuwe buffer toegevoegd aan de kolom en vervolgens gecentrifugeerd/vacuüm door het membraan. Deze buffer is bedoeld om de bindingsomstandigheden te handhaven, terwijl de bindingszouten en andere resterende verontreinigingen worden verwijderd. Over het algemeen duurt het meerdere wasbeurten, vaak met toenemende percentages ethanol/isopropanol, totdat het nucleïnezuur op het silicamembraan vrij is van verontreinigingen. De laatste 'wash' is vaak een droge stap om de alcohol te laten verdampen, zodat alleen gezuiverde nucleïnezuren aan de kolom gebonden zijn.

Ten slotte is elutie het proces waarbij een waterige oplossing aan de kolom wordt toegevoegd, waardoor het hydrofiele nucleïnezuur de kolom kan verlaten en naar de oplossing kan terugkeren. Deze stap kan worden verbeterd met zout, pH, tijd of warmte. Ten slotte wordt de kolom, om het eluaat/eluens te vangen, overgebracht naar een schoon microbuisje voorafgaand aan een laatste centrifugatiestap.

Zelfs vóór de nucleïnezuurmethoden die tegenwoordig worden gebruikt, was het bekend dat in aanwezigheid van chaotrope middelen, zoals natriumjodide of natriumperchloraat, DNA zich bindt aan silica, glasdeeltjes of aan eencellige algen, diatomeeën genaamd, die hun celwanden afschermen met silica. Deze eigenschap werd gebruikt om nucleïnezuur te zuiveren met behulp van glaspoeder of silicaparels onder alkalische omstandigheden. [3] Dit werd later verbeterd door guanidiniumthiocyanaat of guanidiniumhydrochloride als chaotropisch middel te gebruiken. [4] Voor het gebruiksgemak werd het gebruik van glasparels later veranderd in silicakolommen. En om het gebruik van geautomatiseerde extractie-instrumenten mogelijk te maken, was er de ontwikkeling van met silica beklede paramagnetische kralen, beter bekend als "magnetische kralen"-extractie.


DNA is het meest oplosbaar in de waterfase

Dus wat heeft dit te maken met de scheiding van DNA en eiwit?

Over het algemeen lossen polaire (geladen) verbindingen het beste op in polaire oplosmiddelen en niet-polaire moleculen lossen het beste op in minder polaire of niet-polaire oplosmiddelen.

DNA is een polair molecuul vanwege de negatieve ladingen op zijn fosfaatruggengraat, dus het is zeer goed oplosbaar in water en minder in fenol. Dit betekent dat wanneer het water (+DNA +eiwit) en fenol worden gemengd in het protocol, het DNA niet oplost in de fenol, maar in de waterfase blijft.


Wat maakt een goede buffer?

In 1966 gingen Norman Good en collega's op zoek naar de beste buffers voor biochemische systemen (Good et al. 1966). Good heeft verschillende criteria voor dergelijke buffers uiteengezet:

  • een pKeen tussen 6 en 8. De meeste biochemische experimenten hebben een optimale pH in het bereik van 6&ndash8. Het optimale bufferbereik voor een buffer is de dissociatieconstante van de zwakzure component van de buffer (pKeen) plus of min pH-eenheid.
  • Oplosbaarheid in water. Biologische reacties vinden voor het grootste deel plaats in waterige omgevingen en de buffer moet om deze reden in water oplosbaar zijn.
  • Uitsluiting door biologische membranen. Dit is niet voor alle biochemische reacties van belang. However, if this is an important criterion for your particular experiment, it is helpful to remember that zwitterionic buffers (positive and negative charges on different atoms within the molecule) do not pass through biological membranes. Examples of zwitterionic buffers include MOPS and HEPES Tris and phosphate buffers do not isomerize into zwitterions.
  • Minimal salt effects. In other words, the buffer components should not interact or affect ions involved in the biochemical reactions being explored.
  • Minimal effects on the dissociation from changes in temperature and concentration. Usually there is some change in the dissociation with a change in concentration. If this change is small, stock solutions usually can be diluted without changing the pH. However, with some buffers, changes in concentration have more effect on dissociation, and stock solutions cannot be diluted without significantly affecting pH.
    For instance, the pH of Tris decreases approximately 0.1 pH unit per tenfold dilution, and the pH could change dramatically if you dilute a working solution and are at the limits of the optimal buffering range of the Tris (optimal buffering range pH 7.3&ndash9.3 at 20°C). Note that Tris is not one of Good&rsquos buffers.
    Temperature changes can be a problem too. Tris exhibits a large shift in dissociation with a change in temperature. For example, if you prepare a Tris buffer at pH 7.0 at 4.0°C and perform a reaction in that same buffer at 37°C, the pH will drop to 5.95.
    If you have a Tris buffer prepared at 20°C with a pKeen of 8.3, it would be an effective buffer for many biochemical reactions (pH 7.3&ndash9.3), but the same Tris buffer used at 4°C becomes a poor buffer at pH 7.3 because its pKeen shifts to 8.8.
    So the take-home message: Make the buffer at the temperature you plan to use it, and if your experiment involves a temperature shift, select a buffer with a range that can accommodate any shift in dissociation as a result.
  • Minimal interactions between buffer components and critical reaction components. If a complex forms between the buffer and a required cofactor, say a metal cation like zinc or magnesium, your reaction also might be compromised. For example calcium precipitates as calcium phosphate in phosphate buffers. Not only would any Ca 2+ -requiring reactions be compromised, but the buffering capacity of the phosphate buffer also is affected.
    Having excessive amounts of a chelating agent in the buffer for an enzymatically driven reaction could cause problems (e.g., a high concentration of EDTA in a PCR amplification). Citrate is a calcium chelator, so avoid citrate buffers in situations where calcium concentrations are critical.
    Tris buffers again give us problems because Tris contains a reactive amine group. If you are trying to make Tris buffer that is RNase-free, the amine group on the Tris molecule will react with diethylpyrocarbonate (DEPC), the chemical typically used to pretreat aqueous solutions used for RNA work. So, do not DEPC-treat Tris-containing solutions. HEPES is another buffer that reacts with DEPC. (Remember too, that MOPS is a much better buffer for most RNA work!)
    Take-home message: Buffers are not inert. Be careful which ones you chose.
  • Chemical stability. The buffer should be stable and not break down under working conditions. It should not oxidize or be affected by the system in which it is being used. Try to avoid buffers that contain participants in reactions (e.g., metabolites).
    Some buffers, such as MOPS, must be protected from light, but when they are stored properly they are still extremely useful buffers in biochemical reactions and laboratory protocols like RNA electrophoresis.
  • Light absorption. The buffer should not absorb UV light at wavelengths that may be used for readouts in photometric experiments.
  • Ease of Use. The buffer components should be easy to obtain and prepare.

Mooi zo et al. defined several characteristics of buffers for biochemical reactions. No matter what buffer you choose, you need to consider effects of temperature and environment on the buffer and ensure that the buffer is compatible with your system.


Introduction to Single-Cell RNA Sequencing

During the last decade, high-throughput sequencing methods have revolutionized the entire field of biology. The opportunity to study entire transcriptomes in great detail using RNA sequencing (RNA-seq) has fueled many important discoveries and is now a routine method in biomedical research. However, RNA-seq is typically performed in "bulk," and the data represent an average of gene expression patterns across thousands to millions of cells this might obscure biologically relevant differences between cells. Single-cell RNA-seq (scRNA-seq) represents an approach to overcome this problem. By isolating single cells, capturing their transcripts, and generating sequencing libraries in which the transcripts are mapped to individual cells, scRNA-seq allows assessment of fundamental biological properties of cell populations and biological systems at unprecedented resolution. Here, we present the most common scRNA-seq protocols in use today and the basics of data analysis and discuss factors that are important to consider before planning and designing an scRNA-seq project. © 2018 by John Wiley & Sons, Inc.

trefwoorden: RNA sequencing gene expression profiling single-cell analysis.


Bekijk de video: Protocol 1 - DNA Extraction Part 1 (Januari- 2022).