Informatie

Zijn er eiwitten die mRNA:RNA-polymerase of mRNA:ribosoomcomplex stabiliseren?


Actinomyceten staan ​​bekend om hun vermogen om een ​​rijke verscheidenheid aan natuurlijke producten te produceren, en in het bijzonder polyketiden. Veel van de genen die coderen voor de biosyntheseroutes zijn behoorlijk groot, aangezien ze 20 kb kunnen bereiken. Deze bacteriën hebben hoogstwaarschijnlijk een soort mechanisme dat zorgt voor een efficiënte transcriptie en translatie van deze lange ORF's. Dit kan op twee manieren: ofwel door het mRNA:RNA-polymerasecomplex te stabiliseren, ofwel door het mRNA:ribosoomcomplex te stabiliseren. Heeft iemand van jullie gehoord van dergelijke mechanismen in bacteriën?


Ik heb informatie over dit onderwerp gezocht omdat ik vroeger op het gebied van eiwitbiosynthese werkte, maar zonder succes. Een argument tegen de neiging van ribosomen om van mRNA af te vallen, is echter het zeer specifieke mechanisme voor ribosoomafgifte nadat het stopcodon is bereikt (hier beschreven).

Er zijn andere mogelijke problemen met zeer lange mRNA's:

  • Mogelijke afbraak van (prokaryotisch) mRNA tijdens een lange translatietijd. Ik kan me voorstellen dat het mRNA structurele kenmerken zou moeten bevatten die zijn levensduur verlengen.
  • Mogelijke verkeerde vouwing en precipitatie van het eiwitproduct voordat het hele eiwit is voltooid. Ik denk dat er waarschijnlijk chaperonne-eiwitten zijn die hydrofobe regio's beschermen of het vouwen van domeinen stimuleren om dit te voorkomen.

Als voetnoot wordt aangenomen dat het langste mRNA dat is voor het spiereiwit titine. De assemblage van dat op het sarcomeer zou bijvoorbeeld niet typisch zijn voor polyketiden, maar andere problemen die men tegenkomt, kunnen vergelijkbaar zijn.


Er is inderdaad een gen, nusG genaamd, waarvan wordt aangenomen dat het de antiterminator van RNA-transcriptie is. NusG bindt aan RNA-polymerase, wat leidt tot een verhoogde RNA-elongatiesnelheid, een kortere tijd waarin het polymerase zich in kortstondige gepauzeerde toestanden bevindt en onderdrukte langlevende gestabiliseerde pauzetoestanden.

Van NusG is aangetoond dat het belangrijk is voor de ontdekking van natuurlijke producten en biosynthese:

Overexpressie van nusG in C. cellulolyticum maakte de isolatie mogelijk van zeven nieuwe analogen van closthioamide, genaamd closthioamides B-H86. Deze nieuwe verbindingen zijn afgeknotte en gedeeltelijk O-gesubstitueerde derivaten van de antibacteriële oorspronkelijke hexathioamideverbinding, maar hebben een aanzienlijk lagere antibacteriële activiteit.

Verder wordt een nusG-achtig gen gevonden in het Myxococcus xanthus-gencluster dat codeert voor myxovirescine (TA)-antibioticum. Een van de voor polyketide coderende genen in dit cluster is ~27kb lang [3]:

  1. Herbert, K.M. et al. E. coli NusG remt backtracking en versnelt pauzevrije transcriptie door voorwaartse translocatie van RNA-polymerase te bevorderen. J. Mol. Biol. 399, 17-30 (2010)

  2. Peter J. Rutledge & Gregory L. Challis. Ontdekking van microbiële natuurlijke producten door activering van stille biosynthetische genclusters. Natuurbeoordelingen Microbiologie 13, 509-523 (2015)

  3. http://mibig.secondarymetabolites.org/repository/BGC0001025/index.html#cluster-1


Primair transcript

EEN primaire transcriptie is het enkelstrengs ribonucleïnezuur (RNA) product dat wordt gesynthetiseerd door transcriptie van DNA en verwerkt om verschillende rijpe RNA-producten op te leveren, zoals mRNA's, tRNA's en rRNA's. De primaire transcripten die worden aangeduid als mRNA's worden gemodificeerd ter voorbereiding op translatie. Bijvoorbeeld, een voorloper mRNA (pre-mRNA) is een type primair transcript dat na verwerking een boodschapper-RNA (mRNA) wordt.

Pre-mRNA wordt gesynthetiseerd uit een DNA-sjabloon in de celkern door transcriptie. Pre-mRNA omvat het grootste deel van heterogeen nucleair RNA (hnRNA). Zodra pre-mRNA volledig is verwerkt, wordt het "mature messenger RNA" of eenvoudigweg "messenger-RNA" genoemd. De term hnRNA wordt vaak gebruikt als synoniem voor pre-mRNA, hoewel hnRNA in strikte zin nucleaire RNA-transcripten kan bevatten die niet eindigen als cytoplasmatisch mRNA.

Er zijn verschillende stappen die bijdragen aan de productie van primaire transcripten. Al deze stappen omvatten een reeks interacties om de transcriptie van DNA in de kern van eukaryoten te initiëren en te voltooien. Bepaalde factoren spelen een sleutelrol bij de activering en remming van transcriptie, waar ze de productie van primaire transcripten reguleren. Transcriptie produceert primaire transcripten die verder worden gewijzigd door verschillende processen. Deze processen omvatten de 5'-cap, 3'-polyadenylatie en alternatieve splicing. In het bijzonder draagt ​​alternatieve splicing direct bij aan de diversiteit van mRNA dat in cellen wordt aangetroffen. De modificaties van primaire transcripten zijn verder bestudeerd in onderzoek naar meer kennis van de rol en betekenis van deze transcripten. Experimentele studies op basis van moleculaire veranderingen in primaire transcripten en de processen voor en na transcriptie hebben geleid tot een beter begrip van ziekten waarbij primaire transcripten betrokken zijn.


Het vergroten van de afstand tussen de Shine-Dalgarno-sequentie en het P-Site-codon vermindert de snelheid van mRNA-translocatie

mRNA Shine-Dalgarno (SD) -sequenties reguleren de verlenging van de translatie.

Het verlengen van de spacer tussen de SD-sequentie en het P-site-codon destabiliseert mRNA-tRNA-ribosoominteracties.

Het verlengen van de spacer tussen de SD-sequentie en het P-plaatscodon remt mRNA-translocatie.

Door basenparende interacties te vormen met het 3'-uiteinde van 16S-rRNA, vergemakkelijken mRNA Shine-Dalgarno (SD) -sequenties die stroomopwaarts van open leesramen zijn gepositioneerd, de translatie-initiatie. Tijdens de verlengingsfase van eiwitsynthese stimuleren intragene SD-achtige sequenties ribosoomframeshifting en kunnen ze ook ribosoombeweging langs mRNA vertragen. Hier laten we zien dat de lengte van de spacer tussen de SD-sequentie en het P-site-codon de snelheid van ribosoomtranslocatie sterk beïnvloedt. Het vergroten van de spacerlengte tot meer dan 6 nt destabiliseert mRNA-tRNA-ribosoominteracties en resulteert in een 5- tot 10-voudige verlaging van de translocatiesnelheid. Deze waarnemingen suggereren dat tijdens translatie de spacer tussen de SD-sequentie en het P-plaatscodon structurele herschikkingen ondergaat, die de mRNA-translocatie vertragen en mRNA-frameshifting bevorderen.


RESULTATEN

De homologie van PTB1 en PTB2 met de zoogdier-PTB

Inspectie van de T. brucei genoom onthulde verschillende eiwitten die mogelijk zouden kunnen deelnemen aan de regulatie van trans-splitsing (Liang et al. 2003). Twee eerder geïdentificeerde eiwitten, DRBD3 en DRBD4, lijken op de zoogdier-PTB (De Gaudenzi et al. 2005). Op basis van deze homologie hebben we DRBD3 hernoemd als PTB1. Dit eiwit is geannoteerd in GeneDB als Tb09.211.0560. We hebben DRBD4 omgedoopt tot PTB2, die is geannoteerd als Tb11.01.5690. Om verder aan te tonen dat deze eiwitten in feite zijn: T. brucei PTB-homologen, we vergeleken de structuur van T. brucei eiwitten aan de menselijke PTB-eiwitten ( <"type":"entrez-protein","attrs":<"text":"NP_002810.1","term_id":"4506243">> NP_002810.1 en nPTB <"type ":"entrez-protein","attrs":<"text":"NP_067013.1","term_id":"10863997">> NP_067013.1). Een schematische vergelijking van hun vermeende domeinstructuur wordt gegeven in Figuur 1A, en de identiteit en gelijkenis van de RRM-domeinen van de menselijke eiwitten met ofwel PTB1 ofwel PTB2 worden getoond in Figuur 1B. De posities van de RRM-domeinen in de eiwitten zijn aangegeven in de kaders en pijlen verbinden de residuen die in elk domein verwant zijn. De gegevens in figuur 1 suggereren dat de RRM 1 en RRM 2 van T. brucei PTB1 zijn meestal gerelateerd aan overeenkomstige RRM's van menselijke eiwitten PTB en nPTB RRM1, RRM 2 en RRM 3 van T brucei PTB2 lijkt het meest op RRM1, RRM3 en RRM4 van menselijke eiwitten PTB en nPTB. T. brucei PTB2 bevat niet de menselijke RRM2-homoloog. Er is een rudimentair RRM-domein op posities 98� van het eiwit dat het meest lijkt op RRM 2 van het menselijke eiwit. In feite kon de domeindatabase (gebaseerd op de programma's SMART, FPAM, PROSITE en INTERPROSCAN) geen RRM2-homoloog domein detecteren. Pas toen we het programma SMART gebruikten, met de sequentie van aminozuren 98�, werd dit domein geïdentificeerd als een RRM-domein, zij het met een relatief slechte score. We noemden dit divergente domein RRM X.

Schematische weergave van de vergelijking tussen de menselijke PTB (PTB1 en nPTB) en Tb PTB (PTB1 en PTB2). De aminozuursequentie van de zoogdiereiwitten PTB1 ( <"type":"entrez-protein","attrs":<"text":"NP_002810.1","term_id":"4506243">> NP_002810.1) en nPTB ( <"type":"entrez-protein","attrs":<"text":"NP_067013.1","term_id":"10863997">> NP_067013.1) werden vergeleken met trypanosoom PTB1 (Tb09.211.0560 ) en PTB2 (Tb11.01.5690) met behulp van het programma pBLAST (Altschul et al. 1997) en Psi BLAST (Altschul et al. 1997). Om de verwantschap van elk van de RRM-domeinen van de zoogdiereiwitten met de overeenkomstige trypanosoomsequenties te onderzoeken, werden de programma's SMART, FPAM, PROSITE en INTERPROSCAN gebruikt. De positie van de RRM-domeinen van zoogdieren was gebaseerd op gegevens van Wagner en Garcia-Blanco (2001). (EEN) Vergelijking tussen de RRM-domeinen. Elk RRM-domein is omkaderd. De aminozuren die verwant zijn tussen de PTB-eiwitten zijn met pijlen verbonden en de exacte posities staan ​​buiten de doos. (B) De verwantschap (identiteit en gelijkenis) tussen de RRM-domeinen wordt getoond tussen de PTB-eiwitten gespecificeerd in EEN.

Vervolgens hebben we het hele genoom doorzocht, evenals de lijst met alle RRM-bevattende eiwitten in T. brucei (De Gaudenzi et al. 2005) met de menselijke PTB-isovormen (aangegeven in Fig. 1). De twee eiwitten die bovenaan de lijst verschenen waren PTB2 (7e �) en PTB1 (3e �).

Silencing door RNAi van PTB1 en PTB2 toont aan dat beide factoren essentieel zijn voor groei

Om de rol van PTB-eiwitten in het metabolisme van trypanosoom-RNA te onderzoeken, en in het bijzonder om te bepalen of deze factoren een rol spelen bij trans- en cis-splitsing werd de expressie van deze genen tot zwijgen gebracht door RNAi. PTB1 en PTB2 werden geamplificeerd uit het genoom en er werden stam's02013loop-constructen ontworpen. De constructen waren samengesteld uit een stam van 479 basenparen (bp) voor PTB1 en een 443-bp stuurpen voor PTB2, en beide droegen een stuffer afgeleid van Pex sequenties (Wang et al. 2000). Deze constructen werden stroomafwaarts van een door tetracycline gereguleerde EP-promoter gekloond en gebruikt om te transfecteren T. brucei (29-13) die de tetracycline-repressor en T7-polymerase tot expressie brengen (Wang et al. 2000). Gekloneerde cellen die de constructen tot expressie brengen, werden geselecteerd op fleomycine. Figuur 2A toont de groei van de PTB1 en PTB2 tot zwijgen gebrachte cellen, wat een duidelijke vermindering van de celgroei aantoont bij het tot zwijgen brengen van elk van deze factoren. Hoewel de groei van beide PTB1 en PTB2 tot zwijgen gebrachte cellen werden geremd, PTB2 tot zwijgen gebrachte cellen werden ernstiger getroffen. Het verschil kan het gevolg zijn van het effect op de verwerking of stabiliteit van verschillende subsets van mRNA's door deze twee factoren (zie hieronder). De vermindering van de overeenkomstige mRNA's en eiwitten in de tot zwijgen gebrachte cellen wordt weergegeven in figuur 2, B en C. De resultaten wijzen op inductie van de productie van dsRNA en een verlaging van 80% tot 100% van het niveau van de overeenkomstige mRNA's.

(EEN) PTB1 en PTB2 zijn essentiële genen. De groei van niet-geïnduceerde cellen (−Tet) werd vergeleken met cellen die waren geïnduceerd voor dsRNA-productie (+Tet). Het aantal cellen in de niet-geïnduceerde culturen wordt aangeduid met zwarte diamanten en het aantal in de geïnduceerde culturen, door grijze vierkanten. (B) Noordelijke analyse van PTB1 en PTB2 bij RNAi-uitschakeling. RNA werd bereid uit niet-geïnduceerde cellen en cellen na 3 dagen inductie. Totaal RNA (20 μg) werd gescheiden op een 1,2% agarose𠄲.2 M formaldehydegel. Het RNA werd geblot en gehybridiseerd met een willekeurig gelabelde probe die specifiek is voor de twee genen. Het niveau van 7SL-RNA (controle voor gelijke belading) werd gedetecteerd door hybridisatie met het anti-sense 7SL-RNA-oligonucleotide. De identiteit van de transcripties wordt aangegeven. (C) Westerse analyse van de PTB-eiwitten (links). Hele celextract (30 μg) werd gescheiden op 12% SDS–polyacrylamide en onderworpen aan Western-analyse met behulp van anti-PTB-antilichamen (verdund 1: 10.000). Molecuulmassamarkers zijn aangegeven. Westerse analyse van het niveau van PTB-eiwitten bij silencing (Rechtsaf). Totale eiwitextracten van 2 tot 108 cellen van niet-geïnduceerde en tot zwijgen gebrachte cellen 3 dagen na inductie werden gescheiden op 12% SDS-polyacrylamidegels en onderworpen aan Western-analyse met behulp van anti-PTB1- en anti-PTB2-antilichamen (verdund 1: 10.000). Het niveau van hnRNP D0 werd gebruikt als controle voor gelijke belasting.

Antilichamen werden opgewekt tegen PTB1 en PTB2, zoals beschreven in Materialen en Methoden, en gebruikt om de verlaging van het niveau van eiwitten na silencing te onderzoeken. De specificiteit van de antilichamen werd onderzocht met behulp van T. brucei extracten van hele cellen, en de resultaten in figuur 2C (linker paneel) laten zien dat elk antilichaam slechts één enkel polypeptide herkent. Na het tot zwijgen brengen werd volledige eliminatie van het overeenkomstige eiwit waargenomen (Fig. 2C, rechter paneel). Deze resultaten suggereren dat het tot zwijgen brengen van PTB1 en PTB2 zeer efficiënt was en dat deze factoren essentieel zijn voor het leven.

Cellulaire lokalisatie en biochemische fractionering van PTB1 en PTB2

De lokalisatie van PTB-eiwitten werd bepaald door het PTB1 te fuseren met GFP, of door immunofluorescentie, met behulp van antilichamen tegen PTB2. De resultaten (Fig. 3A) tonen beelden van de gehele parasiet (lange blootstelling) en korte blootstelling van de kern (linkerhoek). De gegevens suggereren dat beide eiwitten voornamelijk gelokaliseerd zijn in de kern in spikkels, maar er werd ook een zwakke kleuring waargenomen in het cytoplasma.

(EEN) Lokalisatie van PTB1 en PTB2 in de cel. (Bovenste panel) Beeldvorming van cellen die het GFP-PTB1-construct tot expressie brengen. Cellen werden gefixeerd in 4% formaldehyde (paneel een) fluorescentie van PTB1-GFP (paneel B) kernen gekleurd met DAPI (C) DIC samenvoegen van panelen een en B. De beelden werden verkregen na lange blootstelling. Uitbreiding van het nucleaire gebied is ingelijst en werd verkregen met een kortere belichting. (Lager panel) Immunofluorescentie van PTB2. Cellen werden gefixeerd met 2% paraformaldehyde gedurende 25 min, geïncubeerd met antilichamen zoals beschreven in Materialen en Methoden, en gedetecteerd door een FITC-geconjugeerd secundair antilichaam. (Paneel een) Fluorescentie van het PTB2-eiwit (paneel B) kernen gekleurd met DAPI (paneel C) DIC samenvoegen van panelen een en B. De beelden werden verkregen na lange blootstelling. Uitbreiding van het nucleaire gebied is ingelijst en werd verkregen met een kortere belichting. (B) Fractionering van extracten door FPLC om de grootte van complexen te bepalen die zijn geassocieerd met PTB-eiwitten. Hele celextracten werden bereid uit oudercellen of uit cellen die het BB2-gelabelde Prp31-eiwit tot expressie brengen (Liang et al. 2006). Extract voorbereiding en kolomchromatografie worden beschreven in materialen en methoden. Eiwitten werden onderworpen aan westerse analyse met behulp van de relevante antilichamen (anti-BB2, anti PTB [deze studie], anti-U2AF65 [vriendelijk verstrekt door Dr. Mariano Levin, Institute for Genetic Engineering and Molecular Biology (INGEBI) en National Council of Science en Technologieonderzoek (CONICET)]). De identiteit van de onderzochte eiwitten wordt aangegeven. De elutieposities van de markereiwitten, BSA (66 kDa) en β-amylase (200 kDa), zijn aangegeven. (C) Co-immunoprecipitatie van PTB-eiwitten. Extract werd bereid uit 5 x 109 cellen en immunoprecipitatie werd uitgevoerd met de antilichamen zoals beschreven in Materialen en Methoden. De monsters werden onderworpen aan Western-analyse met behulp van PTB1- en PTB2-antilichamen. Eiwitten die geïmmunoprecipiteerd waren met PTB1 werden onderzocht met anti-PTB2 en vice versa. Totaal celextract en supernatant (5%) werden naast hele kralen geanalyseerd.

Vervolgens hebben we de verdeling van de factoren onderzocht door extracten te fractioneren die zijn afgeleid van wildtype T. brucei in het procyclische stadium of extracten van cellen die een BB2-gelabeld PRP31-eiwit dragen dat tot expressie wordt gebracht vanaf zijn authentieke plaats (Liang et al. 2006). Extracten werden bereid onder zoutarme omstandigheden (50 mM KCl) en gefractioneerd op een Superdex S-200 FPLC-kolom. De piekfracties van deze factoren waren verschillend (Fig. 3B). PTB1 werd meestal gevonden in fracties 22�, terwijl PTB2 werd gevonden in fracties 24�. Vanwege hun differentiële verdeling hebben deze factoren hoogstwaarschijnlijk geen interactie met elkaar. Om te verifiëren dat dit inderdaad het geval is, werden antilichamen tegen elk van deze eiwitten gebruikt in immunoprecipitatie-experimenten. De resultaten in figuur 3C tonen aan dat antilichamen tegen PTB1 PTB1 maar niet PTB2 immuniseerden, terwijl antilichamen tegen PTB2 PTB2 precipiteerden maar niet PTB1. Interessant is dat PTB1 en PTB2 ook niet fractioneren samen met verschillende van de algemene splitsingsfactoren zoals PRP31 of U2AF65. Desalniettemin ligt de grootte van de complexen die PTB1 of PTB2 dragen in het bereik van 66�-kDa, wat suggereert dat deze factoren waarschijnlijk geassocieerd zijn met andere splicing- of eiwitfactoren. Niettemin zijn de complexen gevormd met PTB1 en met PTB2 aanzienlijk kleiner dan die geassocieerd met PRP31 en U2AF65.

PTB1 en PTB2 zijn geen basale splitsingsfactoren, hoewel hun silencing het steady-state niveau van SL-RNA en de ontluikende transcriptie ervan beïnvloedt

We hebben eerder aangetoond dat silencing van basale splitsingsfactoren die de trans-splitsing van alle mRNA's resulteert in de verhoging van SL-RNA-niveaus, omdat het niet wordt gebruikt bij splitsing en zich daarom ophoopt in de cel (Mandelboim et al. 2003 Liu et al. 2004 Liang et al. 2006 Tkacz et al. 2007). Om te onderzoeken of de PTB1- en PTB2-eiwitten basale splitsingsfactoren zijn, werd het effect op het steady-state niveau van SL-RNA onderzocht door primerverlenging na PTB-uitschakeling. De resultaten gepresenteerd in figuur 4A suggereren dat silencing van beide factoren het steady-state niveau van SL-RNA met 30% en 60% verminderde in PTB1 en PTB2 respectievelijk tot zwijgen gebrachte cellen. Er werd geen effect op capping van het SL-RNA waargenomen, aangezien de verspringende stops op de cap-4-nucleotiden hetzelfde waren in niet-geïnduceerde cellen en in PTB1- of PTB2-arme cellen. om te onderzoeken of trans-splitsing in dezelfde mate wordt beïnvloed als de reductie van SL-RNA of drastischer, het niveau van het Y-structuurtussenproduct werd onderzocht met behulp van een oligonucleotide dat complementair is aan het introngedeelte van het SL-RNA. Indien trans-splitsing wordt beïnvloed bij de eerste stap van het splitsen, het niveau van de Y-structuur wordt verlaagd, maar als de reactie wordt beïnvloed in de tweede stap accumuleert de Y-structuur. De resultaten, weergegeven in figuur 4B, suggereren dat de verlaging van de niveaus van het Y-structuurtussenproduct (39% en 58%, voor respectievelijk PTB1 en PTB2) de verlaging van het niveau van steady-state SL-RNA weerspiegelt, wat suggereert dat geen van beide PTB1 noch PTB2 heeft invloed op de trans-splitsing van alle mRNA's de verlaging van het niveau van de Y-structuur correleert goed met de verlaging van het niveau van SL-RNA in de tot zwijgen gebrachte cellen. Experimenten die de mate van reductie in SL-RNA en het Y-structuurtussenproduct meten, werden drie keer herhaald en de resultaten van deze experimenten worden weergegeven in figuur 4C. Op dit moment kunnen we de mogelijkheid niet uitsluiten dat deze factoren de trans-splitsing van slechts een subset van mRNA's, maar de gegevens suggereren dat noch PTB1 noch PTB2 een algemene splitsingsfactor is die het niveau van het Y-structuurtussenproduct beïnvloedt. De defecten als gevolg van PTB2-uitschakeling zijn ernstiger dan die waargenomen voor PTB1. Deze verschillen kunnen niet worden toegeschreven aan verschillende gradaties van silencing, aangezien silencing in beide gevallen leidde tot volledige eliminatie van de eiwitten.

De niveaus van SL-RNA en Y-structuur liggen tussen PTB1 en PTB2 tot zwijgen brengen. (EEN) Het niveau van SL-RNA. Totaal RNA werd bereid uit cellen die de PTB-constructen droegen vóór inductie (−Tet) en na 3 dagen inductie (+Tet). Primerverlenging werd uitgevoerd op 10 μg RNA met radioactief gelabeld oligonucleotide dat complementair is aan het 3′ uiteinde van SL RNA (20708 vermeld in aanvullende tabel S-1). cDNA werd gescheiden op een 6% sequentiebepalingsgel. De positie van de aanslagen als gevolg van de verschillende dop nt is aangegeven op de links. Primerverlenging met U3 werd gebruikt om de hoeveelheid RNA in het monster te controleren. (B) Primerverlenging om het niveau van de Y-structuur tussenproduct te bepalen. hetzelfde als in EEN maar de 9091-primer werd gebruikt (vermeld in S-1). (C) Kwantitatieve analyse van het SL-RNA en de Y-structuur intermediair op PTB tot zwijgen brengen. Het niveau van de SL-RNA- en Y-structuur in de niet-geïnduceerde cellen wordt weergegeven in grijze balken en dezelfde waarden die zijn afgeleid van drie onafhankelijke silencing-experimenten worden gegeven in witte balken, de standaarddeviatie wordt weergegeven.

Vervolgens hebben we onderzocht of de verlaging van het niveau van SL-RNA tijdens het uitschakelen het gevolg is van transcriptie-uitschakeling van het SL-RNA. Hiertoe werd een permeabel celsysteem gebruikt (Tschudi en Ullu 1990 Ullu en Tschudi 1990). SL-RNA is het belangrijkste radioactief gemerkte transcript in dit systeem. De resultaten in figuur 5 geven een vermindering van 54% en 79% aan in het niveau van nieuw getranscribeerd SL-RNA als gevolg van PTB1 en PTB2 zwijgen, respectievelijk.

Ontluikende transcriptie in PTB1 tot zwijgen gebrachte cellen en PTB2 tot zwijgen gebrachte cellen. Permeabele cellen werden bereid uit hetzelfde aantal niet-geïnduceerde en PTB-gedempte cellen op de derde dag van het uitschakelen, zoals beschreven in de materialen en methoden. Het gemerkte RNA werd gefractioneerd op een 6% denaturerende gel. De identiteiten van de RNA's zijn aangegeven. Een kortere blootstelling van het SL-RNA wordt getoond op de Rechtsaf.

Het effect van PTB-eiwitten op het niveau van SL-RNA kan het gevolg zijn van een direct effect of een indirect effect. PTB-eiwitten kunnen bijvoorbeeld een interactie aangaan met de promotor of met het SL-RNA-transcriptiecomplex. PTB-eiwitten kunnen ook binden aan het ontluikende SL-RNA voordat het wordt geassembleerd met de Sm-eiwitten en zo de stabiliteit van het ontluikende SL-RNA beïnvloeden. Als alternatief kan het effect op SL-RNA-transcriptie een indirect effect zijn en kan een van de eiwitten die essentieel zijn voor SL-RNA-transcriptie worden gecodeerd door een kortlevend RNA waarvan het niveau wordt gereguleerd (verlaagd) in PTB-gedempte cellen.

Om mogelijke directe binding van PTB aan de SL-RNA-promoter te detecteren, werd een ChiP-assay uitgevoerd met behulp van antilichamen tegen de PTB-eiwitten. De resultaten (gegevens niet getoond) suggereren dat PTB niet direct associeert met het DNA van de SL-promotor. Vervolgens hebben we onderzocht of de verlaging van het opkomende SL-RNA-niveau het gevolg kan zijn van binding van deze eiwitten aan het opkomende SL-RNA, door in vitro UV-verknoping van PTB1-eiwit aan SL-RNA dat is gesynthetiseerd in permeabele cellen. De resultaten (gegevens niet getoond) suggereren dat een dergelijke verknoping niet kan worden waargenomen wanneer extracten van hele cellen werden gebruikt. Deze resultaten suggereren dat het effect van PTB op SL-RNA-niveaus waarschijnlijk niet primair is en mogelijk het gevolg is van neerwaartse regulatie van een tot nu toe niet-geïdentificeerde factor die ofwel functioneert in SL-RNA-transcriptie of stabilisatie van het ontluikende SL-RNA.

Microarray-analyse van RNA geïsoleerd uit PTB1- en PTB2- tot zwijgen gebrachte cellen suggereert differentiële effecten op het transcriptoom

Omdat de resultaten in figuur 4 suggereren dat noch PTB1 noch PTB2 een algemene splitsingsfactor is die de splitsing van alle mRNA beïnvloedt, hebben we geprobeerd te identificeren welke mRNA's specifiek en differentieel worden beïnvloed in cellen die uitgeput zijn voor PTB1 of PTB2. RNA werd bereid uit cellen na 3 dagen stilleggen en werd vergeleken met RNA van niet-geïnduceerde cellen.

Er werden drie biologische replica's uitgevoerd en gehybridiseerd met T. brucei microarrays beschreven in materialen en methoden. De gegevens werden geanalyseerd met behulp van GeneSpring GX-software (Agilent Technologies). Lowess-normalisatie werd uitgevoerd om te corrigeren voor kleurstofbias, en de genormaliseerde gegevens werden gebruikt om genen te identificeren waarvan de expressie significant bleek te zijn (P waarde π.05) omhoog of omlaag gereguleerd, met een willekeurige grenswaarde van minimaal 1,5-voudig. Een lijst van dergelijke genen vindt u in aanvullende tabel S-2. Om de verschillen in genexpressie in de PTB tot zwijgen gebrachte cellen, werd gemiddelde hiërarchische clustering van de koppeling uitgevoerd op de geselecteerde genen met behulp van Pearson-correlatie als een overeenkomstmaat, en werd een warmtekaart geconstrueerd die het verschil in het niveau van transcripten tussen niet-geïnduceerde en tot zwijgen gebrachte cellen weergeeft (Fig. 6). De resultaten tonen aan dat PTB1 en PTB2 het transcriptoom differentieel beïnvloeden, wat suggereert dat deze eiwitten verschillende subsets van mRNA's binden.

Warmtekaart van genen die differentieel tot expressie worden gebracht tussen PTB1- en PTB2- tot zwijgen gebrachte cellen ten opzichte van niet-geïnduceerde cellen. Transcripten die verschillen van het besturingselement met een ϡ,5-voudige verandering (P waarde π.05) gekozen voor de analyse. Elke kolom vertegenwoordigt het gemiddelde van drie biologische replica's. De warmtekaart is gegenereerd met behulp van Genspring GX-software (Agilent-technologieën) met behulp van het hiërarchische clusteringalgoritme voor gemiddelde koppeling en Pearson-correlatie als overeenkomstmaat. Het diagram geeft het differentiële expressieniveau weer volgens de volgende kleurenschaal: rood, opwaarts gereguleerde genen blauw, neerwaarts gereguleerde genen.

Aangezien PTB1 en PTB2 niet alleen de splicing beïnvloeden, maar ook de mRNA-stabiliteit (zie hieronder), werd de lijst van gereguleerde genen gescreend op de aanwezigheid van sequenties die rijk zijn aan polypyrimidine-kanalen in sequenties die de coderende sequentie flankeren aan zowel de 5′ als 3′ uiteinden van het ORF. Hiertoe werden 300 bp stroomopwaartse en 500 bp stroomafwaartse sequenties van elk gen opgehaald uit de GeneDB met behulp van de “list download” tool (http://www.genedb.org). De zoekopdracht werd uitgevoerd met behulp van een C-taalprogramma dat in eigen huis is geschreven (op verzoek verkrijgbaar bij de auteurs).

Het programma is ontworpen om te zoeken naar drie soorten sequenties: (1) sequenties die een optimaal polypyrimidine-kanaal dragen (als een splitsingssignaal), gedefinieerd als een stuk van ten minste tien T's met slechts één C toegestaan ​​(Benz et al. 2005) ( 2) polypyrimidine-kanalen die stukken T en C dragen, waar T overvloediger is, en ook PTB-bindingsplaatsen (TCTT en/of TCTCT) en (3) niet-optimale polypyrimidine-kanalen (als splitsingssignalen) die PTB-sequenties missen, en in waarbij T ten minste 59% van de reeks uitmaakt (Benz et al. 2005). Honderdzeventig genen bleken neerwaarts gereguleerd te zijn en 146 genen werden meer dan 1,5 keer opwaarts gereguleerd in PTB1 tot zwijgen gebrachte cellen vergeleken met controle. Hiervan dragen 49 van de neerwaarts gereguleerde genen en 36 van de opwaarts gereguleerde genen een niet-conventionele polypyrimidine-kanaal (PPT) -plaats met een PTB-bindingsplaats in hun stroomopwaartse regio, en worden weergegeven in aanvullende tabel S-3. 150 genen werden naar beneden gereguleerd en 214 genen werden meer dan 1,5 keer naar boven gereguleerd in PTB2 tot zwijgen gebrachte cellen vergeleken met controle. Van deze genen missen 46 van de neerwaarts gereguleerde genen en 51 van de opwaarts gereguleerde genen een canonieke PPT-site, die PTB-bindende sequenties in hun stroomopwaartse regio bevat, en worden weergegeven in aanvullende tabel S-4. De genen die worden vermeld in de aanvullende tabellen S-3 en S-4 zijn hoogstwaarschijnlijk genen die worden gereguleerd op het splitsingsniveau, terwijl de resterende transcripten hoogstwaarschijnlijk worden gereguleerd op het niveau van mRNA-stabiliteit (zie hieronder). Om te onderzoeken of transcripten worden gereguleerd door zowel PTB1 als PTB2, werd een Venn-diagram opgesteld. De resultaten duiden erop dat er geen significante overlap is tussen de transcripten die worden gereguleerd door de twee PTB-eiwitten (gegevens niet getoond), wat suggereert dat elke factor bindt aan een andere subset van transcripten .

Validatie van de microarray-gegevens

Om de door de Microarray verkregen resultaten te valideren, werden verschillende transcripten geselecteerd uit de lijst in aanvullende tabel S-2 van potentiële PTB1- en PTB2-substraten die omhoog of omlaag zijn gereguleerd. cDNA werd bereid uit het RNA met behulp van willekeurige primers. De hoeveelheid RNA in elk monster werd gekalibreerd door het niveau van tubuline te onderzoeken, een transcript waarvan het niveau niet was veranderd in PTB-gedempte cellen. De kandidaten werden geselecteerd op basis van hun vouwverandering tijdens silencing (meer dan 2,3-voudig), en alleen overvloedige mRNA's (gebaseerd op de intensiteit van hybridisatie in microarray-experimenten) werden geanalyseerd. We kozen ook liever voor genen die een duidelijke annotatie in het genoom hebben. De resultaten in figuur 7A vatten de validatie samen van vijf opwaarts gereguleerde transcripten en vier neerwaarts gereguleerde transcripten in PTB1 tot zwijgen gebrachte cellen, en die in figuur 7B vatten vier omhoog gereguleerde transcripten en vijf omlaag gereguleerde transcripten samen in PTB2 tot zwijgen gebrachte cellen. Deze resultaten bevestigen dat de microarray-gegevens inderdaad echte veranderingen in het transcriptoom weerspiegelen als gevolg van PTB-uitschakeling, en dat deze transcripten ofwel naar beneden of naar boven worden gereguleerd als gevolg van PTB uitputting. Om de specificiteit van het effect op deze verschillende transcripten aan te tonen, werd het niveau van PTB1-substraten onderzocht in PTB2-gedempte cellen en vice versa. De resultaten geven aan dat silencing van elk van de PTB-eiwitten specifiek een unieke subset van transcripten beïnvloedde, wat opnieuw het idee ondersteunt dat deze factoren op verschillende substraten werken.

Validatie van de microarray-gegevens door RT-PCR. cDNA werd bereid uit totaal RNA (1 μg) afgeleid van niet-geïnduceerde cellen (−Tet) of cellen na 3 dagen tot zwijgen brengen (+Tet), zoals beschreven in Materialen en Methoden. Een aliquot van het cDNA (1/50 tot 1/100) werd geamplificeerd door PCR met behulp van de genspecifieke primers (vermeld in aanvullende tabel S-1). De PCR-reactie werd geanalyseerd op 1% agarosegels en zichtbaar gemaakt door kleuring met ethidiumbromide. De hoeveelheid cDNA werd gekalibreerd door de hoeveelheid tubuline in het monster te meten. Voor elke reactie bepaalden we de lineariteit van de amplificatie door het cDNA te verdunnen. De gepresenteerde genen zijn die genen die significant omhoog of omlaag werden gereguleerd tijdens silencing (met ten minste 2,3-voudig in de microarray-gegevens). Als controle werd het niveau van deze transcripten onderzocht in RNA dat was geëxtraheerd uit cellen die tot zwijgen waren gebracht voor de andere PTB. (EEN) Opwaarts gereguleerde en neerwaartse gereguleerde genen in PTB1 tot zwijgen gebrachte cellen (B) als in EEN, maar voor PTB2 tot zwijgen gebrachte cellen. Het toegangsnummer en de annotatie van elk gen, gebaseerd op GeneDB, worden gepresenteerd.

Vervolgens hebben we onderzocht of de neerwaartse of opwaartse regulatie een direct gevolg is van binding van deze factoren aan de verwante mRNA's. De binding van PTB werd onderzocht door immunoprecipitatie van de transcripten met behulp van antilichamen tegen PTB1 en PTB2. Om de mRNA-eiwitinteracties te stabiliseren, werden de cellen blootgesteld aan UV-straling, werden extracten van de cellen bereid en werd het immunogeprecipiteerde RNA onderworpen aan RT-PCR om de relevante transcripten te detecteren. Als controle werd pre-immuunserum gebruikt. De resultaten gepresenteerd in Figuur 8 tonen selectieve binding van het PTB1 (Fig. 8A) en het PTB2 (Fig. 8B) aan de verwante transcripten waarvan de niveaus veranderden tijdens het tot zwijgen brengen. Van de geteste genen bleken er drie vals-positieven te zijn in twee van de drie (Tb927.4.5390 en Tb927.6.2640), hun veranderingen tijdens uitputting werden ook niet bevestigd door RT-PCR. Om de specificiteit van binding te verifiëren, werden PTB1-substraten onderzocht onder de mRNA's die werden geïmmunoprecipiteerd door anti-PTB2-antilichamen en vice versa. De resultaten tonen volledige specificiteit aan, aangezien er geen PTB1-substraten werden geïmmunoprecipiteerd met behulp van anti-PTB2-antilichamen en vice versa.

Identificatie van PTB1- en PTB2-substraten door immunoprecipitatie met verwante antilichamen. Een extract van hele cellen werd bereid uit 5 ° 109 oudercellen na 5 minuten UV-verknoping zoals beschreven in Materialen en Methoden. Immunoprecipitatie werd uitgevoerd met anti-PTB1, anti-PTB2 of controle-pre-immuunserum. RNA werd uit de korrels geëlueerd en samen met totaal RNA (invoer) werd geanalyseerd met RT-PCR. De primers die worden gebruikt voor amplificatie van de specifieke genen staan ​​vermeld in aanvullende tabel S-1. Het toegangsnummer en de annotatie van de genen op basis van GenDB worden gepresenteerd. Als controle werden PTB2-substraten onderzocht in de met PTB1 geïmmunoprecipiteerde mRNA's en vice versa zijn deze controletranscripten gemarkeerd met asterisken.

Voor elk transcript kan de verandering in het niveau van mRNA voortkomen uit een of meer mechanismen. PTB kan de transcriptie van mRNA, de stabiliteit van het mRNA of de splitsing van het pre-mRNA beïnvloeden. Een afname van het niveau van het transcript in tot zwijgen gebrachte cellen kan erop wijzen dat PTB essentieel is voor transcriptie, splitsing of transcriptstabilisatie. We kunnen echter niet uitsluiten dat het niveau van transcripten ook wordt beïnvloed door secundaire effecten. Een van de PTB-targets kan bijvoorbeeld op zichzelf een RNA-bindend eiwit zijn dat het niveau van andere substraten beïnvloedt. Er bestaat echter geen exacte overeenkomst met sequenties die aanwezig zijn in het silencing-construct in het genoom dat een ander gen dan de PTB-genen tot zwijgen zou kunnen brengen en dus een off-target effect zou kunnen genereren.

Hoewel transcriptionele regulatie (op initiatieniveau) geen grote rol lijkt te spelen bij genregulatie in trypanosomen, PTB silencing beïnvloedde de transcriptie van het SL-RNA. Het was daarom interessant om het effect van PTB silencing op de transcriptie van eiwitcoderende genen, en vergelijk het met de transcriptie van niet-eiwitcoderende genen die zijn getranscribeerd door polymerase I of III. PTB kan aan het DNA binden en de verlenging van de transcriptie beïnvloeden. Om te onderzoeken of PTB silencing beïnvloedt transcriptie, ontluikend RNA gesynthetiseerd in permeabele cellen werd gebruikt om slot-blots te onderzoeken die PCR-producten van transcripten dragen die veranderde niveaus in de PTB-gedempte cellen vertoonden. De resultaten (Fig. 9) laten zien dat in beide PTB1 tot zwijgen gebrachte cellen (Fig. 9A) en PTB2 tot zwijgen gebrachte cellen (Fig. 9B), was het effect op ontluikende transcriptie van eiwitcoderende mRNA's zeer bescheiden vergeleken met het effect ervan op SL-RNA-transcriptie. Merk op dat er geen verandering in transcriptie werd waargenomen voor transcripten waarvan de niveaus verhoogd waren tijdens het uitschakelen (gemarkeerd met pijlen). De resultaten tonen ook aan dat transcriptie-uitschakeling hoogstwaarschijnlijk specifiek is voor polymerase II, aangezien het meest significante effect werd waargenomen voor polymerase II-transcripten en er geen effect werd waargenomen op transcriptie van rRNA (getranscribeerd door polymerase I) of U2-snRNA, dat getranscribeerd in trypanosomen door polymerase III (Nakaar et al. 1994). We kunnen echter niet uitsluiten dat PTB zich bindt aan bepaalde DNA-sequenties langs het genoom en de transcriptie-verlenging van dergelijke loci beïnvloedt. Desalniettemin konden we dergelijke loci niet detecteren in ons beperkte scherm voor PTB-substraten.

Ontluikende RNA-synthese in PTB1 en PTB2 tot zwijgen gebrachte cellen. Permeabele cellen werden bereid uit niet-geïnduceerde cellen (−Tet) en cellen na 3 dagen PTB1- en PTB2-uitschakeling (+Tet) zoals beschreven in Materialen en Methoden. RNA werd gebruikt voor hybridisatie met een slot-blot die DNA bevat dat codeert voor de genen, zoals aangegeven. (EEN) PTB1 (B) PTB2. De identiteit van de genen wordt gegeven door hun toegangsnummer. Als controle werd het zoogdier SIRT-gen gebruikt. De opwaarts gereguleerde genen op basis van de array zijn aangegeven met pijlen.

PTB1 en PTB2 beïnvloeden de stabiliteit van verschillende sets mRNA's

Bij zoogdieren bleek PTB de stabiliteit van mRNA te regelen door te binden aan de 3′ UTR (Soderberg et al. 2002 Kosinski et al. 2003 Tillmar en Welsh 2004). Om te onderzoeken of PTB1 en PTB2 op dezelfde manier de stabiliteit van hun substraten reguleren, werd de halfwaardetijd van PTB1- en PTB2-doeltranscripten onderzocht. Er werden twee PTB1-doelen geselecteerd: AATP11 (Tb927.4.4730), die codeert voor een aminozuurtransporter waarvan de expressie naar beneden wordt gereguleerd bij PTB-silencing, en een transcript dat codeert voor een hypothetisch eiwit, HP2690 (Tb11.01.2690), waarvan het niveau omhoog wordt gereguleerd tijdens het stilzetten (Fig. 7A). Voor PTB2 zijn de volgende transcripties geselecteerd: AQP3 coderen voor een waterkanaal aquaporine (Tb927.6.1520), die down-gereguleerd is, en PDE (pyruvaatdehydrogenase Tb10.389.0890) waarvan het niveau omhoog wordt gereguleerd in PTB2tot zwijgen gebrachte cellen (Fig. 7B). Om de halfwaardetijd van het mRNA tijdens silencing te meten, werden niet-geïnduceerde cellen en cellen 3 dagen na inductie geconcentreerd. Na een paar minuten herstel werden de cellen behandeld met sinefungin, waarvan werd aangetoond dat het remt trans-splitsing en om te helpen bij het afsluiten van mRNA-productie, daarom verbetert dit middel de kwaliteit van experimenten die de halfwaardetijd van mRNA's bepalen (Colasante et al. 2007). Sinefungin werd gedurende 10 minuten aan de cellen toegevoegd, daarna werd actinomycine D toegevoegd en op de aangegeven tijdstippen werd RNA uit de cellen geëxtraheerd. Northern-analyse werd uitgevoerd met gebruikmaking van de aangegeven probes.Dezelfde membranen werden gehybridiseerd met een probe die specifiek is voor 7SL-RNA. Het niveau van de mRNA's werd gemeten door densitometrie en de halfwaardetijd werd berekend om te normaliseren naar het niveau van 7SL-RNA. Zoals te zien is in figuur 10A, is de halfwaardetijd van AATP11 mRNA was verlaagd van 43 naar 22 min, terwijl de halfwaardetijd van HP2690 werd verhoogd van 10 naar 100 minuten in PTB1 tot zwijgen gebrachte cellen. De halfwaardetijd van AQP3 werd verlaagd van 80 min tot 20 min, en die van PDE werd verhoogd van 40 min tot 75 min in PTB2 tot zwijgen gebrachte cellen (Fig. 10B). De resultaten in figuur 10 werden drie keer herhaald en elk tijdstip wordt weergegeven met de bijbehorende standaarddeviatie. Deze resultaten suggereren dat beide PTB-eiwitten de stabiliteit van mRNA's beïnvloeden door ze te stabiliseren of te destabiliseren. Interessant is dat de vouw verandert in AATP11 niveaus in tot zwijgen gebrachte cellen overschrijdt de waargenomen verandering in de halfwaardetijd van het overeenkomstige mRNA, wat suggereert dat PTB zijn regulatie op dit transcript kan uitoefenen via aanvullende mechanismen (zie hieronder).

PTB1 en PTB2 reguleren de halfwaardetijd van mRNA's. Northern-analyse van mRNA-niveaus. Niet-geïnduceerde en PTB1-uitgeputte cellen (3 dagen na inductie) werden behandeld met sinefungine (2 μg/mL) en, na 10 min, met Actinomycin D (30 μg/mL). RNA werd bereid op tijdstippen die boven de lanen zijn aangegeven, gescheiden op een 1,2% agaroseformaldehydegel en onderworpen aan Northern-analyse met de aangegeven genspecifieke probes. 7SL-RNA werd gebruikt om te controleren op gelijke belading. (EEN) PTB1 (B) PTB2. De hybridisatiesignalen getoond in de bovenste panel werden gemeten door densitometrie. De vervalcurven worden weergegeven onder de blots en de halfwaardetijd wordt geïllustreerd door de onderbroken lijnen. Het verval bij afwezigheid van inductie (−Tet) wordt aangegeven door zwarte ruiten bij inductie (+Tet), door grijze vierkanten.

Deze resultaten laten zien dat de transcripten differentieel worden beïnvloed, waarbij de amplitude van de regulatie varieert van een twee- tot tienvoudig verschil. PTB1- en PTB2-eiwitten zouden echter een PPT-domein moeten herkennen dat is verrijkt met PTB-bindingsplaatsen, dus wordt verwacht dat de verwante transcripten dergelijke plaatsen bevatten, en er zou een consensus-bindingsplaats moeten bestaan. Om naar dergelijke sequenties te zoeken, werd een meervoudige uitlijning uitgevoerd met behulp van ClustalW (//npsa-pbil.ibcp.fr/cgi-bin/npsa_automat.pl?page=/NPSA/npsa_server.html). Een reeks van 41 transcripten die PPT-sequenties droegen die waren aangetast in PTB1 tot zwijgen gebrachte cellen en 98 transcripten die waren aangetast in PTB2 tot zwijgen gebrachte cellen werden gekozen voor de analyse. Aangezien deze bindingsplaatsen gemakkelijk werden gedetecteerd op de 3′ UTR, werden alleen 3′ UTR-sequenties gebruikt om de dataset te genereren. De sequentie-uitlijning wordt weergegeven in aanvullende tabel S-5. De gemarkeerde sequenties bevatten een of twee PTB-bindingsplaatsen die zijn ingebed in de PPT.

PTB1 en PTB2 zijn essentieel voor: trans-splitsing van transcripten die C-rijke polypyrimidine-kanalen dragen

Zoals hierboven aangegeven, werden transcripten zoals AATP11 neerwaarts gereguleerd voorbij de effecten die kunnen worden toegeschreven aan mRNA-stabiliteit, wat suggereert dat PTB ook op het niveau van splitsing kan werken. Deze observatie bracht ons ertoe de 5′ UTR te inspecteren van genen die naar beneden werden gereguleerd als gevolg van PTB1 of PTB2 tot zwijgen brengen. We identificeerden transcripten die geen consensus PPT hebben, met voornamelijk U's, maar PTB-sites bezitten die C-rijk zijn. Zes transcripten werden gekozen en hun AG-splitsingsplaats werd bepaald door het specifieke mRNA te amplificeren met behulp van RT-PCR met een anti-sense-primer die zich dicht bij de eerste AUG- en SL-sense-primer bevindt. De sequentie stroomopwaarts van de AG-splitsingsplaats van zes genen wordt getoond in figuur 11A, de vermeende PPT's zijn omkaderd en cursief weergegeven. Inspectie van de sequenties suggereert dat in deze transcripten de afstand tussen de AG en de PPT 10� nucleotiden (nt) is, wat in de meeste gevallen langer is dan het eerder waargenomen gemiddelde van 25 nt (Benz et al. 2005). De verhouding van U/C is 1,52 vergeleken met 2 gevonden in de meeste transcripten (Benz et al. 2005). Bovendien werd een PTB-bindingsplaats gevonden ingebed in elk van de PPT-plaatsen. Om te onderzoeken of de trans-splitsing van deze transcripten wordt beïnvloed onder PTB silencing werden de niveaus van het rijpe en pre-mRNA bepaald na PTB-silencing door RT-PCR. Aangezien U2AF65 bindt aan PPT-sites (Zamore et al. 1992), was het van belang om te bepalen of de trans-splitsing van deze PPT C-rijke transcripten is ook afhankelijk van de aanwezigheid van U2AF65. De T. brucei U2AF65 is onlangs beschreven en is groter dan zijn zoogdierhomoloog. Het interageert met SF1 maar niet met U2AF35 en beïnvloedt de eerste stap van de trans-splitsingsreactie (Vazquez et al. 2009). Daartoe is de trans-splitsing van de zes transcripten werden onderzocht in PTB1 tot zwijgen gebrachte cellen, PTB2 tot zwijgen gebrachte cellen, en U2AF65 tot zwijgen gebrachte cellen. De resultaten (Fig. 11B) suggereren dat in vijf van de transcripten, trans-splitsing was verstoord in PTB1 tot zwijgen gebrachte cellen of PTB2 tot zwijgen gebrachte cellen, wat suggereert dat de trans-splitsing van deze transcripten hangt af van de aanwezigheid van PTB1 of PTB2. Om te controleren op specificiteit en de hoeveelheid RNA die in de reacties werd gebruikt, gebruikten we tubuline-mRNA als controle, aangezien het niveau van dit transcript niet verandert na PTB1- of PTB2-uitschakeling. Voor U2AF65, werd het niveau van 7SL-RNA gebruikt voor normalisatie, aangezien U2AF65 een algemene splitsingsfactor is die de trans-splitsing van alle genen. De resultaten in figuur 11 suggereren daarom dat PTB-eiwitten naast, en niet in plaats van, U2AF65 functioneren, aangezien trans-splitsing van dezelfde zes transcripten vereiste de aanwezigheid van functioneel U2AF65 voor juiste trans-splitsen.

Analyse van genen waarvan trans-splitsing wordt gereguleerd door de PTB-eiwitten. (EEN) De sequentie stroomopwaarts van de AG-splitsingsplaats is aangegeven, en de sequenties van de AG zijn vetgedrukt en onderstreept, de PPT-sequentie cursief en omkaderd, en de vermeende PTB-bindingsplaatsen binnen de PPT-sequenties zijn vetgedrukt. Het toegangsnummer en de regeling door PTB1 of PTB2 worden aangegeven. (B) RT-PCR om het niveau van pre-mRNA en volwassen mRNA onder te bepalen PTB1, PTB2, en U2AF65 tot zwijgen brengen. cDNA werd bereid uit niet-geïnduceerde cellen of uit cellen na 3 dagen stilleggen. De kalibratie van de hoeveelheid cDNA werd uitgevoerd met behulp van het tubuline-gen. RT-PCR werd uitgevoerd zoals beschreven in Materialen en Methoden. De primers die worden gebruikt om het pre-mRNA en het rijpe RNA te amplificeren, worden vermeld in aanvullende tabel S-1. De PCR-producten werden gescheiden op 1% agarosegels en gekleurd met ethidiumbromide. De toegangsnummers van de genen worden gegeven. Als controle voor de hoeveelheid cDNA in elk monster, werd de hoeveelheid tubuline bepaald voor RNA uit PTB1 en PTB2 tot zwijgen gebrachte cellen en de hoeveelheid 7SL-RNA in RNA van U2AF65 tot zwijgen gebrachte cellen.

Omdat PTB bij zoogdieren een splitsingsrepressor is, hebben we in de dataset van opwaarts gereguleerde genen gezocht naar genen die een C-rijke PPT-site dragen. Eén zo'n transcript (nummer 6 in de lijst, Tb11.01.3580) werd geïdentificeerd, en inderdaad, het tot zwijgen brengen van PTB1 verbeterde zijn trans-splitsing, wat suggereert dat de PTB1 kan dienen als een splitsingsrepressor of als activator. Er kunnen veel meer van dergelijke transcripten voorkomen onder transcripten die een PTB-bindingsplaats in hun PPT hebben, en waarvan het niveau tijdens het uitschakelen wordt verhoogd.

Identificatie van de AATP11 PTB1-bindingsplaatsen in vivo en in vitro

Om te verifiëren dat PTB bindt aan de vermeende bindingsplaatsen aangegeven in figuur 11A, AATP11 substraat werd gebruikt voor verdere analyse. Recente studies suggereren dat dit gen in hoge mate tot expressie wordt gebracht in het procyclische stadium van de parasiet en wordt gereguleerd via mRNA-stabiliteit, gedicteerd door sequenties die aanwezig zijn in de 3′ UTR van het gen (Robles en Clayton 2008). De volgorde van AATP11 en de positie van de PPT ten opzichte van de AG-splitsingsplaats worden weergegeven in figuur 12A (EST <"type":"entrez-nucleotide","attrs":<"text":"AF009707","term_id":"2735809" >> AF009707). Er werd een RNase-beschermingstest uitgevoerd om te onderzoeken: trans- splicing defecten van AATP11 in PTB1 tot zwijgen gebrachte cellen. De resultaten (Fig. 12B, paneel c) tonen accumulatie van de voorloper en reductie in het rijpe aan AATP11 als gevolg van PTB1-uitschakeling.

In vivo en in vitro analyse van AATP11, een gen waarvan de splitsing wordt gereguleerd door PTB1. (EEN) Schematische weergave van de AATP11 vertaling. De AG-splitsing en de PPT zijn onderstreept. De in de PPT geïntroduceerde base-substituties zijn aangegeven met pijlen. (B) RNase-bescherming van AATP11 vertaling. Schematische weergave van de sondes die worden gebruikt voor RNase-bescherming van de premature en volwassen AATP11 transcripties. (Paneel een) De probe die werd gebruikt om het wildtype transcript te beschermen, de verwachte grootte in nucleotiden van de rijpe en voorloper-beschermde fragmenten zijn aangegeven. (Paneel B) Schematische weergave van de sonde die wordt gebruikt om de te beschermen AATP11 5′ regulerende eenheid gefuseerd met het luciferase-gen. De afmetingen van de rijpe en beschermde fragmenten zijn aangegeven. (Paneel C) Beschermde fragmenten van de AATP11 wildtype transcript. RNA werd onderworpen aan RNase-bescherming zoals beschreven in Materialen en Methoden, en de producten werden gescheiden op een 6% acrylamide𠄷 M-ureumgel. De beschermde fragmenten van niet-geïnduceerde cellen (−Tet) en cellen na 3 d inductie (+Tet) van PTB1 worden gepresenteerd. P geeft probe C aan, controle (er werd geen RNA toegevoegd aan het RNase-digestiemengsel) en M, marker (eindgelabeld pBR322 MspI-digest). De posities van de voorloper en rijpe AATP11 zijn aangegeven. (Paneel NS) RNase-bescherming van AATP11-luciferase-fused transcript. RNA werd bereid uit transgene parasieten die het luciferase-gen van de AATP11 5′-regulerende eenheid (pNS21b) tot expressie brengen. Expressie werd gevolgd in PTB1-cellen na 3 dagen stilleggen. De beschermde fragmenten werden gescheiden op een 6% acrylamide𠄷 M ureumgel. Een langere blootstelling van het beschermde fragment wordt weergegeven en aangegeven met pijlen. P geeft probe C aan, controle (er werd geen RNA toegevoegd aan de RNase-beschermingstest). (Paneel e) RNase-bescherming op AATP11-luciferase-fused transcript dat een PPT-mutatie draagt. hetzelfde als in NS maar het RNA werd bereid uit cellen die de PPT-mutatie dragen. (C) Eiwitten die cross-liked worden naar de AATP11 transcript en naar het transcript dat mutaties in de PPT-plaats draagt. (Rechts panel) Verknoping werd uitgevoerd zoals beschreven in Materialen en Methoden, met gebruikmaking van extracten van hele cellen in de aanwezigheid van toenemende hoeveelheden niet-gelabeld, niet-radioactief, concurrent AATP-11-transcript. (rijstroken) 14) Toenemende hoeveelheden ongelabeld wildtype AATP-11 (respectievelijk (0, 50, 100, 200 ng) 58) toenemende hoeveelheden niet-gelabeld, niet-radioactief AATP-11 dat de PPT-mutatie draagt ​​(respectievelijk 0, 50, 100, 200 ng) (baan 9) verknoping met recombinant PTB1. (Links) Westerse analyse. Het verknoopte materiaal werd onderworpen aan Western-analyse met anti-PTB1-antilichamen. (Rijbaan 1) Verknoping met behulp van recombinant eiwit (50 ng) (baan 2) verknoping met behulp van extract van hele cellen. De grootte van de eiwitmarker wordt aangegeven.

Vervolgens worden de 5′ flankerende sequenties van AATP11 werden gekloond in de pNS21b-vector (64 nt van 5′ UTR) met een extra 260 nt stroomopwaarts van de AG-splitsingsplaats, die de signalen draagt ​​die essentieel zijn voor trans-splitsing van het gen. De vector bevat dus een luciferasegen, waarvan de expressie afhangt van de 5′ flankerende sequenties van de AATP11 gen (Fig. 12B, paneel b). Het transcript wordt tot expressie gebracht vanaf de sterke EP-promoter (Siegel et al. 2005), en de 3′ UTR-sequenties zijn afgeleid van het EP-gen. Aangezien het gefuseerde transcript de authentieke 3′ UTR van het AATP11-gen mist, hangt het effect op de expressie dat in dit onderzoek wordt waargenomen uitsluitend af van de binding van PTB aan de AATP11 PPT-site.

Om te verifiëren dat de sequentie die 10 nt stroomopwaarts van de AG-splitsingsplaats aanwezig is en de PTB-bindingsplaats draagt, inderdaad de plaats is die de regulering van de splitsing van AATP11 door PTB1 werden de C's op deze plaats omgezet in U's, waardoor de PTB-bindingsplaatsen werden vernietigd. De structuur van het construct wordt getoond in Figuur 12B, paneel b, en de locatie van de mutaties die zijn geïntroduceerd in de PPT-plaats wordt getoond in Figuur 12A. Transgene parasieten die zowel het reportergen als de stengel'x02013loop dragen om het zwijgen op te leggen PTB1 werden gegenereerd. De verwerking van de AATP11 aan luciferase gefuseerd transcript werd onderzocht door RNase-bescherming. De resultaten gepresenteerd in Figuur 12B, d, tonen aan dat, net als het wildtype gen, de AATP11-luciferase-splitsing was afhankelijk van PTB1, omdat in tot zwijgen gebrachte cellen een vermindering van rijp RNA en de accumulatie van voorloper werden waargenomen. De regulatie door PTB1 ging echter verloren in cellen die het gemuteerde PPT-kanaal dragen, aangezien het gemuteerde AATP11 transcript vertoonde geen enkele afhankelijkheid van PTB1 voor splitsing (Fig. 12B, e). In feite waren de mRNA-niveaus niet verlaagd, maar enigszins verhoogd. Deze gegevens suggereren dat de PPT die de PTB-bindingsplaats draagt ​​en rijk is aan C's inderdaad de bindingsplaatsen zijn die PTB1-regulatie verlenen aan AATP11.

Om de directe binding van PTB aan de AATP11 substraat werd het pre-mRNA geïncubeerd met ofwel recombinant PTB1 ofwel extract van hele cellen en blootgesteld aan UV-verknoping. Na RNase-digestie blijft de radioactiviteit alleen geassocieerd met eiwitten die aan het gelabelde RNA waren gebonden. De resultaten van een dergelijk experiment zijn weergegeven in figuur 12C. Een van de eiwitten die verknoopt raakten met AATP11 is PTB1, aangezien een eiwit dat migreerde met hetzelfde molecuulgewicht als recombinant PTB1 werd geïdentificeerd toen pre-mRNA werd verknoopt met eiwitten die aanwezig zijn in extract van hele cellen. De identificatie van de PTB1-band in extract van hele cellen werd geverifieerd door Western-analyse (Fig. 12C, linkerpaneel). Bovendien was de verknoping met dit eiwit (gemarkeerd met een pijl) verminderd wanneer niet-gelabelde pre-AATP11 werd toegevoegd aan de reactie (reductie tot 24% binding na toevoeging van 200 molaire overmaat van het ongelabelde RNA), maar niet wanneer ongelabeld gemuteerd AATP11, zonder de PTB-plaatsen, werd gebruikt voor competitie (reductie tot 85% binding na toevoeging van 200 molaire overmaat van het niet-gelabelde RNA) (Fig. 12C). Deze resultaten tonen duidelijk directe binding van PTB aan de AATP11 substraat op de voorgestelde PTB1-bindingsplaats. Merk op, dat een dergelijke binding aan AATP11 werd ook gedetecteerd wanneer anti-PTB1-antilichamen werden gebruikt om PTB-substraten te immunoprecipiteren (Fig. 8A).

PTB1 maar niet PTB2 is essentieel voor: cis-splitsen

Aangezien is aangetoond dat PTB invloed heeft op: cis-splitsing bij zoogdieren en bleek niet alleen te binden aan de PPT stroomopwaarts van de 3′ splice site, maar ook aan de 5′ splice site regio, onderzochten we of PTB ook essentieel is voor cis-splitsen. Hiertoe zijn twee bekende substraten die ondergaan: cis-splitsing werden onderzocht. De resultaten in figuur 13 tonen door middel van RT-PCR (met behulp van tubuline om de hoeveelheid RNA te controleren) aan dat splitsing van zowel poly A-polymerase (PAP) en ATP-afhankelijke DEAD/H RNA-helicase (ADRH) werden aangetast in de tot zwijgen gebrachte cellen, aangezien in beide genen reductie van het rijpe RNA werd waargenomen, met duidelijke accumulatie van de voorloper. Inspectie van de PPT van deze genen suggereert dat hun sites conventioneel zijn. De aanwezigheid van een PTB-bindingsplaats werd waargenomen in de buurt van de 5'02032 splitsingsplaats, in het geval van PAP, of in meerdere posities in het intron, in het geval van ADRH (Zie aanvullende tabel S-6). Interessant geen effect op cis-splitsing werd waargenomen in PTB2 tot zwijgen gebrachte cellen (Fig. 13).

cis-splitsing van poly A-polymerase (PAP) en ATP-afhankelijke DEAD/H RNA-helicases (ADRH) wordt gereguleerd door PTB1 maar niet door PTB2. Niveaus van PAP- en ADRH-precursor en rijp mRNA gedetecteerd door RT-PCR. cDNA werd bereid zoals beschreven in Materialen en Werkwijzen. cDNA werd gebruikt voor PCR-analyse met de primers vermeld in aanvullende tabel S-1. Schematische weergave van de in de reactie gebruikte primers en verwachte PCR-producten worden geïllustreerd op de links. De PCR-reacties werden geanalyseerd op een 1% agarosegel. (Links) Analyse van PTB1 tot zwijgen gebrachte cellen. cDNA van niet-geïnduceerde cellen (−Tet) en cDNA van PTB1 tot zwijgen gebrachte cellen 3 d na inductie (+Tet). (Rechts) Analyse van PTB2 tot zwijgen gebrachte cellen. cDNA van niet-geïnduceerde cellen (−Tet), en cDNA van PTB2 tot zwijgen gebrachte cellen 3 d na inductie (+Tet). Het niveau van tubulinetranscript werd gebruikt om de hoeveelheid cDNA in elk monster te controleren.


Degradatie

Verschillende mRNA's binnen dezelfde cel hebben verschillende levensduren (stabiliteiten). In bacteriële cellen kunnen individuele mRNA's van seconden tot meer dan een uur overleven. De levensduur is echter gemiddeld tussen 1 en 3 minuten, waardoor bacterieel mRNA veel minder stabiel is dan eukaryoot mRNA. ⎤] In zoogdiercellen varieert de levensduur van mRNA van enkele minuten tot dagen. ⎥] Hoe groter de stabiliteit van een mRNA, hoe meer eiwit er uit dat mRNA kan worden geproduceerd. De beperkte levensduur van mRNA stelt een cel in staat om de eiwitsynthese snel te veranderen in reactie op de veranderende behoeften. Er zijn veel mechanismen die leiden tot de vernietiging van een mRNA, waarvan er enkele hieronder worden beschreven.

Prokaryotische mRNA-afbraak

In het algemeen is de levensduur van mRNA bij prokaryoten veel korter dan bij eukaryoten. Prokaryoten degraderen berichten door een combinatie van ribonucleasen te gebruiken, waaronder endonucleasen, 3'-exonucleasen en 5'-exonucleasen. In sommige gevallen kunnen kleine RNA-moleculen (sRNA) van tientallen tot honderden nucleotiden lang de afbraak van specifieke mRNA's stimuleren door basenparing met complementaire sequenties en ribonuclease-splitsing door RNase III te vergemakkelijken. Onlangs is aangetoond dat bacteriën ook een soort 5'-kap hebben, bestaande uit een trifosfaat aan het 5'-uiteinde. ⎦] Verwijdering van twee van de fosfaten laat een 5'-monofosfaat achter, waardoor de boodschap wordt vernietigd door het exonuclease RNase J, dat 5' naar 3' degradeert.

Eukaryotische mRNA-omzet

Binnen eukaryote cellen is er een evenwicht tussen de processen van translatie en mRNA-verval.Berichten die actief worden vertaald, worden gebonden door ribosomen, de eukaryote initiatiefactoren eIF-4E en eIF-4G en poly(A)-bindend eiwit. eIF-4E en eIF-4G blokkeren het decapping-enzym (DCP2), en poly(A)-bindend eiwit blokkeert het exosoomcomplex, waardoor de uiteinden van de boodschap worden beschermd. De balans tussen translatie en verval wordt weerspiegeld in de grootte en overvloed van cytoplasmatische structuren die bekend staan ​​als P-lichamen. '9127'93 De poly(A)-staart van het mRNA wordt verkort door gespecialiseerde exonucleasen die door een combinatie op specifieke boodschapper-RNA's worden gericht. van cis-regulerende sequenties op het RNA en trans-werkende RNA-bindende eiwitten. Aangenomen wordt dat poly(A)-staartverwijdering de cirkelvormige structuur van de boodschap verstoort en het cap-bindingscomplex destabiliseert. Het bericht is dan onderhevig aan degradatie door ofwel het exosoomcomplex of het decappingcomplex. Op deze manier kunnen translationeel inactieve berichten snel worden vernietigd, terwijl actieve berichten intact blijven. Het mechanisme waarmee de vertaling stopt en de boodschap wordt doorgegeven aan vervalcomplexen wordt niet in detail begrepen.

AU-rijk elementverval

De aanwezigheid van AU-rijke elementen in sommige zoogdier-mRNA's heeft de neiging om die transcripten te destabiliseren door de werking van cellulaire eiwitten die aan deze sequenties binden en poly(A)-staartverwijdering stimuleren. Verlies van de poly(A)-staart zou de afbraak van mRNA bevorderen door de aanval door zowel het exosoomcomplex '9128'93 als het decappingcomplex te vergemakkelijken. ⎩] Snelle mRNA-afbraak via AU-rijke elementen is een cruciaal mechanisme voor het voorkomen van de overproductie van krachtige cytokines zoals tumornecrosefactor (TNF) en granulocyt-macrofaag-koloniestimulerende factor (GM-CSF). ⎪] AU-rijke elementen reguleren ook de biosynthese van proto-oncogene transcriptiefactoren zoals c-Jun en c-Fos. ⎫]

Onzin gemedieerd verval

Eukaryote berichten worden gecontroleerd door nonsense gemedieerd verval (NMD), dat controleert op de aanwezigheid van voortijdige stopcodons (nonsense codons) in het bericht. Deze kunnen ontstaan ​​door onvolledige splicing, V(D)J-recombinatie in het adaptieve immuunsysteem, mutaties in DNA, transcriptiefouten, lekkende scanning door het ribosoom dat een frameverschuiving veroorzaakt, en andere oorzaken. Detectie van een voortijdig stopcodon veroorzaakt mRNA-afbraak door 5'-decapping, 3'-poly(A)-staartverwijdering of endonucleolytische splitsing. ⎬]

Klein interfererend RNA (siRNA)

In metazoën worden kleine interfererende RNA's (siRNA's) die door Dicer worden verwerkt, opgenomen in een complex dat bekend staat als het RNA-geïnduceerde silencing-complex of RISC. Dit complex bevat een endonuclease dat perfect complementaire berichten splitst waaraan het siRNA bindt. De resulterende mRNA-fragmenten worden vervolgens vernietigd door exonucleasen. siRNA wordt vaak gebruikt in laboratoria om de functie van genen in celcultuur te blokkeren. Men denkt dat het deel uitmaakt van het aangeboren immuunsysteem als verdediging tegen dubbelstrengs RNA-virussen. ⎭]

MicroRNA (miRNA)

MicroRNA's (miRNA's) zijn kleine RNA's die meestal gedeeltelijk complementair zijn aan sequenties in metazoan messenger-RNA's. ⎮] Binding van een miRNA aan een bericht kan de vertaling van dat bericht onderdrukken en de verwijdering van poly(A)-staarten versnellen, waardoor de afbraak van mRNA wordt versneld. Het werkingsmechanisme van miRNA's is het onderwerp van actief onderzoek. ⎯]

Andere vervalmechanismen

Er zijn andere manieren waarop berichten kunnen worden afgebroken, waaronder non-stop verval en tot zwijgen brengen door onder andere Piwi-interacting RNA (piRNA).


Materialen en methodes

Bereiding van kippenhersenen en fibroblastextracten

Hersencytoplasmatisch extract werd bereid uit 12-d-oude kippenembryo's. Hele hersenen werden verwijderd en driemaal gewassen met buffer A (20 mM Tris Cl, 3 mM MgCl2, 40 mM KCl en 1 mM DTT, 0,7 g/ml leupeptine, 1 g/ml aprotinine, 0,7 g/ml pepstantine en 1 mM PMSF). Per gram nat doekje werd 1 ml buffer A toegevoegd en het mengsel werd gehomogeniseerd in een Teflon glashomogenisator. Homogenaten werden gedurende 10 minuten bij 5.000 gecentrifugeerd Gen het supernatant werd gedurende 2 uur bij 28.000 rpm in een Beckman SW-40.1-rotor gecentrifugeerd. Het supernatant met hoge snelheid werd ofwel onmiddellijk gebruikt of bewaard in porties bij -70°C. De eiwitconcentratie van het hersenextract was ∼10-20 g/μl. Om CEF-extract te bereiden, werden fibroblasten geïsoleerd uit borstspierweefsel van 11-d-oude kippenembryo's. Cellen werden gekweekt tot -95% confluentie (Kislauskis et al., 1994), en vervolgens geschraapt en gewassen in koude buffer A en gepelleteerd door centrifugatie (Ross et al., 1997). De cellen werden opnieuw gesuspendeerd in buffer A en gehomogeniseerd in een Dounce-homogenisator. Homogenaten werden gecentrifugeerd zoals hierboven beschreven. De eiwitconcentratie van het bereide extract was 5-10 g/μl.

Neuronale culturen

Primaire kweken van embryonale neuronen van de voorhersenen van kippen werden gegenereerd zoals eerder beschreven (Zhang et al., 1999). In het kort, voorhersenen werden ontleed uit 8-d kippenembryo's, getrypsiniseerd, gedissocieerd en uitgeplaat op poly-l-lysine- (0,2 mg/ml, 16 uur) en laminine- (0,02 mg/ml, 12 min) gecoate dekglaasjes in MEM met 10% FBS gedurende 2 uur. Cellen werden omgekeerd op een monolaag van kuikenastrocyten in N2-geconditioneerd medium met serum (0,2% FBS) en 4 dagen gekweekt bij 37°C in 5% CO2.

In vitro RNA-transcriptie

De pCZIP werd geconstrueerd door het invoegen van de 54-nucleotidencode van chick-actine-mRNA van kippen in een pSP64-Poly(A)-vector (Promega) op Hind III- en Aval-plaatsen. Om het pCZIPm-plasmide te construeren, werd het volgende paar complementaire oligo's gesynthetiseerd, gehybridiseerd en ingevoegd tussen Hind III- en Ava I-plaatsen van pSP64 Poly(A)-vector: Sense: 5' AGCTTACCGGACT-GTTACCATGTGTGTGTGTGCTGTGATGAAACAAAACCCATAAATGC 3' en antisense: 5'CCGGGCATTCATTA 3'CCGGGCATTTCATTA3' .

Voor gelmobiliteitsverschuivingsassays werd [32P]-gelabeld RNA gegenereerd door SP6 RNA-polymerase gerichte in vitro transcriptie van met Ava I gelineariseerd pCZIP-DNA. Het getranscribeerde RNA werd op gel gezuiverd met 6%. Voor RNA-affiniteitszuivering werden gepolyadenyleerde transcripten in vitro gesynthetiseerd met SP6-polymerase (MEGAScript-kit Ambion) uit EcoRI-gelineariseerde pCZIP-constructen. Sporenhoeveelheden [32P]-CTP werden toegevoegd om detectie en kwantificering van getranscribeerd RNA mogelijk te maken. Het getranscribeerde RNA bevatte de 54 nts pCZIP-RNA en een poly(A)-staart van 30 nts.

Gelmobiliteitsverschuivingstest en UV-verknoping

In het kort werd 105 CPM van de [32P]-gelabelde RNA-sonde gedurende 20 minuten bij kamertemperatuur geïncubeerd met 5 l hersen- of fibroblasteiwitextract in een 20 μl bindingsoplossing die 20 mM Hepes, pH 7,4, 50 mM KCl bevatte. , 3 mM MgCl2, 2 mM DTT en 5% glycerol. Ongebonden RNA's werden afgebroken door een incubatie van 10 minuten met 1 U RNase T1en niet-specifieke RNA-eiwit-interacties werden geminimaliseerd door incubatie met 5 mg / ml heparine gedurende 10 minuten. De gevormde RNA-eiwitcomplexen werden gescheiden in een 4% natieve gel en zichtbaar gemaakt door autoradiografie. Om de specificiteit van RNA-eiwit-interacties vast te stellen, werden competitie-assays uitgevoerd door het eiwitextract vooraf te incuberen met niet-gelabelde RNA-concurrenten.

UV-verknoping van RNA-eiwitcomplexen werd uitgevoerd door de reacties op ijs te bestralen in een UV-kamer (GS-genlinker Bio-Rad Laboratories) met 254-nm, 8-W UV-lampen gedurende 10 minuten en opgelost door 4% natieve gel. De UV-verknoopte RNA-eiwitcomplexen, gedetecteerd door autoradiografie, werden uit de gel gesneden, gemengd met SDS-laadbuffer en gedurende 30 minuten bij kamertemperatuur geïncubeerd met 10 U RNase T1. De gelplakjes werden op een 10% SDS-polyacrylamidegel geladen en aan elektroforese onderworpen om de RNA-eiwitcomplexen te onderscheiden.

Affiniteitszuivering van eiwitten die aan RNA binden

2 ml poly(U)-agaroseparels (type 6 Amersham Pharmacia Biotech) werden gesuspendeerd in RNA-bindingsbuffer (25 mM Tris HCl, pH 7,4, 100 mM KCl) en gepakt in een kolom van 10 ml. Ongeveer 1 mg in vitro gesynthetiseerd poly(A)-zipcode-RNA werd aan de kolom toegevoegd en viermaal gecycleerd. De efficiëntie van RNA gebonden aan poly(U)-agaroseparels werd gevolgd door het meten van de hoeveelheid [32P]-gelabeld RNA dat aanwezig was in het RNA-preparaat. Na binding werden de korrels geëquilibreerd met de extractbuffer, gemengd met 40 ml herseneiwitextracten of 20 ml fibroblastextracten die 50 E/ml RNasin (Promega) bevatten en gedurende 1 uur bij kamertemperatuur onder zacht schudden geïncubeerd. Om niet-specifieke eiwitbinding te verlagen, werden gist-tRNA en heparine toegevoegd tot respectievelijk 50 g/ml en 5 mg/ml aan bindingsbuffer. De kralen werden vervolgens gedurende 2 minuten bij 1000 gecentrifugeerd G, opnieuw gesuspendeerd in bindingsbuffer en opnieuw verpakt in een kolom van 10 ml. De kolom werd als volgt uitgebreid gewassen in 5 x 20 ml bindingsbuffer: (1) bindingsbuffer (2) bindingsbuffer + 40 g/ml gist-RNA (3) bindingsbuffer + 5 mg/ml heparine (4) bindingsbuffer + Alleen 0,1% Triton X-100 en (5) bindingsbuffer. Eiwitten die op de RNA-affiniteitskolom werden vastgehouden, werden stapsgewijs geëlueerd met 20 mM Hepes-buffer, pH 7,4, die 0,5, 1 en 2 M KCl bevat. De geëlueerde eiwitten werden geanalyseerd met SDS-PAGE en bandverschuivingsassay.

Productie van anti-ZBP2-antilichamen van ratten

De 2-M KCl-elutiefractie van de zipcode-affiniteitskolom werd geconcentreerd met een centricon-30-filter en geëlektroforeerd in 10% SDS-PAGE. Na kleuring met Coomassie-blauw werden de verwachte eiwitbanden uit de gel gesneden, fijngemaakt, gemengd met adjuvans en geïnjecteerd in ratten (Covance, Inc.) voor antilichaamproductie. De titer van het antiserum werd getest door middel van immunoblot.

Immunoblotting

Porties van eiwitten werden gescheiden in 10% SDS-PAGE en overgebracht op Zeta-membranen door een semi-droge transfererende blotter (Bio-Rad Laboratories). De membranen werden overnacht geblot met PBS dat 5% magere melk bevat bij 4°C en vervolgens 2 uur bij kamertemperatuur geïncubeerd met antiserum tegen ZBP2 (1:2.000) in PBS dat 1% BSA bevat. Na drie keer wassen met PBS/0,3% Tween-20 werden de membranen geïncubeerd met mierikswortelperoxidase geconjugeerde anti-rat antilichamen van geit (1:8.000), werd ZBP2 gedetecteerd met het ECL-systeem (Amersham Pharmacia Biotech) of met DAB/H2O2.

Immunoprecipitatie en -actine-mRNA-detectie

10 g gezuiverde antilichamen of 5 l antiserum tegen ZBP2 werden gedurende 1 uur bij 4°C onder zacht schudden geïncubeerd met 100 μl herseneiwitextract. 30 l proteïne G-gekoppelde agarosekorrels (Pierce Chemical Co.) werd aan het mengsel toegevoegd en nog 1 uur bij 4 ° C geïncubeerd. Na 5 min centrifugeren bij 1.500 G, het supernatant werd genomen voor immunoblotting en RNA-bandverschuivingsassays. Voor analyse van ZBP2 werden de tot korrels gevormde agaroseparels uitgebreid gewassen met PBS en werden de aan de parels gebonden eiwitten geëlueerd met 100 l ImmunoPure IgG Elution Buffer (Pierce Chemical Co.). Voor het detecteren van β-actine-mRNA werden de gepelleteerde agarosekorrels driemaal gewassen met DEPC-PBS, opnieuw gesuspendeerd in 100 l DEPC-water en 10 minuten gekookt. Totaal RNA werd uit het supernatant geëxtraheerd met behulp van TRIzol RNA-isolatiereagens (GIBCO BRL). RT-PCR voor β-actine-mRNA werd gedurende 20 cycli uitgevoerd met 1 l RNA als matrijs met behulp van ReadyToGo RT-PCR-kralen (Amersham Pharmacia Biotech). De volgende primers werden gebruikt voor amplificatie: 5' CTGACACCTTCACCATTCCAG 3' en 5' ATTGCTGACAGGATGCAGAAG 3'. Het verwachte PCR-product is een DNA-fragment van 398 bp van β-actine-mRNA in 3'UTR op de posities 1021-1419.

Isolatie en klonering van ZBP2 cDNA

Twee primers, zbp2-1 en zbp2-2, werden ontworpen en gesynthetiseerd volgens de twee peptidesequenties (respectievelijk ZBP2-aminozuren 621-627 en 685-709) en menselijke KSRP-cDNA-sequentie (zbp2-1 GCTTGGGAGGAGTACTACAA, zbp2-2 AGGACCTGGGGTCTGTCCGTA ): Een DNA-fragment van 200 bp werd geamplificeerd uit een bibliotheek van kippenembryo-hersenen (CLONTECH Laboratories, Inc.) en geverifieerd door sequentiebepaling. Dit fragment werd gebruikt voor het screenen van de kippenembryo-hersenbibliotheek. Twee cDNA-klonen werden uit de bibliotheekscreening geïsoleerd. Na sequentieanalyse was het duidelijk dat beide klonen een COOH-terminale coderende sequentie van 500 bp bevatten, gevolgd door 150 bp 3'-UTR. 5′ RACE PCR werd toegepast om een ​​NH . te verkrijgen2-terminaal fragment van ZBP2 (CLONTECH Laboratories, Inc.) RACE 4-primers werden gebruikt in het 5'-RACE-experiment (RACE6-1: CACGCGGCGTTGGGGTCGGCTGC, RACE7: TTATAGGCGGCCCA-CGCGGCGTTGG, RACEF1: GAACGCGTCCTTCCGGATCC, TTGGCGCGCTCATAATCTTTGCCGCTCATAATCTTTGC). De sequenties van DNA-fragmenten geamplificeerd door RACE werden bepaald door geautomatiseerde DNA-sequentieanalyses. Het gen van volledige lengte werd aan elkaar gesplitst door middel van PCR en bevestigd door sequencing.

In situ hybridisatie en immunocytochemie

In situ hybridisatie werd uitgevoerd op fibroblasten zoals beschreven door Kislauskis et al. (1993), en op neuronen zoals beschreven door Zhang et al. (1999). CEF's van 9 dagen oud werden gekweekt in MEM aangevuld met 10% FCS. Na 2 dagen op dekglaasjes te hebben gekweekt, werden de cellen gedurende 10 minuten in 4% paraformaldehyde in PBS gefixeerd en gedurende nog eens 10 minuten bij kamertemperatuur gepermeabiliseerd met 0, 5% Triton X-100. Distributie van ZBP2 in CEF's werd gevisualiseerd door incubatie van rattenantiserum tegen ZBP2 (1:800) gevolgd door Cy3- of FITC-geconjugeerde konijnen-anti-rat-antilichamen (1:500 Jackson ImmunoResearch Lab). Neuronen werden gedurende 2 of 4 dagen gekweekt in N2-geconditioneerde media met 2% foetaal runderserum (FBS) en gedurende 15 minuten bij kamertemperatuur gefixeerd in 4% paraformaldehyde in PBS. Na permeabilisatie met 0, 5% Triton X-100 werden de cellen geïncubeerd met rattenantiserum tegen ZBP2 (1:750) gevolgd door Cy3-gelabelde konijnen-anti-rat-antilichamen (1:750). Voor in situ hybridisatie en immunochemie werden cellen eerst verwerkt voor hybridisatie van β-actine-mRNA, gewassen met PBS en immunologisch gekleurd zoals eerder beschreven (Zhang et al., 1999). Cellen werden bekeken met een Olympus B × 60 met 60 × Plan Apo 1.4NA-doelstelling. Beelden werden verkregen met een gekoelde CCD-camera, bediend door Espirit-beeldvormingssoftware.

GFP-fusie-eiwitconstructies

Humaan KSRP-cDNA (de homoloog van kip ZBP2), een geschenk van D. Black (University of California in Los Angeles, Los Angeles, CA), werd gesubkloneerd naar pEGFP C1-vector (CLONTECH Laboratories, Inc.) bij de EcoRI en Hind III plaatsen. (pGFP-KSRP). Alle andere EGFP-fusieconstructen zijn ofwel volledige lengte ofwel ingekorte kip ZBP2. Het centrale domeinfragment dat aa-sequentie 103-650 bevat, inclusief de 47-aa-sequentie die uniek is voor ZBP2- en 4-KH-domeinen, werd geamplificeerd door PCR en gekloneerd in pEGFP-C1-vector op EcoRI- en Xbal-plaatsen om plasmide pGFP-CD te genereren. De 4-KH-domeinen van ZBP2 werden gekloneerd in pEGFP-C1-vector op de SalI- en XbaI-plaats om het construct pGFP-KH te produceren. De unieke sequentie van 47-aa werd geamplificeerd door PCR en geïntroduceerd in pEGFPC1 bij EcoRI Hind III (plaats pGFP-IN). Het COOH-terminale domein, inclusief van aminozuren 650 tot het stopcodon, werd uitgesneden uit het plasmide pBS-LS2 (geïsoleerd uit bibliotheekscreening) met behulp van EcoRI- en XhoI-plaatsen en gekloneerd in pEGFPC1-vector, waarbij pGFP-CT werd gegenereerd. ZBP2 van volledige lengte werd gekloneerd in pEGFPC2 (CLONTECH Laboratories, Inc.) op EcoRI- en Hind III-plaatsen om pGFP-FULL te genereren. De unieke sequentie van 47-aa werd verwijderd uit ZBP2 van volledige lengte door middel van tweestaps splitsings-PCR, en werd gekloneerd in pEGFPC2-vector door EcoRI- en HindIII-plaatsen om pGFP-Δ47 te genereren. Alle hierboven genoemde constructen werden geverifieerd door middel van DNA-sequencing.

Transfectie en beeldvorming van getransfecteerde cellen

CEF's werden gedurende 4-5 uur getransfecteerd met GFP-ZBP2-constructen met behulp van Qiagen's Effectene-reagens volgens het protocol van de fabrikant. Gekweekte neuronen werden getransfecteerd met DOTAP zoals beschreven (Zhang et al., 1999). GFP-beeldvorming met of zonder FISH werd uitgevoerd (Zhang et al., 1999). Voor CEF's werden de GFP- en β-actine-mRNA-signalen gevisualiseerd door fluorescentiemicroscopie met behulp van een Olympus B × 60-microscoop met een 60 × objectief, n.v.t. 1.4. Per dekglaasje werden ten minste 50 getransfecteerde cellen geteld voor de lokalisatie van β-actine-mRNA.

De EGFP/ZBP2-fusie uitgedrukt in neuronen werd geïdentificeerd met behulp van een fluorescentiemicroscopie (Nikon Eclipse omgekeerde microscoop) uitgerust met 60× Plan-Neofluar objectief, fase-optica, 100 W kwikbooglamp en HiQ-banddoorlaatfilters (ChromaTech). Fluorescentiebeelden werden onmiddellijk verkregen in een constante belichtingstijd (1 s) met een gekoelde CCD-camera die werd uitgevoerd door IP Lab-computersoftware. De omtrek van elke axonale dendrieten (eerste 30 m van het cellichaam) werd getraceerd met behulp van fasebeeld. Het interessegebied werd overgebracht naar het fluorescentiebeeld in dezelfde cel en de fluorescentie-intensiteit van β-actine-mRNA werd gemeten met IP Lab-software. De fluorescentie-intensiteit van ROI in niet-getransfecteerde cellen op het dekglaasje werd gemeten als normale controle. Meer dan 20 cellen in elke groep werden geanalyseerd.


Boodschapper-RNA (mRNA)

Messenger RNA (of mRNA) speelt de hoofdrol bij transcriptie, oftewel de eerste stap bij het maken van een eiwit uit een DNA-blauwdruk. Het mRNA bestaat uit nucleotiden die in de kern worden gevonden en die samenkomen om een ​​complementaire sequentie te vormen voor het DNA dat daar wordt gevonden. Het enzym dat deze mRNA-streng samenvoegt, wordt RNA-polymerase genoemd. Drie aangrenzende stikstofbasen in de mRNA-sequentie worden een codon genoemd en ze coderen elk voor een specifiek aminozuur dat vervolgens in de juiste volgorde aan andere aminozuren wordt gekoppeld om een ​​eiwit te maken.

Voordat mRNA naar de volgende stap van genexpressie kan gaan, moet het eerst enige bewerking ondergaan. Er zijn veel DNA-gebieden die niet coderen voor genetische informatie. Deze niet-coderende gebieden worden nog steeds getranscribeerd door mRNA. Dit betekent dat het mRNA deze sequenties, introns genaamd, eerst moet uitknippen voordat het kan worden gecodeerd tot een functionerend eiwit. De delen van mRNA die coderen voor aminozuren worden exons genoemd. De introns worden uitgesneden door enzymen en alleen de exons blijven over. Deze nu enkele streng genetische informatie is in staat om uit de kern en in het cytoplasma te gaan om het tweede deel van genexpressie, translatie genaamd, te beginnen.


Genexpressie


Coderingsinformatie in genomen wordt getranscribeerd in stappen die overeenkomen met een of enkele genen. Gencoderende en regulerende (cis-werkende) DNA-sequenties die transcriptie-initiatie, verlenging en terminatie sturen, worden gezamenlijk een transcriptie-eenheid genoemd. Prokaryote transcriptie-eenheden, operons genaamd, bevatten meer dan één gen, dat vaak codeert voor fysiologisch verwante eiwitten (Fig. 15-2A). Operons worden geflankeerd door sequenties die de initiatie en beëindiging van transcriptie aansturen.Figuur 15-2B toont een eenvoudige eukaryote transcriptie-eenheid die codeert voor de menselijke hemoglobine-β-keten. Hoewel slechts een kleine fractie van dit gebied codeert voor het β-globine-polypeptide, zijn de aangrenzende regulerende sequenties cruciaal voor de juiste expressie van β-globine. Genetische defecten die resulteren in een verminderde productie van β-globine worden -thalassemieën genoemd. Dergelijke mutaties kunnen optreden in het coderende gebied, wat resulteert in een onstabiel of afgeknot polypeptide, of in de aangrenzende controlegebieden, wat leidt tot lage niveaus van transcriptie of afwijkende verwerking van het nieuw gesynthetiseerde RNA (zie hoofdstuk 16). De transcriptie-eenheid kan dus worden gezien als een gekoppelde reeks modules, die allemaal functioneel moeten zijn om het gen op het juiste niveau te laten transcriberen.


Eukaryotisch ribosomaal RNA wordt gesynthetiseerd uit een reeks tandem herhaalde genen als een enkel molecuul, dat wordt gesplitst en gemodificeerd om de uiteindelijke 28S-, 5.8S- en 18S-RNA's te geven (Fig. 15-3). Deze worden samen met 5S-RNA en ongeveer 80 eiwitten geassembleerd tot ribosomen in de nucleolus. Transfer-RNA wordt in de kern gesynthetiseerd en naar het cytoplasma getransporteerd, waar het wordt geladen met aminozuren voordat het deelneemt aan de eiwitsynthese (zie hoofdstuk 17). snRNA's worden gesynthetiseerd en verwerkt in de kern. Van daaruit migreren ze naar het cytoplasma, waar ze essentiële eiwitten verwerven, en keren dan terug naar de kern, waar ze functioneren in de enzymatische reacties van RNA-verwerking (splitsing zie hoofdstuk 16). De postsynthetische verwerkingsroute die een bepaald transcript volgt, wordt gedeeltelijk gedicteerd door de transcriptiemachinerie die wordt gebruikt om het transcript te initiëren en te verlengen en door bepaalde kenmerken van het ontluikende RNA.


(B, met dank aan Yvonne Osheim, Universiteit van Virginia, Charlottesville.)


(B, PDB-bestand: 1I50. Referentie: Cramer P, Bushnell DA, Kornberg RD: Structurele basis van transcriptie: RNA-polymerase II met een resolutie van 2,8 angstrom. Science 292:1863-1876, 2001. D, Van Zhang G, Campbell EA, Minakhin L, et al: Kristalstructuur van Thermus aquaticus kern-RNA-polymerase met een resolutie van 3,3 A. Cell 98: 811-824, 1999.)


Het laden van RNA-polymerase op het dubbelstrengs genomische DNA bij een promotorsequentie wordt het best begrepen in prokaryoten en wordt eerst besproken vóór de bespreking van eukaryoten. De initiatie vindt plaats in een reeks gedefinieerde stappen (Fig. 15-1). Ten eerste bindt holo-enzym aan de dubbelstrengs promotor en vormt zo het zogenaamde gesloten complex. De specificiteit en sterkte van deze interactie worden bepaald door sequentiespecifieke contacten tussen de σ-factor en de basen in de -10- en -35-elementen van de promotor (Fig. 15-6). De tweede stap in de initiatie is de vorming van een open complex waarin een gebied van 14 bp rond de startplaats van de transcriptie ongepaard is en een transcriptiebel produceert. Deze ontkoppeling gaat gepaard met een conformationele verandering in het polymerase dat de enkelstrengs DNA-matrijs in de actieve plaats positioneert en de DNA-bindingsspleet vernauwt, waardoor de polymeraseklem effectief wordt gesloten. In de volgende stap wordt de DNA-matrijs in de actieve plaats basenparen met de eerste twee ribonucleotiden en wordt de eerste fosfodiesterbinding gekatalyseerd. Dit proces wordt herhaald totdat het ontluikende RNA een lengte van acht tot negen basen bereikt, op welk punt toevoeging van basen aan de groeiende RNA-keten resulteert in het ontkoppelen van één base van de RNA-DNA-hybride, en het ontluikende RNA begint te verlaten via een kanaal op het oppervlak van de polymerase. De resulterende conformationele verandering in polymerase leidt tot de afgifte van σ-factor en vorming van een stabiel ternair (drieweg) complex dat RNA-polymerase, de DNA-matrijs en het ontluikende RNA bevat.


De RNA-polymerase II-GTF's omvatten meer dan 20 polypeptiden met een geaggregeerd molecuulgewicht van meer dan 106 D (Tabel 15-1). Voordat RNA-polymerase II in vitro transcriptie kan initiëren, moet een geordende verzameling van factoren bij de promotor plaatsvinden. Assemblage van het pre-initiatiecomplex van RNA-polymerase II begint met de binding van TFIID, een grote factor (˜700 kD) bestaande uit TATA-box-bindend eiwit (TBP) en een reeks TBP-geassocieerde factoren die TAFII's worden genoemd (Fig. 15-7A) . TBP alleen is voldoende voor basale transcriptie, terwijl TAF's blijkbaar dienen als doelwitten voor verdere activering van transcriptie (zie volgende paragrafen). TBP is het eerste polypeptide in de basale transcriptiemachinerie dat een specifieke DNA-sequentie herkent tijdens het initiatieproces. DNA-binding wordt geleverd door een sterk geconserveerd C-terminaal 180-aminozuurdomein, dat een zadelvormig monomeer vormt met een dyade-symmetrie-as (Fig. 15-7B). De onderkant van het TBP "zadel" bindt aan de kleine groef van de TATA-reeks, die tijdens het proces open wordt gespreid. Een uitgesproken DNA-buiging wordt geproduceerd aan elk uiteinde van het TATAAA-element door de intercalatie van fenylalaninezijketens (Fig. 15-7C).


(B–D, PDB-bestand: 1VOL. TBP + DNA-coördinaten met dank aan Stephen Burley, Rockefeller University, New York.)


Resultaten

Identificatie van postcode-bindende eiwitten

Om eiwitten te identificeren die aan de postcode van β-actine-mRNA bonden, werden RNA-mobiliteitsverschuiving en UV-crosslinking-benaderingen gebruikt (Ross et al., 1997). Radioactief gemerkte postcodetranscripten werden gebruikt voor RNA-mobiliteitsverschuivingsassays. Drie verschillende RNA-eiwitcomplexen werden gevormd toen de gelabelde postcode-probe werd geïncubeerd met hersen- of fibroblastextracten (Fig. 1A, lanen 1𠄴-complexen zijn aangegeven met pijlen). De intensiteit van verschoven complexen was evenredig met de hoeveelheid hersenextract die werd gebruikt (lanen 1𠄳). Het snel migrerende complex (F) werd gezien in zowel hersen- als fibroblastextracten (respectievelijk lanen 3 en 4). De twee langzamer migrerende complexen (M en S) waren echter duidelijker in de hersenen dan in fibroblastextracten (lanen 3 en 4). De specificiteit van de complexen werd bepaald door competitie-assays waarin een 100-voudige overmaat van niet-gelabelde postcode concurreerde met de vorming van de complexen (baan 5), terwijl een 100-voudige overmaat van niet-gelabeld RNA getranscribeerd van pGEM 3Z-vector het complex niet stoorde formatie (ongepubliceerde gegevens).

Karakterisering van eiwitten die binden aan de postcode in kippenembryo-hersenen en fibroblastextracten. (EEN). Complexen gevormd uit hersenen en fibroblasten. [32P]-gelabelde transcripten die coderen voor de 54 nts postcode van de 3′ UTR van mRNA van kippen-actine werden geïncubeerd met hoeveelheden kippenembryo-hersenen en fibroblast-eiwitextracten, gevolgd door incubatie met RNase T1 (50 E/ml ) en heparine (5 mg/ml). RNA's eiwitcomplexen werden opgelost in natuurlijke gels van 4% polyacrylamide die vervolgens werden gedroogd en blootgesteld aan Kodak X-Ray-film. (Lanes 1, 2 en 3) [32P]-gelabeld transcript geïncubeerd met respectievelijk 1-, 2- en 5-μl hersenextracten. (Laan 4) [32P]-gelabeld transcript geïncubeerd met 5 fibroblastextract. (Laan 5) [32P]-gelabeld transcript geïncubeerd met 5-μl-hersenextract in aanwezigheid van 100-plus molaire hoeveelheden niet-gelabelde 3′ UTR van actine-mRNA-transcripten. De pijlen wijzen naar de langzame (S), medium (M) en snel migrerende (F) RNA-eiwitcomplexen. (B) specificiteit van de complexen voor de postcode. (Baan 1) Postcode geïncubeerd met hersenextract. (Baan 2) Mutant postcode geïncubeerd met hersenextract. (C) UV-verknopingstest. [32P]-gelabelde transcripten werden geïncubeerd met hersenextract, behandeld met RNase T1 en 3 minuten blootgesteld aan UV-licht op een afstand van 1 cm. Elk van de RNA-eiwitcomplexen (F, M en S) werd geïdentificeerd en uitgesneden uit een natuurlijke gel van 4% polyacrylamide, gedrenkt in SDS-buffer en opgelost in 10% SDS-PAGE. (Linker drie banen) Uitgesneden RNA-eiwitcomplexen F, M en S die niet UV-verknoopt waren. (Rechter drie rijstroken) Uitgesneden RNA-eiwitcomplexen F, M en S die waren verknoopt. De pijlen geven de eiwitmobiliteiten aan met gelabeld RNA gebonden.

Omdat een gemuteerde postcode het reporter-mRNA niet kon lokaliseren (Ross et al., 1997), redeneerden we dat de mutante postcode geen RNA-eiwitcomplex zou vormen. Om dit te testen, hebben we radioactief gemerkte mutante postcode gegenereerd waarin de twee ACACCC-motieven werden vervangen door GTGTGT, en we voerden RNA-mobiliteitsverschuivingstests uit met hersenextracten (Fig. 1B). In tegenstelling tot de wildtype postcode (baan 1), kon de mutante postcode geen RNA-eiwitcomplexen vormen (Fig. 1B, baan 2). Dit gaf aan dat eiwitten in het hersenextract niet binden aan de mutante postcode, en toonde aan dat een mutatie die de mRNA-lokalisatie belemmert, kan worden gecorreleerd met een verminderde binding van het RNA'x02013-bindende eiwit. Om de eiwitcomponenten die aan de postcode binden te onderscheiden, hebben we UV gebruikt om RNA-eiwitcomplexen te crosslinken die zijn gevormd door de radioactief gelabelde postcode te mengen met hersenextracten, en de complexen geanalyseerd met SDS-PAGE. Alle drie de RNA-eiwitcomplexen waren niet detecteerbaar zonder verknoping (Fig. 1 C, geen UV-X). Toen de RNA-eiwitcomplexen werden verknoopt en gestabiliseerd, werden specifieke banden zichtbaar gemaakt (UV-X). Complex F bevatte een verknoopt eiwit met een geschatte molecuulmassa van -68 kD, dezelfde molecuulmassa als ZBP1 (Ross et al., 1997). Complexen M en S (de met de hersenen verrijkte banden) bevatten een verknoopt eiwit met een geschatte molecuulmassa van � kD. Het migratieverschil van complexen M en S in natieve gel, en de identiteit in molecuulmassa op SDS-PAGE, suggereerde dat complex S een dimeer van complex M zou kunnen zijn. Uit deze gegevens concluderen we dat de 68- en 92-kD-eiwitten binden naar de postcode, het β-actine mRNA-lokalisatiesignaal. De 68-kD-band is waarschijnlijk ZBP1, maar de andere ZBP wordt bij voorkeur tot expressie gebracht in de hersenen. Het 92-kD-eiwit werd ZBP2 genoemd. Het feit dat ze segregeren in afzonderlijke complexen geeft aan dat ZBP1 en ZBP2 niet gelijktijdig aan de postcode binden.

Zuivering van ZBP's

Om het met de hersenen verrijkte eiwit te identificeren, hebben we ZBP's gezuiverd met behulp van RNA-affiniteitsselectietechnieken. We lieten hersen- of gekweekte fibroblastextracten over een affiniteitschromatografiekolom die postcode-RNA bevatte. Na uitgebreide wassingen werden de op de kolom achtergehouden eiwitten geëlueerd met toenemende zoutconcentratiestappen en geanalyseerd met SDS-PAGE met zilverkleuring (Fig. 2A). Hoewel het uitgangsextract en de doorstroomfractie heterogeen waren (Fig. 2 A, laan 1), werden na een reeks wassingen (lanen 2𠄵) specifieke eiwitten geëlueerd met toenemende zoutcondities (Fig. 2 A, lanen 7' x020139). De eiwitfractie die werd geëlueerd met 1 en 2 M KCl bevatte verschillende eiwitbanden (Fig. 2A, lanen 8 en 9, pijlen) drie eiwitten waren D kD en één was 92 kD. De geschatte molecuulmassa's kwamen nauw overeen met die van de UV-verknoopte RNA-eiwitcomplexen geïdentificeerd door SDS-PAGE (Fig. 1B). Een eiwit met een lagere molecuulmassa (53 kD) was ook eerder gedetecteerd (Ross et al., 1997).

Analyse van de eiwitten gefractioneerd door RNA-affiniteitschromatografie. (A) SDS-PAGE-analyse. Porties (30 °x003bcl) eiwitten in elke zuiveringsstap die uit de RNA-affiniteitschromatografie werden geëlueerd, werden opgelost in 10% SDS-PAGE. (Baan 1) Doorstroomfractie. (Lanes 2𠄶) Eiwitten in respectievelijk vijf opeenvolgende wasstappen. (Lanes 7𠄹) Eiwitten in respectievelijk 0,5, 1,0 en 2,0 KCl-elutiefracties. De molecuulmassa van het eiwit is op de juiste positie gemarkeerd. De kleine pijlen geven de vijf eiwitten aan waarvan de microsequentie is bepaald. (B) Gel shift-assay met behulp van de affiniteit geselecteerde eiwitten. Porties (5 x 003bcl) van elk zoals in A (fractie) werden geïncubeerd met 1 x 105 CPM [32P]-gelabeld zipcodetranscript en de gevormde complexen werden opgelost in 4% natieve gels. (C) Uitgangsmateriaal. De pijlen vertegenwoordigen de RNA-eiwitcomplexen die zijn geïdentificeerd in Fig. 1A.

Om te bepalen of eiwitten die uit de RNA-affiniteitskolom werden geëlueerd RNA-bindende activiteit bevatten, voerden we de bandmobiliteitsverschuivingstest uit door de radioactief gemerkte postcode te incuberen met eiwitten van elk van de zuiveringsstappen (Fig. 2B). In vergelijking met het uitgangsmateriaal (Fig. 2B, laan C), werd verhoogde RNA-bindingsactiviteit gedetecteerd in 1- en 2-M KCl-fracties (lanen 7 en 8). De RNA-bindende activiteit werd niet gevonden in de doorstroom (Fig. 2 B, baan 2), wasstappen (Fig. 2 B, banen 3𠄶) en 0,5-M KCl-fractie (Fig. 2 B, baan 6 ), wat aangeeft dat de RNA-bindende eiwitten waren verrijkt in de 1- en 2-M KCl-fracties na RNA-affiniteitszuivering. Verrassenderwijs werden, hoewel de 1- en 2-M KCl-fracties 92- en 68-kD-eiwitten bevatten, na incubatie met radioactief gemerkte postcode, alleen complexen M en S gevormd (Fig. 2B, lanen 8 en 9). De relatieve afwezigheid van complex F in de bandverschuivingsassay suggereerde ofwel dat het 68-kD-eiwit zijn RNA-bindende activiteit verloor in de hoge zout-elutieconditie, of dat de binding van het 68-kD-eiwit aan de postcode aanvullende eiwitten nodig heeft die niet aanwezig zijn of actief in de hoge zoutfractie.

Microsequencing van door affiniteit gezuiverde eiwitten

Eiwitten in de 2-M KCl-fractie van de RNA-affiniteitskolom (Fig. 2A, baan 9) werden geconcentreerd met een centricon-30-filter, opgelost in 12% SDS-PAGE en zichtbaar gemaakt door Coomassie-blauwkleuring. Vier eiwitbanden van �, 70, 65 en 45 kD werden uit de gel geëlueerd en aan microsequentie onderworpen. Zes peptiden van het gezuiverde 92-kD-eiwit, dat we ZBP2 noemden, werden verkregen na microsequencing. Een databaseonderzoek met de peptidesequenties van ZBP2 onthulde dat de zes peptiden overeenkwamen met een humaan nucleair eiwit, KSRP, dat eerder is geïdentificeerd als een regulerende splitsingsfactor (Min et al., 1997). De andere drie eiwitten werden ook geïdentificeerd door hun peptidesequenties. Het 70-kD-eiwit was een homoloog van een menselijk eiwit, FBP, dat bekend stond als een transcriptiefactor voor de c-myc gen (Duncan et al., 1994). Het eiwit van 65 kD was een onbekend eiwit. We hebben het 68-kD-eiwit niet gesequenced, omdat we aannamen dat dit eiwit ZBP1 was (Ross et al., 1997). Het 45-kD-eiwit werd geïdentificeerd als ssDBF, een enkelstrengs DNA-bindingsfactor bij kippen (Smidt et al., 1995), en was homoloog aan een menselijk eiwit, ABBP, een type A/B hnRNP-eiwit dat een rol speelt bij mRNA-bewerking (Lau et al., 1997).

Isolatie van kippen-cDNA voor ZBP2

Het voor cDNA coderende ZBP2 werd verkregen door screening van drie cDNA-bibliotheken van kippen en snelle amplificatie van cDNA-uiteinden (RACE)-PCR-amplificatie van het 5'02032-uiteinde. Het ZBP2 en het menselijke KSRP delen een identiteit van 81% in de nucleïnezuursequentie en een identiteit van 86% in de aminozuursequentie (aa) (Figuur 3), wat aangeeft dat ZBP2/KSRP een sterk geconserveerd eiwit is. Net als bij humaan KSRP en ZBP1, bevat ZBP2 ook vier hnRNP type K homologie-RNA-bindende (KH)-domeinen en een COOH-terminaal gebied verrijkt in glutamine, met vier herhalingen van een AWEEYYK-motief en een NH2-terminaal proline-glycine rijk domein (Fig. 3). Kip ZBP2 bevat echter een 47-aa-segment vóór het eerste KH-domein dat niet in KSRP wordt gevonden, en significante sequentieverschillen in het 5′-uiteinde van het mRNA.

Volledige sequentie van ZBP2 vergeleken met humaan KSRP. Eiwitten in de 2,0 KCl-elutiefractie van de RNA-affiniteitskolom zoals getoond in Fig. 2 werden geconcentreerd met een contricon-30-filter (Amicon) en geëlektroforeerd in 10% SDS-PAGE. De eiwitten die zichtbaar werden gemaakt door kleuring met Coomassie-blauw werden uitgesneden voor microsequencing. De onderstreepte sequenties tonen de vijf peptiden met microsequentie van 16, 13, 13, 7 en 24 aa van gezuiverd ZBP2 (92 kD). De rode gebieden geven de vier sterk geconserveerde K-homologiedomeinen van het hnRNP aan. Let op de proline, glycine-rijke NH2-terminale en glutamine-rijke COOH-terminale domeinen van ZBP2. De identiteit van ZBP2 en KSRP is 86%. ZBP2 is verkrijgbaar bij GenBank/EMBL/DDBJ/toegangsnr. <"type":"entrez-nucleotide","attrs":<"text":"AF461020","term_id":"18252631">> AF461020.

ZBP2 wordt geassocieerd met de postcode in kippenhersenen en fibroblasten

Om onze studies naar de rol van ZBP2 voor mRNA-lokalisatie te vergemakkelijken, hebben we antilichamen gegenereerd door gel-gezuiverd ZBP2 in ratten te injecteren. De specificiteit van ZBP2-antilichamen werd bepaald door Western-blotanalyse (Fig. 4A), waarbij de rattenantilichamen tegen ZBP2 specifiek ZBP2 herkenden in zowel fibroblast- als hersenextracten, evenals in affiniteitsgezuiverde eiwitfracties (Fig. 4A, rijstroken 1𠄳).

Karakterisering van antilichamen tegen ZBP2. Antilichamen tegen ZBP2 werden gemaakt door SDS-PAGE gel-gezuiverd ZBP2 in ratten te injecteren. (A) Western-blotting naar ZBP2. (Baan 1) Ruw hersenextract. (Baan 2) Ruw fibroblastextract. (Laan 3) 1,0 M KCl-affiniteitsgezuiverde eiwitfractie van hersenextract. De pijl geeft ZBP2 aan. (B) Antiserum tegen ZBP2 of pre-immuunserum werd gedurende 2 uur geïncubeerd met hersenextract, gevolgd door incubatie met agarose-eiwit G-korrels gedurende 2 uur bij 4°C. De supernatanten werden, na 10 minuten centrifugeren bij 1.500 rpm, geanalyseerd met een motiliteitsverschuivingstest op hun vermogen om een ​​RNA-eiwitcomplex te vormen. (Baan 1) Controle hersenextract. (Baan 2) Hersenextract geïncubeerd met pre-immuun serum van de rat. (Baan 3) Hersenextract geïncubeerd met anti-ZBP2-serum. Pijlen duiden de RNA-eiwitcomplexen aan die zijn geïdentificeerd in Fig. 1 A. (C) Dezelfde monsters als in B werden gebruikt voor Western-blotting. (Baan 1) Controle hersenextract. (Baan 2) Hersenextract geïncubeerd met pre-immuun serum van de rat. (Baan 3) hersenextract immuundepletie met behulp van anti-ZBP2-serum. Pijl geeft ZBP2 aan.

Om er zeker van te zijn dat ZBP2 in hersenextracten het eiwit was dat de complexen M en S vormde met de postcode, hebben we ZBP2 uit hersenextracten immuundepletie gegeven en RNA-mobiliteitsverschuivingsassays uitgevoerd om RNA-eiwitcomplexen te detecteren (Fig. 4B). Wanneer de supernatanten van een immunoprecipitatie met ZBP2-antilichamen werden geïncubeerd met de postcode, waren de specifieke RNA-eiwitcomplexen M en S sterk verminderd (Fig. 4B, baan 3). De immunoprecipitatie met anti-ZBP2-antilichamen bleek specifiek te zijn, aangezien complex F slechts in geringe mate was verminderd (Fig. 4B, baan 3). Daarentegen, wanneer de RNA-mobiliteitsverschuivingsassay werd uitgevoerd met de supernatanten na immunoprecipitatie door een pre-immuun serum van een controlerat, werd geen vermindering van de intensiteit van de verwachte RNA-eiwitcomplexen gevonden (Fig. 4B, baan 2). Dit bevestigde dat de vorming van complexen M en S afhankelijk was van de aanwezigheid van ZBP2. De vorming van complex F was waarschijnlijk afhankelijk van ZBP1, dat niet wordt herkend door de ZBP2-antilichamen. Om te verifiëren dat ZBP2 immuunverarmd was uit extracten met anti-ZBP2-antilichamen, werden dezelfde supernatanten die in de bovenstaande mobiliteitsverschuivingstest werden gebruikt, geanalyseerd met Western-blotting (Fig. 4C). Het resultaat toonde aan dat in tegenstelling tot supernatanten die met controle- en rattenpre-immuunserum waren behandeld (Fig. 4C, lanen 1 en 2), ZBP2 was verwijderd door de anti-ZBP2-antilichamen (Fig. 4C, laan 3).

Ontwikkelingsregulatie van ZBP2

Om het expressiepatroon van ZBP2 in zich ontwikkelende neuronen te bepalen, werden eiwitextracten bereid uit verschillende ontwikkelingsstadia van kippenhersenen en geanalyseerd op ZBP2-niveaus door Western-blotting (Fig. 5). De hoogste expressie van ZBP2 werd gezien in 6-d embryo's (Fig. 5, 6 6 d), het niveau van expressie werd verlaagd tot 30% vóór het uitkomen en bleef daarna stabiel (Fig. 5). Daarentegen is de hoeveelheid &#-actine-eiwit vrijwel constant op dezelfde tijdstippen. Dit komt overeen met de gebeurtenissen tijdens neurale embryogenese, wanneer axonen en dendrieten maximaal groeien, en valt ook samen met de expressie van ZBP1 (niet-gepubliceerde gegevens).

Embryonale expressie van ZBP2. Eiwitten werden in verschillende stadia uit kippenembryo-hersenen geëxtraheerd en op 10% SDS-PAGE gelopen vóór Western-blotting met behulp van ZBP2- en β-actine-antilichamen.De relatieve verhoudingen van ZBP2 per actine-intensiteit werden berekend voor de aangegeven stadia (in dagen).

Distributie van β-actine-mRNA en ZBP2 in CEF's en neuronen. CEF's (A) en neuronen (B) werden gekweekt en gefixeerd zoals beschreven in materialen en methoden. De cellen werden in situ gehybridiseerd met β-actine-mRNA (Cy3, rood) en door immunofluorescentie tot ZBP2 (FITC, groen). Overlap wordt rechts van A en in B aangegeven. Afbeelding in B is een over elkaar heen geplaatste enkele, deconvolved optische secties. Pijlpunten tonen de co-lokalisatie van ZBP2- en β-actine-mRNA in neuronale processen en groeikegel. Staven, 10 μm.

Cellulaire lokalisatie van ZBP2

Om de subcellulaire lokalisatie van ZBP2 te onderzoeken en of ZBP2 in vivo geassocieerd was met β-actine-mRNA in fibroblasten en neuronen, hebben we een gecombineerde test uitgevoerd, waarbij we in situ hybridisatie met fluorescent-gelabelde oligonucleotide-probes voor β-actine-mRNA hebben gebruikt. (rood Fig. 6, A , linkerpaneel en B), en met antilichamen voor ZBP2 (groen Fig. 6, A , middelste paneel en B). ZBP2 is voornamelijk aanwezig in celkernen. Af en toe werd echter een significante hoeveelheid van het ZBP2 gedetecteerd door immunofluorescentie in de voorrand van CEF's en de groeikegel van neuronen die kippen ontwikkelen. We hebben hun afbeeldingen over elkaar heen gelegd (Fig. 6, A, rechts en B) waar ZBP2 en β-actine-mRNA elkaar overlapten (geel) in de voorrand van CEF's (Fig. 6 A, rechts) en de groeikegel van neuronen ( Afb. 6 B, pijlen). Dit leverde bewijs dat ZBP2- en &#-actine-mRNA in vivo ruimtelijk geassocieerd waren in de onderzochte cellen. Hoewel het eiwit en RNA over het algemeen in hetzelfde gebied van de neurieten zijn verdeeld, overlappen ze elkaar soms. Zowel het β-actine-mRNA als het ZBP2 vertonen een puntvormige verdeling, vooral duidelijk in neuronen, consistent met waarnemingen van lokaliserende deeltjes (Ainger et al., 1993 Zhang et al., 2001).

ZBP2 en β-actine mRNA zijn fysiek geassocieerd

Om te bepalen of het ZBP2- en &#-actine-mRNA fysiek geassocieerd konden worden, gebruikten we immunoprecipitatie gevolgd door RT-PCR-assays om te bepalen of de geïmmunoprecipiteerde pellet met anti-ZBP2-antilichamen &#-actine-mRNA bevatte (Fig. 7). RNA werd geïsoleerd uit de geïmmunoprecipiteerde pellet uit hersenextract met behulp van ofwel anti-ZBP2-antilichamen of pre-immuun serum van de rat, en vervolgens onderworpen aan RT-PCR. Een fragment van 398 bp van het β-actine mRNA 3′ untranslated region (UTR) werd gekozen voor PCR-amplificatie. We gebruikten een plasmide zonder -actine-cDNA als negatieve controle (Fig. 7, baan 1) en een plasmide met cDNA van -actine als positieve controle (Fig. 7, baan 6). Een fragment van de 3′ UTR van β-actine-mRNA werd geamplificeerd uit de immunoprecipitaties met ZBP2-antiserum of antilichamen (Fig. 7, lanen 3 en 5). De immunoprecipitaties met pre-immuun rattenserum of IgG vertoonden geen PCR-geamplificeerde DNA-fragmenten (Fig. 7, lanen 2 en 4). Dit experiment gaf aan dat β-actine-mRNA en ZBP2 hoogstwaarschijnlijk fysiek met elkaar in verband werden gebracht in extracten van kippenhersenen.

β-actine-mRNA werd gecoprecipiteerd met ZBP2. ZBP2-antilichamen werden gebruikt om een ​​CEF-extract te immunoprecipiteren. Primers voor β-actine-mRNA werden gebruikt in een RT-PCK-assay om de aanwezigheid van β-actine-mRNA in de pellets te detecteren. (Baan 1) Negatieve PCR-controle geen primers. (Baan 2) Pre-immuun rattenserum. (Baan 3) ZBP2-antiserum. (Baan 4) Gezuiverd normaal IgG van de rat. (Baan 5) affiniteitsgezuiverd ZBP2 IgG. (Baan 6) Positieve PCR-controle met cDNA van volledige lengte van mRNA van β-actine als matrijs. M is de moleculaire merker van DNA. De pijl geeft het PCR-geamplificeerde DNA-fragment van de 3′ UTR van β-actine-mRNA aan.

Delen van ZBP2 kunnen de nucleaire en cytoplasmatische distributie bepalen

Om te bepalen of ZBP2 tussen de kern en het cytoplasma pendelt, hebben we het gefuseerd met verbeterd groen fluorescentie-eiwit (EGFP) en de compartimentering van het fluorescerende eiwit in zowel fibroblasten als neuronen geanalyseerd. De verschillende delen van ZBP2 die aan GFP waren gefuseerd, omvatten het 47-aa-segment (rood), de centrale vier KH-domeinen (blauw) en de COOH-terminale herhalingen (grijs) (Fig. 8 A). Verschillende domeinen van ZBP2 regelen de nucleaire of cytoplasmatische compartimentering van het EGFP dat eraan is gefuseerd (cijfers geven het percentage cellen aan met cytoplasmatische fluorescentie in fibroblasten). Het COOH-terminale (Fig. 8 B) domein en vier KH-domeinen (Fig. 8 D) werden door de cel verdeeld, terwijl wanneer de 47 aa werden toegevoegd aan het 4-KH-domein, dat we het centrale domein noemen, de lokalisatie was bijna volledig nucleair (Fig. 8 C). Dit suggereerde dat de 47 aa de nucleaire distributie bepaalde. Dit werd bevestigd door het 47-aa-segment te fuseren met EGFP, dat vervolgens uitsluitend nucleair werd (Fig. 8 E). Inspectie van het 47-aa-segment onthulde verschillende arginine-residuen die wijzen op een nucleair lokalisatiesignaal (NLS). Wanneer de ZBP2 van volledige lengte werd gefuseerd met GFP, met of zonder het 47-aa-segment (Fig. 8, F en G), werd de nucleaire fluorescentie verlaagd maar niet geëlimineerd in het construct zonder de 47 aa, en nam de cytoplasmatische fluorescentie toe , wat aangeeft dat zwakke NLS's hoogstwaarschijnlijk elders in het eiwit bestonden. De verdeling in fibroblasten voor deze laatste twee constructies werd gekwantificeerd in neuronen en leverde dezelfde percentages cellen op met cytoplasmatische fluorescentie. In tegenstelling tot ZBP2 was menselijk KSRP volledig nucleair wanneer het werd gefuseerd met GFP en uitgedrukt in CEF (niet-gepubliceerde gegevens).

Nucleaire versus cytoplasmatische distributie van ZBP2 in fibroblasten en neuronen. De genstructuur van ZBP2 wordt gedemonstreerd in A. Rode balk, 47-aa insert blauwe balken, KH-domeinen grijze balken, COOH-terminale herhaling van AWEEYYK-motief. De verschillende constructen van ZBP2 de volledige lengte met of zonder de 47-aa-insertie (F en G), de 47-aa-insertie (E), de vier KH-domeinen (D), het centrale domein dat de vier KH-domeinen bevat, en het 47-aa-insert (C), of het COOH-uiteinde van het eiwit (B) werden gefuseerd met GFP en de cellulaire distributie werd gekarakteriseerd. De constructies worden gedetailleerd in de linkerpanelen met cellulaire distributies in de rechterpanelen. Het percentage cellen met cytoplasmatisch signaal werd gekarakteriseerd voor elk construct in het aantal onder elk construct. Staven, 10 μm.

Overexpressie van het centrale domein van ZBP2 verstoort gedeeltelijk de lokalisatie van mRNA van actine in CEF's en neuronen

Een afknotting van de ZBP2, het centrale domein, dat � aa bevatte inclusief de 47 aa met vier KH-domeinen (Fig. 8C), werd getransfecteerd in CEF's. We postuleerden dat de KH-domeinen zouden strijden om RNA-binding met de ZBP2 van volledige lengte, analoog aan ZBP1 (niet-gepubliceerde gegevens), en daarom zouden fungeren als een dominant negatief voor β-actine-mRNA-lokalisatie. Het EGFP-signaal in fibroblasten die met de afknotting waren getransfecteerd, was voornamelijk aanwezig in de kern. Lokalisatie van het β-actine-mRNA werd gevisualiseerd door fluorescentie in situ hybridisatie. Het percentage cellen met gelokaliseerd &#-actine-mRNA nam ruwweg af met de helft in de getransfecteerde CEF's (Fig. 9, boven) in tegenstelling tot de cellen die waren getransfecteerd met EGFP of EGFP-KSRP als controle (de menselijke ZBP2-homoloog). De intensiteit van het cytoplasmatische signaal van β-actine-mRNA veranderde niet significant, wat aangeeft dat de nucleaire export van β-actine-mRNA niet werd geremd door het dominante negatieve construct (niet-gepubliceerde gegevens). In getransfecteerde zich ontwikkelende neuronen veroorzaakte deze afknotting ook een afname van 35% van het &#-actine-mRNA-signaal in processen of groeikegels vergeleken met het controle-experiment (Fig. 9, midden). Dit suggereerde dat de overexpressie van het afgeknotte, maar nog steeds nucleaire, ZBP2 de lokalisatie van het mRNA van &#-actine beïnvloedde. Om aan te tonen dat het dominante negatieve effect van ZBP2 truncate specifiek is, hebben we cotransfecties van zowel het volledige ZBP2 als het centrale domein in CEF's uitgevoerd. De delokalisatie van &#-actine-mRNA in getransfecteerde cellen werd gedeeltelijk gered door gebruik te maken van het wildtype ZBP2 (Fig. 9, onder).

Een ZBP2 dominant negatief construct onderdrukt β-actine mRNA lokalisatie. (Bovenkant) Het percentage getransfecteerde CEF's met gelokaliseerd β-actine-mRNA. CEF's werden gedurende 6 uur getransfecteerd gevolgd door fluorescentie in situ hybridisatie. Getransfecteerde cellen werden gescoord op lokalisatie van mRNA van actine. GFP, vector pEGFPC1 GFP-CD, GFP gefuseerd met centraal domein GFP-KSRP, GFP-humaan KSRP Mock, geen plasmide. De staven tonen het percentage getransfecteerde cellen met gelokaliseerd &#-actine-mRNA in elk experiment. Ten minste 50 getransfecteerde cellen werden geteld in elk dekglaasje, twee experimenten elk. (Midden) Het β-actine mRNA-signaal in neuronale processen. Experimenten waren parallel aan A, behalve dat het COOH-uiteinde van ZBP2 (GFP-CT) werd gebruikt (Fig. 8, construct B). β-actine mRNA-signaal werd gemeten en vervolgens omgezet in fluorescentie-eenheden. (Onder) Het percentage gecotransfecteerde CEF's met gelokaliseerd β-actine-mRNA. CEF's werden getransfecteerd met ofwel een enkel construct (wildtype ZBP2 of het dominante negatieve centrale domeinconstruct) of beide constructen van verschillende verhoudingen (dominant negatief vs. wildtype 1:1 of 1:4) gedurende 6 uur. Na FISH werden getransfecteerde cellen gescoord zoals in Fig. 9A.


We zijn dankbaar voor de financiering ontvangen door het Centre of Excellence SymBioSys (Onderzoeksraad KULeuven EF/05/007), het Strategisch Basisonderzoek van het Instituut voor de Aanmoediging van Innovatie door Wetenschap en Technologie in Vlaanderen onder subsidie ​​IWT-SBO 120050 ( NEMOA) en het FWO [Fonds voor Wetenschappelijk Onderzoek – Vlaanderen (België)] via een postdoctoraal mandaat aan HS.

Aiba, H. (2007). Mechanisme van RNA-silencing door Hfq-bindende kleine RNA's. Curr. Opin. microbiologisch. 10, 134�. doi: 10.1016/j.mib.2007.03.010

Anderson, P.E., Gober J.W. (2000). FlbT, de post-transcriptionele regulator van flagellinesynthese in Caulobacter crescentus, interageert met het 5’ onvertaalde gebied van flagelline-mRNA. Mol. microbiologisch. 38, 41�. doi: 10.1046/j.1365-2958.2000.02108.x

Arthur, D.C., Ghetu, A.F., Gubbins, M.J., Edwards, R.A., Frost, L.S. en Glover, J.N.M. (2003). FinO is een RNA-chaperonne die sense-antisense RNA-interacties mogelijk maakt. EMBO J. 22, 6346�. doi: 10.1093/emboj/cdg607

Aymerich, S., en Steinmetz, M. (1992). Specificiteitsdeterminanten en structurele kenmerken in het RNA-doelwit van de bacteriële antiterminator-eiwitten van de BglG / SacY-familie. Proc. nat. Acad. Wetenschap. VS. 89, 10410�. doi: 10.1073/pnas.89.21.10410

Babitzke, P. (2004). Regulering van transcriptieverzwakking en translatie-initiatie door allosterische controle van een RNA-bindend eiwit: de Bacillus subtilis TRAP-eiwit. Curr. Opin. microbiologisch. 7, 132�. doi: 10.1016/j.mib.2004.02.003

Babitzke, P., Bear, D.G., en Yanofsky, C. (1995). TRAP, het trp RNA-bindende verzwakkingseiwit van Bacillus subtilis, is een torusvormig molecuul dat transcripten bindt die GAG- of UAG-herhalingen bevatten, gescheiden door twee nucleotiden. Proc. nat. Acad. Wetenschap. VS. 92, 7916�. doi: 10.1073/pnas.92.17.7916

Babitzke, P., Stults, J.T., Shire, S.J., en Yanofsky, C. (1994). TRAP, het trp RNA-bindende verzwakkingseiwit van Bacillus subtilis, is een multisubunit-complex dat G/UAG-herhalingen in de trpEDCFBA- en trpG-transcripten lijkt te herkennen. J. Biol. Chem. 269, 16597�.

Bachem, S., en Stéx000FClke, J. (1998). regulering van de Bacillus subtilis GlcT-antiterminator-eiwit door componenten van het fosfotransferasesysteem. J. Bacteriol. 180, 5319�.

Bae, W., Xia, B., Inouye, M., en Severinov, K. (2000). Escherichia coli CspA-familie RNA chaperonnes zijn transcriptie-antiterminatoren. Proc. nat. Acad. Wetenschap. VS. 97, 7784�. doi: 10.1073/pnas.97.14.7784

Baker, C.S., Eöry, L.A., Yakhnin, H., Mercante, J., Romeo, T., en Babitzke, P. (2007). CsrA remt de translatie-initiatie van Escherichia coli hfq door te binden aan een enkele plaats die de Shine-Dalgarno-sequentie overlapt. J. Bacteriol. 189, 5472�. doi: 10.1128/JB.00529

Baker, C.S., Morozov, I., Suzuki, K., Romeo, T., en Babitzke, P. (2002). CsrA reguleert de biosynthese van glycogeen door translatie van glgC in . te voorkomen Escherichia coli. Mol. microbiologisch. 44, 1599�. doi: 10.1046/j.1365-2958.2002.02982.x

Barria, C., Malecki, M., en Arraiano, C. M. (2013). Bacteriële aanpassing aan kou. Microbiologie 159, 2437�. doi: 10.1099/mic.0.052209-0

Beyer, D., Skripkin, E., Wadzack, J., en Nierhaus, K.H. (1994). Hoe het ribosoom langs het mRNA beweegt tijdens eiwitsynthese. J. Biol. Chem. 269, 30713�.

Brencic, A., en Lory, S. (2009). Bepaling van het regulon en identificatie van nieuwe mRNA-doelen van Pseudomonas aeruginosa RsmA. Mol. microbiologisch. 72, 612�. doi: 10.1111/j.1365-2958.2009.06670.x

Browne, P., Barret, M., O’Gara, F., en Morrissey, J.P. (2010). Computationele voorspelling van de Crc-regulon identificeert geslachtsbrede en soortspecifieke doelen van katabolietrepressiecontrole in Pseudomonas bacteriën. BMC Microbiol. 10:300. doi: 10.1186/1471-2180-10-300

Burrowes, E., Baysse, C., Adams, C., en O’Gara, F. (2006). Invloed van het regulerende eiwit RsmA op cellulaire functies in Pseudomonas aeruginosa PAO1, zoals onthuld door transcriptoomanalyse. Microbiologie 152, 405�. doi: 10.1099/mic.0.28324-0

Callaghan, A.J., Marcaida, M.J., Stead, J.A., McDowall, K.J., Scott, W.G., en Luisi, B.F. (2005). Structuur van Escherichia coli RNase E katalytisch domein en implicaties voor RNA-turnover. Natuur 437, 1187�. doi: 10.1038/nature04084

Carpousis, AJ (2007). Het RNA-degradosoom van Escherichia coli: een mRNA-afbrekende machine geassembleerd op RNase E. Ann. Rev. Microbiol. 61, 71�. doi: 10.1146/annurev.micro.61.080706.093440

Chai, W., en Stewart, V. (1999). RNA-sequentievereisten voor NasR-gemedieerde, nitraat-responsieve transcriptie-antiterminatie van de Klebsiella oxytoca M5al nasF operon leider. J. Mol. Biol. 292, 203�. doi: 10.1006/jmbi.1999.3084

Chaulk, S., Lu, J., Tan, K., Arthur, D.C., Edwards, R.A., Frost, L.S., et al. (2010). N. meningitidis 1681 is een lid van de FinO-familie van RNA-chaperonnes. RNA Biol. 7, 812�. doi: 10.4161/rna.7.6.13688

Chaulk, S.G., Smith-Frieday, M.N., Arthur, D.C., Culham, D.E., Edwards, R.A., Soo, P., et al. (2011). ProQ is een RNA-chaperonne die de ProP-niveaus in Escherichia coli. Biochemie 50, 3095�. doi: 10.1021/bi101683a

Chen, Y., en Anderson, D.M. (2011). Expressiehiërarchie in de Yersinia type III-secretiesysteem tot stand gebracht door YopD-herkenning van RNA. Mol. microbiologisch. 80, 966�. doi: 10.1111/j.1365-2958.2011.07623.x

Christiansen, J.K., Larsen, M.H., Ingmer, H., Søgaard-andersen, L., en Kallipolitis, B.H., (2004). Het RNA-bindende eiwit Hfq van Listeria monocytogenes: rol bij stresstolerantie en virulentie. J. Bacteriol. 186, 3355�. doi: 10.1128/JB.186.11.3355-3362.2004

Cohen-Or, I., Shenhar, Y., Biran, D., en Ron, EZ (2010). CspC reguleert rpoS-transcriptniveaus en vult hfq-deleties aan. Onderzoek microbiologisch. 161, 694�. doi: 10.1016/j.resmic.2010.06.009

Davies, B.W., Köx000F6hrer, C., Jacob, A.I., Simmons, L.A., Zhu, J., Aleman, L.M., et al. (2011). Rol van Escherichia coli YbeY, een sterk geconserveerd eiwit, in rRNA-verwerking. Mol. microbiologisch. 78, 506�. doi: 10.1111/j.1365-2958.2010.07351.x

Deana, A., en Belasco, J.G. (2005). Lost in translation: de invloed van ribosomen op bacterieel mRNA-verval. Genen Dev. 19, 2526�. doi: 10.1101/gad.1348805

De Lay, N., Schu, D.J. en Gottesman, S. (2013). Bacteriële kleine op RNA gebaseerde negatieve regulatie: Hfq en zijn handlangers. J. Biol. Chem. 288, 7996�. doi: 10.1074/jbc.R112.441386

Desnoyers, G., Bouchard, M.P., en Masséx000E9, E. (2013). Nieuwe inzichten in kleine RNA-afhankelijke translationele regulatie in prokaryoten. Trends Genet. 29, 92�. doi: 10.1016/j.tig.2012.10.004

Desnoyers, G., en Masse, E. (2012). Niet-canonieke onderdrukking van translatie-initiatie door kleine RNA-rekrutering van de RNA-chaperone Hfq. 42, 726�. doi: 10.1101/gad.182493.111

Du, H. en Babitzke, P. (1998). trp RNA-binding verzwakking eiwit-gemedieerde lange afstand RNA hervouwing reguleert de translatie van trpE in Bacillus subtilis. J. Biol. Chem. 273, 20494�. doi: 10.1074/jbc.273.32.20494

Du, H., Tarpey, R., en Babitzke, P. (1997). Het trp RNA-bindende verzwakkingseiwit reguleert de TrpG-synthese door te binden aan de trpG-ribosoombindingsplaats van Bacillus subtilis. J. Bacteriol. 179, 2582�.

Dubey, A.K., Baker, C.S., Romeo, T., en Babitzke, P. (2005). RNA-sequentie en secundaire structuur nemen deel aan CsrA – RNA-interactie met hoge affiniteit. RNA 11, 1579�. doi: 10.1261/rna.2990205.3

Dubey, A.K., Baker, C.S., Suzuki, K., Jones, A.D., Pandit, P., Romeo, T., et al. (2003). CsrA regelt de vertaling van de Escherichia coli koolstofgebrekgen, cstA, door ribosoomtoegang tot het cstA-transcript te blokkeren. J. Bacteriol. 185, 4450�. doi: 10.1128/JB.185.15.4450-4460.2003

Edwards, A.N., Patterson-Fortin, L.M., Vakulskas, C.A., Mercante, J.W., Potrykus, K., Vinella, D., et al. (2011). Circuits die de Csr en de stringente wereldwijde regelgevende systemen met elkaar verbinden. Mol. microbiologisch. 80, 1561�. doi: 10.1111/j.1365-2958.2011.07663.x

Even, S., Pellegrini, O., Zig, L., Labas, V., Vinh, J., Brøx000E9chemmier-Baey, D., et al. (2005). Ribonucleasen J1 en J2: twee nieuwe endoribonucleasen in B. subtilis met functionele homologie met E coli RNase E. Nucleïnezuren Res. 33, 2141�. doi: 10.1093/nar/gki505

Feng, Y., Huang, H., Liao, J., en Cohen, S. N. (2001). Escherichia coli poly(A)-bindende eiwitten die een interactie aangaan met componenten van degradosomen of RNA-verval belemmeren dat wordt gemedieerd door polynucleotidefosforylase en RNase E. J. Biol. Chem. 276, 31651�. doi: 10.1074/jbc.M102855200

Ferooz, J., Lemaire, J., en Letesson, J.-J. (2011). De rol van FlbT in de productie van flagelline in Brucella melitensis. Microbiologie 157, 1253�. doi: 10.1099/mic.0.044867-0

Figueroa-Bossi, N., Schwartz, A., Guillemardet, B., D’Heygère, F., Bossi, L., en Boudvillain, M. (2014). RNA-remodellering door bacteriële globale regulator CsrA bevordert Rho-afhankelijke transcriptieterminatie. Genen Dev. 28, 1239�. doi: 10.1101/gad.240192.114

Finn, R.D., Bateman, A., Clements, J., Coggill, P., Eberhardt, R.Y., Eddy, S.R., et al. (2014). Pfam: de database van eiwitfamilies. Nucleïnezuren Res. 42, D222�. doi: 10.1093/nar/gkt1223

Folichon, M. (2003). Het poly(A)-bindende eiwit Hfq beschermt RNA tegen RNase E en exoribonucleolytische afbraak. Nucleïnezuren Res. 31, 7302�. doi: 10.1093/nar/gkg915

Gaballa, A., Antelmann, H., Aguilar, C., Khakh, S.K., Song, K.-B., Smaldone, G.T., et al. (2008). De Bacillus subtilis ijzersparende respons wordt gemedieerd door een Fur-gereguleerd klein RNA en drie kleine, basische eiwitten. Proc. nat. Acad. Wetenschap. VS. 105, 11927�. doi: 10.1073/pnas.0711752105

Geissmann, T.A., en Touati, D. (2004). Hfq, een nieuwe begeleidende rol: binding aan boodschapper-RNA bepaalt de toegang voor kleine RNA-regulator. EMBO J. 23, 396�. doi: 10.1038/sj.emboj.7600058

Gollnick, P., Babitzke, P., Antson, A., en Yanofsky, C. (2005). Complexiteit in de regulatie van tryptofaanbiosynthese in Bacillus subtilis. Ann. Rev. Genet. 39, 47�. doi: 10.1146/annurev.genet.39.073003.093745

Géx000F6pel, Y., Papenfort, K., Reichenbach, B., Vogel, J., en Góx000F6rke, B. (2013). Gericht verval van een regulerend klein RNA door een adapter-eiwit voor RNase E en tegenwerking door een anti-adaptor-RNA. Genen Dev. 27, 552�. doi: 10.1101/gad.210112.112

Hajnsdorf, E., en Boni, I.V. (2012). Meerdere activiteiten van RNA-bindende eiwitten S1 en Hfq. Biochimie 94, 1544�. doi: 10.1016/j.biochi.2012.02.010

Hajnsdorf, E., en Røx000E9gnier, P. (2000). Gastheerfactor Hfq van Escherichia coli stimuleert de verlenging van poly(A)-staarten door poly(A)-polymerase I. Proc. nat. Acad. Wetenschap. VS. 97, 1501�. doi: 10.1073/pnas.040549897

Hämmerle, H., Amman, F., Veຎrek, B., Stülke, J., Hofacker, I., en Bläsi, U. (2014). Impact van Hfq op de Bacillus subtilis transcriptoom. PLoS ONE 9:e98661. doi: 10.1371/journal.pone.0098661

Henderson, C.A., Vincent, H.A., Casamento, A., Stone, C.M., Phillips, J.O., Cary, P.D., et al. (2013). Hfq-binding verandert de structuur van Escherichia coli kleine niet-coderende RNA's OxyS en RprA, die betrokken zijn bij de riboregulatie van rpoS. RNA 19, 1089�. doi: 10.1261/rna.034595.112

Herschlag, D. (1995). RNA-chaperonnes en het RNA-vouwprobleem. J. Biol. Chem. 270, 20871�. doi: 10.1074/jbc.270.36.20871

Hopkins, J.F., Panja, S., en Woodson, S.A. (2011). Snelle binding en afgifte van Hfq uit ternaire complexen tijdens RNA-annealing. Nucleïnezuren Res. 39, 5193�. doi: 10.1093/nar/gkr062

Huttenhofer, A., en Fnolier, H. (1994). Footprinting mRNA-ribosoomcomplexen met chemische sondes. EMBO J. 13, 3892�.

Ikeda, Y., Yagi, M., Morita, T., en Aiba, H. (2011). Hfq-binding in het RhlB-herkenningsgebied van RNase E is cruciaal voor de snelle afbraak van doel-mRNA's gemedieerd door sRNA's in Escherichia coli. Mol. microbiologisch. 79, 419�. doi: 10.1111/j.1365-2958.2010.07454.x

Irie, Y., Starkey, M., Edwards, A.N., Wozniak, D.J., Romeo, T., en Parsek, M.R. (2010). Pseudomonas aeruginosa biofilm matrix polysacharide Psl wordt transcriptioneel gereguleerd door RpoS en post-transcriptioneel door RsmA. Mol. microbiologisch. 78, 158�. doi: 10.1111/j.1365-2958.2010.07320.x

Jacob, A.I., Köx000F6hrer, C., Davies, B.W., Rajbhandary, U.L., en Walker, G.C. (2014). Geconserveerd bacterieel RNase YbeY speelt een sleutelrol bij de kwaliteitscontrole van 70S-ribosoom en de rijping van 16S-rRNA. Mol. Cel 49, 427�. doi: 10.1016/j.molcel.2012.11.025

Jerome, L.J., van Biesen, T., en Frost, L.S. (1999). Afbraak van FinP-antisense-RNA van F-achtige plasmiden: het RNA-bindende eiwit, FinO, beschermt FinP tegen ribonuclease E. J. Mol. Biol. 285, 1457�. doi: 10.1006/jmbi.1998.2404

Jonas, K., Edwards, A.N., Simm, R., Romeo, T., Römling, U., en Melefors, O. (2008). Het RNA-bindende eiwit CsrA regelt het cyclische di-GMP-metabolisme door de expressie van GGDEF-eiwitten direct te reguleren. Mol. microbiologisch. 70, 236�. doi: 10.1111/j.1365-2958.2008.06411.x

Jøx000F8rgensen, M.G., Thomason, M.K., Havelund, J., Valentin-Hansen, P., en Storz, G. (2013). Dubbele functie van het kleine McaS-RNA bij het beheersen van biofilmvorming. Genen Dev. 27, 1132�. doi: 10.1101/gad.214734.113

Jutras, B.L., Chenail, A.M., Carroll, D.W., Miller, M.C., Zhu, H., Bowman A., et al. (2013a). Bpur, het PUR-domeineiwit van de spirocheet van de ziekte van Lyme: identificatie als transcriptionele modulator en karakterisering van nucleïnezuurinteracties. J. Biol. Chem. 288, 26220�. doi: 10.1074/jbc.M113.491357

Jutras, B.L., Jones, G.S., Verma, A., Brown, N.A., Antonicello, A.D., Chenail, A.M., et al. (2013b). Posttranscriptionele zelfregulatie door het BpuR DNA/RNA-bindend eiwit van de bacterie van de ziekte van Lyme. J. Bacteriol. 195, 4915�. doi: 10.1128/JB.00819-13

Kaberdin, VR, Singh, D., en Lin-Chao, S. (2011). Samenstelling en conservering van de mRNA-afbrekende machinerie in bacteriën. J. Biomed. wetenschap. 18, 23. doi: 10.1186/1423-0127-18-23

Kawamoto, H., Koide, Y., Morita, T., en Aiba, H. (2006). Basisparingvereiste voor RNA-silencing door een bacterieel klein RNA en versnelling van duplexvorming door Hfq. Mol. microbiologisch. 61, 1013�. doi: 10.1111/j.1365-2958.2006.05288.x

Kime, L., Jourdan, S.S., Stead, J.A., Hidalgo-Sastre, A., en McDowall, K.J. (2010). Snelle splitsing van RNA door RNase E bij afwezigheid van monofosfaatstimulatie. Mol. microbiologisch. 76, 590�. doi: 10.1111/j.1365-2958.2009.06935.x

Koleva, R.I., Austin, C.A., Kowaleski, J.M., Neems, D.S., Wang, L., Vary, C.P.H., et al. (2006). Interacties van ribosomaal eiwit S1 met DsrA en rpoS mRNA. Biochem. Biofysica. Onderzoek gemeenschappelijk. 348, 662�. doi: 10.1016/j.bbrc.2006.07.102

Komarova, A.V., Tchufistova, L.S., Dreyfus, M., en Boni, I.V. (2005). AU-rijke sequenties in onvertaalde leiders verbeteren de translatie en stabiliseren mRNA in Escherichia coli. J. Bacteriol. 187, 1344�. doi: 10.1128/JB.187.4.1344

Kopaskie, K.S., Ligtenberg, K.G., en Schneewind, O. (2013). Translationele regulering van Yersinia enterocolitica mRNA dat codeert voor een type III-secretiesubstraat. J. Biol. Chem. 288, 35478�. doi: 10.1074/jbc.M113.504811

Kovach, A.R., Hoff, K.E., Canty, J.T., Orans, J., en Brennan, R.G. (2014). Herkenning van U-rijk RNA door Hfq van de Gram-positieve pathogeen Listeria monocytogenes. RNA 20, 1548�. doi: 10.1261/rna.044032.113

Kulkarni, P.R., Cui, X., Williams, J.W., Stevens, A.M., en Kulkarni, R.V. (2006). Voorspelling van CsrA-regulerende kleine RNA's in bacteriën en hun experimentele verificatie in Vibrio fischeri. Nucleïnezuren Res. 34, 3361�. doi: 10.1093/nar/gkl439

Lawhon, S.D., Frye, J.G., Suyemoto, M., Porwollik, S., McClelland, M., en Altier, C. (2003). Wereldwijde regelgeving door CsrA in Salmonella typhimurium. Mol. microbiologisch. 48, 1633�. doi: 10.1046/j.1365-2958.2003.03535.x

Le Derout, J. (2003). Hfq beïnvloedt de lengte en de frequentie van korte oligo(A)-staarten aan het einde van 3’ Escherichia coli rpsO mRNA's. Nucleïnezuren Res. 31, 4017�. doi: 10.1093/nar/gkg456

Le Derout, J., Boni, I.V., Røx000E9gnier, P., en Hajnsdorf, E. (2010). Hfq beïnvloedt mRNA-niveaus onafhankelijk van afbraak. BMC Mol. Biol. 11:17. doi: 10.1186/1471-2199-11-17.

Link, T.M., Valentin-Hansen, P., en Brennan, R.G. (2009). Structuur van Escherichia coli Hfq gebonden aan polyriboadenylaat RNA. Proc. nat. Acad. Wetenschap. VS. 106, 19292�. doi: 10.1073/pnas.0908744106

Liu, J.M., en Camilli, A. (2010). Een zich uitbreidende wereld van bacteriële kleine RNA's. Curr. Opin. microbiologisch. 13, 18�. doi: 10.1016/j.mib.2009.11.004

Liu, M. Y., Gui, G., Wei, B., Preston, J.F., Oakford, L., Yuksel, U., et al. (1997). Het RNA-molecuul CsrB bindt aan het globale regulerende eiwit CsrA en antagoniseert zijn activiteit in Escherichia coli. J. Biol. Chem. 272, 17502�. doi: 10.1074/jbc.272.28.17502

Liu, M. Y., Yang, H. en Romeo, T. (1995). Het product van de pleiotrope Escherichia coli gen csrA moduleert glycogeenbiosynthese via effecten op mRNA-stabiliteit. J. Bacteriol. 177, 2663�.

Liu, Y., Wu, N., Dong, J., Gao, Y., Zhang, X., Mu, C., et al. (2010). Hfq is een wereldwijde regulator die de pathogeniteit van Staphylococcus aureus. PLoS ONE 5:13069. doi: 10.1371/journal.pone.0013069

Lorenz, C., Gesell, T., Zimmermann, B., Schoeberl, U., Bilusic, I., Rajkowitsch, L., et al. (2010). Genomische SELEX voor Hfq-bindende RNA's identificeert genomische aptameren voornamelijk in antisense-transcripten. Nucleïnezuren Res. 38, 3794�. doi: 10.1093/nar/gkq032

Lu, Y., Turner, R., en Switzer, R. (1996). Functie van secundaire RNA-structuren bij transcriptionele verzwakking van de Bacillus subtilis pyr operon. Proc. nat. Acad. Wetenschap. VS. 93, 14462�. doi: 10.1073/pnas.93.25.14462

Mackay, J.P., Font, J., en Segal, D.J. (2011). De vooruitzichten voor designer enkelstrengs RNA-bindende eiwitten. nat. structuur. Mol. Biol. 18, 256�. doi: 10.1038/nsmb.2005

Mackie, G.A. (1998). Ribonuclease E is een 5’-end-afhankelijke endonuclease. Natuur 395, 720�. doi: 10.1038/27246

Mackie, GA (2013). RNase E: op het grensvlak van bacteriële RNA-verwerking en verval. nat. Rev. Microbiol. 11, 45�. doi: 10.1038/nrmicro2930

Mahadevan, S., en Wright, A. (1987). Een bacterieel gen dat betrokken is bij transcriptie-antiterminatie: regulatie bij een rho-onafhankelijke terminator in het bgl-operon van E. coli. Cel 50, 485�. doi: 10.1016/0092-8674(87)90502-2

Mallory, A., en Vaucheret, H. (2010). Vorm, functie en regulatie van ARGONAUTE-eiwitten. Plantaardige cel 22, 3879�. doi: 10.1105/tpc.110.080671

Marden, J.N., Diaz, M.R., Walton, W.G., Gode, C.J., Betts, L., Urbanowski, M.L., et al. (2013). Een ongebruikelijk CsrA-familielid werkt in serie met RsmA om posttranscriptionele reacties te versterken in Pseudomonas aeruginosa. Proc. nat. Acad. Wetenschap. VS. 110, 15055�. doi: 10.1073/pnas.1307217110

Massé9, E., Escorcia, F.E., en Gottesman, S. (2003). Gekoppelde afbraak van een klein regulerend RNA en zijn mRNA-targets in Escherichia coli. Genen Dev. 19, 2374�. doi: 10.1101/gad.1127103

Merino, E., Babitzke, P., Yanofsky, C., Merino, E., Babitzke, P., en Yanofsky, C. (1995). trp RNA-bindend verzwakkingseiwit (TRAP)-trp leider RNA-interacties mediëren zowel translationele als transcriptionele regulatie van de Bacillus subtilis trp operon. J. Bacteriol. 177, 6362�.

Mikulecky, P.J., Kaw, M.K., Brescia, C.C., Takach, J.C., Darren, D., en Feig, A.L. (2004). Escherichia coli Hfq heeft verschillende interactie-oppervlakken voor DsrA-, rpoS- en poly(A)-RNA's. nat. structuur. Mol. Biol. 11, 1206�. doi: 10.1038/nsmb858

Milojevic, T., Grishkovskaya, I., Sonnleitner, E., Djinovic-Carugo, K., en Bläsi, U. (2013). De Pseudomonas aeruginosa katabolietrepressiecontrole-eiwit Crc is verstoken van RNA-bindende activiteit. PLoS ONE 8:e64609. doi: 10.1371/journal.pone.0064609

Mitobe, J., Yanagihara, I., Ohnishi, K., Yamamoto, S., Ohnishi, M., Ishihama, A., et al. (2011). RodZ regelt de post-transcriptionele verwerking van de Shigella sonnei type III secretiesysteem. EMBO-rep. 12, 911�. doi: 10.1038/embor.2011.132

Mohanty, B.K., Maples, V.F., en Kushner, S.R. (2004). Het Sm-achtige eiwit Hfq reguleert polyadenylatie-afhankelijk mRNA-verval in Escherichia coli. Mol. microbiologisch. 54, 905�. doi: 10.1111/j.1365-2958.2004.04337.x

Moll, I., Afonyushkin, T., Vytvytska, O., en Kaberdin, V.R. (2003). Samenvallende Hfq-binding en RNase E-splitsingsplaatsen op mRNA en kleine regulerende RNA's. RNA 11, 1308�. doi: 10.1261/rna.5850703

Møller, T., Franch, T., Højrup, P., Keene, D.R., Ba, H.P., Brennan, R.G., et al. (2002). Hfq: een bacterieel sm-achtig eiwit dat RNA-RNA-interactie bemiddelt. Mol. Cel 9, 23�. doi: 10.1016/S1097-2765(01)00436-1

Moreno, R., Hernández-Arranz, S., La Rosa, R., Yuste, L., Madhushani, A., Shingler, V., et al. (2014). De Crc- en Hfq-eiwitten van Pseudomonas putida samenwerken bij katabolietrepressie en vorming van ribonucleïnezuurcomplexen met specifieke doelmotieven. omgeving. microbiologisch. 17, 105�. doi: 10.1111/1462-2920.12499

Moreno, R., Marzi, S., Romby, P., en Rojo, F. (2009). De wereldwijde Crc-regulator bindt zich aan een ongepaard A-rijk motief aan de Pseudomonas putida alkS mRNA coderende sequentie en remt de translatie-initiatie. Nucleïnezuren Res. 37, 7678�. doi: 10.1093/nar/gkp825

Morita, T., Maki, K. en Aiba, H. (2005). Op RNase E gebaseerde ribonucleoproteïnecomplexen: mechanische basis van mRNA-destabilisatie gemedieerd door bacteriële niet-coderende RNA's. Genen Dev. 19, 2176�. doi: 10.1101/gad.1330405.1996

Morris, E.R., Hall, G., Li, C., Heeb, S., Kulkarni, R.V., Lovelock, L., et al. (2013). Structurele herschikking in een RsmA/CsrA Ortholoog van pseudomonas aeruginosa creëert een dimeer RNA-bindend eiwit, RsmN. Structuur 21, 1659�. doi: 10.1016/j.str.2013.07.007

Mu&#FB04er, A., Fischer, D., en Hengge-Aronis, R. (1996). Het RNA-bindende eiwit HF-I, bekend als een gastheerfactor voor faag Qbeta RNA-replicatie, is essentieel voor rpoS-translatie in Escherichia coli. Genen Dev. 10, 1143�. doi: 10.1101/gad.10.9.1143

Mukherjee, S., Yakhnin, H., Kysela, D., Sokoloski, J., Babitzke, P., en Kearns, D. B. (2011). CsrA-FliW-interactie regelt flagellinehomeostase en een controlepunt op flagellaire morfogenese in Bacillus subtilis. Mol. microbiologisch. 82, 447�. doi: 10.1111/j.1365-2958.2011.07822.x

Muto, Y., Oubridge, C., en Nagai, K. (2000). RNA-bindende eiwitten: het vangen van RNA-basen. Curr. Biol. 10, 19�. doi: 10.1016/S0960-9822(99)00250-X

Osborne, J., Djapgne, L., Tran, B.Q., Goo, Y.A., en Oglesby-Sherrouse, A.G. (2014). Een methode voor in vivo identificatie van bacteriële kleine RNA-bindende eiwitten. Microbiologieopen 3, 950�. doi: 10.1002/mbo3.220

Pandey, P, S., Winkler, J.A., Li, H., Camacho, D.M., Collins, J.J. en Walker, G.C. (2014). Centrale rol voor RNase YbeY in Hfq-afhankelijke en Hfq-onafhankelijke kleine RNA-regulatie in bacteriën. BMC Genomics 15:121. doi: 10.1186/1471-2164-15-121

Pandey, S.P., Minesinger, B.K., Kumar, J., en Walker, G.C. (2011). Een sterk geconserveerd eiwit met onbekende functie in Sinorhizobium meliloti beïnvloedt de sRNA-regulatie vergelijkbaar met Hfq. Nucleïnezuren Res. 39, 4691�. doi: 10.1093/nar/gkr060

Patterson-Fortin, L.M., Vakulskas, C.A., Yakhnin, H., Babitzke, P., en Romeo, T. (2013). Dubbele posttranscriptionele regulatie via een cofactor-responsieve mRNA-leider. J. Mol. Biol. 425, 3662�. doi: 10.1016/j.jmb.2012.12.010

Perez-Rueda, E., en Martinez-Nu༞z, M.A. (2012). Het repertoire van DNA-bindende transcriptiefactoren in prokaryoten: functionele en evolutionaire lessen. Wetenschap. prog. 95, 315�. doi: 10.3184/003685012X13420097673409

Phadtare, S., Inouye, M., en Severinov, K. (2002). De nucleïnezuursmeltactiviteit van Escherichia coli CspE is van cruciaal belang voor transcriptie-antiterminatie en koude acclimatisatie van cellen. J. Biol. Chem. 277, 7239�. doi: 10.1074/jbc.M111496200

Picard, F., Dressaire, C., Girbal, L., en Cocaign-Bousquet, M. (2009).Onderzoek van post-transcriptionele regulaties in prokaryoten door integratieve biologie. C.R. Biol. 332, 958�. doi: 10.1016/j.crvi.2009.09.05

Rabhi, M., Espéx000E9li, O., Schwartz, A., Cayrol, B., Rahmouni, A.R., Arluison, V., et al. (2011). De Sm-achtige RNA-chaperonne Hfq bemiddelt transcriptie-antiterminatie bij Rho-afhankelijke terminators. EMBO J. 30, 2805�. doi: 10.1038/emboj.2011.192

Ramesh, A., DebRoy, S., Goodson, J.R., Fox, K.A., Faz, H., Garsin, D.A., et al. (2012). Het mechanisme voor RNA-herkenning door ANTAR-regulatoren van genexpressie. PLoS Genet. 8:e1002666. doi: 10.1371/journal.pgen.1002666

Rasmussen, A.A., Eriksen, M., Gilany, K., Udesen, C., Franch, T., Petersen, C., et al. (2005). Regulatie van ompA-mRNA-stabiliteit: de rol van een klein regulerend RNA bij groeifaseafhankelijke controle. Mol. microbiologisch. 58, 1421�. doi: 10.1111/j.1365-2958.2005.04911.x

Régnier, P., en Hajnsdorf, E. (2013). Het samenspel van Hfq, poly(A)-polymerase I en exoribonucleasen aan de 3’-uiteinden van RNA's als gevolg van Rho-onafhankelijke terminatie: een voorlopig model. RNA Biol. 10, 602�. doi: 10.4161/rna.23664

Reimmann, C., Valverde, C., Kay, E., en Haas, D. (2005). Posttranscriptionele repressie van GacS / GacA-gecontroleerde genen door het RNA-bindende eiwit RsmE dat samenwerkt met RsmA in de biocontrol-stam Pseudomonas fluorescens CHA0. J. Bacteriol. 187, 276�. doi: 10.1128/JB.187.1.276

Rieder, R., Reinhardt, R., Sharma, C., en Vogel, J. (2012). Experimentele hulpmiddelen om RNA-eiwitinteracties te identificeren in Helicobacter pylori. RNA Biol. 9, 520�. doi: 10.4161/rna.20331

Romeo, T., Vakulskas, C.A., en Babitzke, P. (2013). Post-transcriptionele regulering op wereldschaal: vorm en functie van Csr/Rsm-systemen. omgeving. microbiologisch. 15, 313�. doi: 10.1111/j.1462-2920.2012.02794.x

Rutberg, B. (1997). MicroReview antiterminatie van transcriptie van katabole operons. Mol. microbiologisch. 23, 413�. doi: 10.1046/j.1365-2958.1997.d01-1867.x

Said, N., Rieder, R., Hurwitz, R., Deckert, J., Urlaub, H., en Vogel, J. (2009). In vivo expressie en zuivering van met aptamer gemerkte kleine RNA-regulatoren. Nucleïnezuren Res. 37, e133. doi: 10.1093/nar/gkp719

Salvail, H., Caron, M.-P., Béx000E9langer, J., en Massé9, E. (2013). Antagonistische functies tussen de RNA chaperonne Hfq en een sRNA reguleren de gevoeligheid voor het antibioticum colicine. EMBO J. 32, 2764�. doi: 10.1038/emboj.2013.205

Santangelo, T.J., en Artsimovitch, I. (2011). Beëindiging en antiterminatie: RNA-polymerase voert een stopteken uit. nat. Rev. Microbiol. 9, 319�. doi: 10.1038/nrmicro2560

Saramago, M., Bóx000E1rria, C., Dos Santos, R.F., Silva, I.J., Pobre, V., Domingues, S., et al. (2014). De rol van RNasen bij de regulatie van kleine RNA's. Curr. Opin. microbiologisch. 18, 105�. doi: 10.1016/j.mib.2014.02.009

Sarsero, J.P., Merino, E., en Yanofsky, C. (2000). EEN Bacillus subtilis gen met voorheen onbekende functie, yhaG, wordt translationeel gereguleerd door tryptofaan-geactiveerde TRAP en lijkt betrokken te zijn bij tryptofaantransport. J. Bacteriol. 182, 2329�. doi: 10.1128/JB.182.8.2329-2331.2000

Sauer, E. (2013). Structuur en RNA-bindende eigenschappen van het bacteriële LSm-eiwit Hfq. RNA Biol. 10, 610�. doi: 10.4161/rna.24201

Sauer, E., Schmidt, S., en Weichenrieder, O. (2012). Kleine RNA-binding aan het laterale oppervlak van Hfq-hexameren en structurele herschikkingen bij herkenning van mRNA-doelwit. Proc. nat. Acad. Wetenschap. VS. 109, 9396�. doi: 10.1073/pnas.1202521109

Schiano, C.A., en Lathem, W.W. (2012). Post-transcriptionele regulatie van genexpressie in Yersinia soort. Voorkant. Cel. Infecteren. microbiologisch. 2:129. doi: 10.3389/fcimb.2012.00129

Schnetz, K., en Rak, B. (1988). Regulering van het bgl-operon van Escherichia coli door transcriptionele antiterminatie. EMBO J. 7, 3271�.

Schumacher, M.A., Pearson, R.F., Müller, T., Valentin-Hansen, P., en Brennan, R.G. (2002). Structuren van de pleiotrope translationele regulator Hfq en een Hfq-RNA-complex: een bacterieel Sm-achtig eiwit. EMBO J. 21, 3546�. doi: 10.1093/emboj/cdf322

Shahbabian, K., Jamalli, A., Zig, L., en Putzer, H. (2009). RNase Y, een nieuw endoribonuclease, initieert riboswitch-turnover in Bacillus subtilis. EMBO J. 28, 3523�. doi: 10.1038/emboj.2009.283

Sheidy, D.T., en Zielke, R.A. (2013). Analyse en uitbreiding van de rol van de Escherichia coli eiwit ProQ. PLoS ONE 8:e79656. doi: 10.1371/journal.pone.0079656

Shine, J., en Dalgarno, L. (1974). De 3’-terminale reeks van Escherichia coli 16S ribosomaal RNA: complementariteit met nonsens-tripletten en ribosoombindingsplaatsen. Proc. nat. Acad. Wetenschap. VS. 71, 1342�. doi: 10.1073/pnas.71.4.1342

Smaldone, G.T., Antelmann, H., Gaballa, A., en Helmann, J.D. (2012). Het FsrA-sRNA en FbpB-eiwit mediëren de ijzerafhankelijke inductie van de Bacillus subtilis lutABC ijzerzwavel bevattende oxidasen. J. Bacteriol. 194, 2586�. doi: 10.1128/JB.05567-11

Snyder, D., Lary, J., Chen, Y., Gollnick, P., en Cole, J.L. (2004). Interactie van het trp RNA-bindend verzwakkingseiwit (TRAP) met anti-TRAP. J. Mol. Biol. 338, 669�. doi: 10.1016/j.jmb.2004.03.030

Sobrero, P., en Valverde, C. (2012). Het bacteriële eiwit Hfq: veel meer dan alleen een RNA-bindende factor. Kritiek. Rev. Microbiol. 38, 276�. doi: 10.310/1040841X.2012.664540

Sonnleitner, E., Abdou, L., en Haas, D. (2009). Klein RNA als globale regulator van koolstofkatabolietrepressie in Pseudomonas aeruginosa. Proc. nat. Acad. Wetenschap. VS. 106, 21866�. doi: 10.1073/pnas.pnas.0910308106

Sonnleitner, E., en Blöx000E4si, U. (2014). Regulering van Hfq door het RNA CrcZ in Pseudomonas aeruginosa repressie van koolstofkatabolieten. PLoS Genet. 10:e1004440. doi: 10.1371/journal.pgen.1004440

Soper, T.J., Doxzen, K., en Woodson, S.A. (2011). Grote rol voor mRNA-binding en herstructurering bij sRNA-rekrutering door Hfq. RNA 17, 1544�. doi: 10.1261/rna.2767211

Sorger-Domenigg, T., Sonnleitner, E., Kaberdin, V.R. en Bläsi, U. (2007). Verschillende en overlappende bindingsplaatsen van Pseudomonas aeruginosa Hfq- en RsmA-eiwitten op het niet-coderende RNA RsmY. Biochem. Biofysica. Onderzoek gemeenschappelijk. 352, 769�. doi: 10.1016/j.bbrc.2006.11.084

Sterzenbach, T., Nguyen, K.T., Nuccio, S.-P., Winter, M.G., Vakulskas, C.A., Clegg, S., et al. (2013). Een nieuw CsrA-titratiemechanisme reguleert de fimbriale genexpressie in Salmonella typhimurium. EMBO J. 32, 2872�. doi: 10.1038/emboj.2013.206

Storz, G., Vogel, J., en Wassarman, K.M. (2011). Regulatie door kleine RNA's in bacteriën: grenzen verleggen. Mol. Cel 43, 880�. doi: 10.1016/j.molcel.2011.08.022

Stéx000FClke, J. (2002). Controle van transcriptieterminatie in bacteriën door RNA-bindende eiwitten die RNA-structuren moduleren. Boog. microbiologisch. 177, 433�. doi: 10.1007/s00203-002-0407-5

Subramanian, A.R. (1983). Structuur en functies van ribosomaal eiwit S1. prog. Nucleïnezuur Res. Mol. Biol. 28, 101�. doi: 10.1016/S0079-6603(08)60085-9

Suzuki, K., Babitzke, P., Kushner, S.R., en Romeo, T. (2006). Identificatie van een nieuw regulerend eiwit (CsrD) dat zich richt op de wereldwijde regulerende RNA's CsrB en CsrC voor afbraak door RNase E. Genen Dev. 20, 2605�. doi: 10.1101/gad.1461606

Tortosa, P., Lindner, C., Saier, M.H., Reizer, J., en Le Coq, D. (1997). Meervoudige fosforylering van SacY, a Bacillus subtilis transcriptionele antiterminator negatief gecontroleerd door het fosfotransferasesysteem. J. Biol. Chem. 272, 17230�. doi: 10.1074/jbc.272.27.17230

Tsai, B.P., Wang, X., Huang, L., en Waterman, M.L. (2011). Kwantitatieve profilering van in vivo geassembleerde RNA-eiwitcomplexen met behulp van een nieuwe geïntegreerde proteomische benadering. Mol. Cel Proteomics 10, M110.007385. doi:10.1074/mcp.M110.007385

Tsui, H.C., Leung, H.C. en Winkler, M.E. (1994). Karakterisering van breed pleiotrope fenotypes veroorzaakt door een hfq-insertiemutatie in Escherichia coli K�. Mol. microbiologisch. 13, 35�. doi: 10.1111/j.1365-2958.1994.tb00400.x

Vecerek, B., Moll, I., en Blöx000E4si, U. (2005). Translationele autocontrole van de Escherichia coli hfq RNA chaperonne gen. RNA 11, 976�. doi: 10.1261/rna.2360205

Vercruysse, M., Köx000F6hrer, C., Davies, B.W., Arnold, M.F.F., Mekalanos, J.J., RajBhandary, U.L., et al. (2014). Het sterk geconserveerde bacteriële RNase YbeY is essentieel in vibrio cholerae en speelt een cruciale rol bij virulentie, stressregulatie en RNA-verwerking. PLoS Pathog. 10:e1004175. doi: 10.1371/journal.ppat.1004175

Vogel, J., en Luisi, B.F. (2011). Hfq en zijn constellatie van RNA. nat. Rev. Microbiol. 9, 578�. doi: 10.1038/nrmicro2615

Vytvytska, O., Moll, I., Kaberdin, V.R., Von Gabain, A., en Blóx000E4si, U. (2000). binding Hfq (HF1) stimuleert ompA-mRNA-verval door te interfereren met ribosoombinding. Genen Dev. 14, 1109�. doi: 10.1101/gad.14.9.1109

Wang, M.-C., Chien, H.-F., Tsai, Y.-L., Liu, M.-C. en Liaw, S.-J. (2014). De RNA-chaperonne Hfq is betrokken bij stresstolerantie en virulentie bij uropathogene Proteus mirabilis. PLoS ONE 9:e85626. doi: 10.1371/journal.pone.0085626

Wang, X., Dubey, A.K., Suzuki, K., Baker, C.S., Babitzke, P., en Romeo, T. (2005). CsrA onderdrukt post-transcriptioneel pgaABCD, verantwoordelijk voor de synthese van een biofilm-polysaccharide-adhesine van Escherichia coli. Mol. microbiologisch. 56, 1648�. doi: 10.1111/j.1365-2958.2005.04648.x

Weilbacher, T., Suzuki, K., Dubey, A.K., Wang, X., Gudapaty, S., Morozov, I., et al. (2003). Een nieuwe sRNA-component van het regelsysteem voor koolstofopslag van Escherichia coli. Mol. microbiologisch. 48, 657�. doi: 10.1046/j.1365-2958.2003.03459.x

Windbichler, N., von Pelchrzim, F., Mayer, O., Csaszar, E., en Schroeder, R. (2008). Isolatie van kleine RNA-bindende eiwitten van E. coli: bewijs voor frequente interactie van RNA's met RNA-polymerase. RNA Biol. 5, 30�. doi: 10.4161/rna.5.1.5694

Yakhnin, A.V, Baker, C.S., Vakulskas, C.A., Yakhnin, H., Berezin, I., Romeo, T., et al. (2014). CsrA activeert flhDC-expressie door flhDC-mRNA te beschermen tegen RNase E-gemedieerde splitsing. Mol. Cel 87, 851�. doi: 10.1111/mmi.12136.CsrA

Yakhnin, H., Baker, C.S., Berezin, I., Evangelista, M.A., Rassin, A., Romeo, T., et al. (2011a). CsrA onderdrukt de vertaling van sdiA, dat codeert voor de N-acylhomoserine-L-lactonreceptor van Escherichia colidoor uitsluitend te binden in het coderende gebied van sdiA-mRNA. J. Bacteriol. 193, 6162�. doi: 10.1128/JB.05975-11

Yakhnin, H., Yakhnin, A.V., Baker, C.S., Sineva, E., Berezin, I., Romeo, T., et al. (2011b). Complexe regulatie van het globale regulerende gen csrA: CsrA-gemedieerde translationele repressie, transcriptie van vijf promoters door Esigma70 en EsigmaS, en indirecte transcriptionele activering door CsrA. Mol. microbiologisch. 81, 689�. doi: 10.1111/j.1365-2958.2011.07723.x

Yakhnin, H., Zhang, H., Yakhnin, A.V., en Babitzke, P. (2004). Het trp RNA-bindende verzwakkingseiwit van Bacillus subtilis reguleert de translatie van het tryptofaantransportgen trpP (yhaG) door ribosoombinding te blokkeren. J. Bacteriol. 186, 278�. doi: 10.1128/JB.186.2.278

Yang, M., de Saizieu, A., van Loon, A.P., en Gollnick, P. (1995). Vertaling van trpG in Bacillus subtilis wordt gereguleerd door het trp RNA-bindend verzwakkingseiwit (TRAP). J. Bacteriol. 177, 4272�.

Zha, D., Xu, L., Zhang, H., en Yan, Y. (2014). Het tweecomponenten GacS-GacA-systeem activeert lipA-translatie door RsmE, maar niet RsmA in Pseudomonas protegenen Pf-5. toepassing omgeving. microbiologisch. 80, 6627�. doi: 10.1128/AEM.02184-14

Zhang, A., Wassarman, K.M., Ortega, J., Steven, A.C., en Storz, G. (2002). Het Sm-achtige Hfq-eiwit verhoogt de OxyS-RNA-interactie met doel-mRNA's. Mol. Cel 9, 11�. doi: 10.1016/S1097-2765(01)00437-3

Trefwoorden : post-transcriptionele regulatie, RNA-bindende eiwitten, bacteriën, werkingsmechanismen, biotechnologische toepassingen, regulatie van translatie, stabiliteitsregulatie

Visum: Van Assche E, Van Puyvelde S, Vanderleyden J en Steenackers HP (2015) RNA-bindende eiwitten die betrokken zijn bij post-transcriptionele regulatie in bacteriën. Voorkant. microbiologisch. 6:141. doi: 10.3389/fmicb.2015.00141

Ontvangen: 24 december 2014 Paper in behandeling gepubliceerd: 24 januari 2015
Geaccepteerd: 06 februari 2015 Online gepubliceerd: 03 maart 2015.

Martin G. Klotz, Universiteit van North Carolina in Charlotte, VS

Brian Stevenson, Universiteit van Kentucky, VS
Paul Babitzke, Penn State University, VS

Copyright © 2015 Van Assche, Van Puyvelde, Vanderleyden en Steenackers. Dit is een open-access artikel dat wordt verspreid onder de voorwaarden van de Creative Commons Attribution License (CC BY). Gebruik, verspreiding of reproductie in andere fora is toegestaan, mits de oorspronkelijke auteur(s) of licentiegever worden vermeld en de oorspronkelijke publicatie in dit tijdschrift wordt geciteerd, in overeenstemming met de aanvaarde academische praktijk. Geen enkel gebruik, verspreiding of reproductie is toegestaan ​​die niet in overeenstemming is met deze voorwaarden.