Informatie

Carotenoïde biosynthese in gist


Produceert ontluikende gist Sacchromyces cerevisiae een aanzienlijke hoeveelheid carotenoïden? Heeft iemand een schatting gemaakt van de verhouding van de flux in takken 1. Cholesterolsynthese (via squaleen) 2. Co-enzym Q6 en 3. Dolichols Glycoproteïne en anderen van het vertakkingspunt van Farnesyldifosfaat.

Hier is het kegg-pad

http://www.genome.jp/kegg-bin/show_pathway?map00900 Ik heb ook een pad geformatteerd, maar kon niet uploaden.


Het enzym fytoeensynthase is de eerste toegewijde stap in de biosynthese van carotenoïden. Saccharomyces cerevisiae heeft dit enzym niet, noch heeft het de rest van de relevante route. Andere gisten zoals Rhodotorula soorten en Phaffia rhodozyma kan carotenoïden maken.

De biosynthese van carotenoïden is echter ingebouwd in S. cerevisiae.


Phaffia Rhodozyma

Phaffia rhodozyma is een carotenoïde-producerende gist van de Deuteromycotina (Blastomycetes). Het vermogen om carotenoïden te synthetiseren, de basissamenstelling van het DNA, bepaalde metabolische eigenschappen zoals het vermogen om ureum te gebruiken, de celwandstructuur en de wijze van knopvorming, en de aard van de polysachariden waaruit het kapsel bestaat, duiden op een basidiomyceteuze oorsprong (Miller et al., 1976 ). Vegetatieve cellen zijn ellipsvormig en kunnen afzonderlijk, in paren en soms in korte ketens voorkomen. Echt mycelium is afwezig, maar een rudimentair pseudomycelium kan aanwezig zijn. Phaffia rhodozyma kan chlamydosporen produceren en een vliesje vormen op vloeibare media (Miller, 1984). Phaffia rhodozyma werd begin jaren zeventig geïsoleerd door Phaff et al. (1972) uit de exsudaten van loofbomen in bergachtige gebieden van Japan en Alaska. oorspronkelijk aangewezen Rhodozyma montanae, het werd later hernoemd Phaffia rhodozyma, naar zijn ontdekker Herman Jan Pfaff (Miller et al., 1976 ). het geslacht Phaffia heeft slechts één soort, waarin alle 10 de stammen zijn geïsoleerd door Phaff et al. (1972) zijn opgenomen. Pogingen om deze stammen te paren in de hoop de daaropvolgende vorming van dikaryotisch mycelium en teliosporen waar te nemen, zijn nooit gelukt. Het stamtype is UCD (FS&T) 67–210 (= ATCC 24202 = CBS 5905).

Phaffia rhodozyma verschilt op twee manieren opvallend van andere gepigmenteerde gisten: het fermenteert glucose en andere suikers en synthetiseert astaxanthine als belangrijkste carotenoïde. Andere gepigmenteerde gisten van de genera cryptokokken, Rhodotorula, Rhodosporidium, sporidiobolus en Sporobolomyces zijn strikt aeroob en synthetiseren β-caroteen, γ-caroteen, toruleen of torularhodine als hun belangrijkste pigment (Simpson et al., 1971 ).


Abstract

Opioïden zijn de primaire geneesmiddelen die in de westerse geneeskunde worden gebruikt voor pijnbestrijding en palliatieve zorg. Het telen van papavers blijft de enige bron van deze essentiële medicijnen, ondanks uiteenlopende marktvragen en onzekerheid in gewasopbrengsten als gevolg van weer, klimaatverandering en plagen. We hebben gist ontwikkeld om de geselecteerde opioïde verbindingen thebaïne en hydrocodon te produceren, uitgaande van suiker. Alle werkzaamheden zijn uitgevoerd in een laboratorium dat is toegestaan ​​en beveiligd voor werkzaamheden met gereguleerde stoffen. We combineerden de ontdekking van enzymen, enzymengineering en optimalisatie van paden en stammen om volledige opiaatbiosynthese in gist te realiseren. De resulterende opioïde biosynthesestammen vereisten de expressie van 21 (thebaïne) en 23 (hydrocodon) enzymactiviteiten van planten, zoogdieren, bacteriën en gist zelf. Dit is een proof of principle, en er zijn nog grote hindernissen voordat optimalisatie en opschaling kunnen worden gerealiseerd. Open discussies over mogelijkheden om deze technologie te besturen zijn ook nodig om op verantwoorde wijze alternatieve leveringen voor deze medisch relevante verbindingen te realiseren.

Opioïden zijn een belangrijke klasse geneesmiddelen, waaronder de pijnstillende morfine en de hoestwerende codeïne. De Wereldgezondheidsorganisatie (WHO) classificeert deze verbindingen als essentiële geneesmiddelen vanwege hun nut bij de behandeling van ernstige pijn, pijnbestrijding en palliatieve zorg (1). In de derde wereld is er een tekort aan pijnstillers. De WHO schat dat 5,5 miljard mensen "weinig tot niet-bestaande toegang hebben tot behandeling voor matige of ernstige pijn" (2).

Alle natuurlijke opiaten (bijv. morfine en codeïne) en halfsynthetische opioïden (bijv. oxycodon, hydrocodon en hydromorfon) zijn momenteel afgeleid van de papaver (Papaver somniferum). Jaarlijks wordt ongeveer 100.000 ha papaver verbouwd om papaverstro op te leveren dat meer dan 800 ton opiaten bevat, voornamelijk morfine en thebaïne, om aan de wettelijke medische en wetenschappelijke vraag te voldoen (3). Het merendeel van van papaver afgeleide morfine en thebaïne wordt chemisch omgezet in hoogwaardige verbindingen, waaronder codeïne, oxycodon en hydrocodon. Industriële papaverteelt is gevoelig voor omgevingsfactoren zoals plagen, ziekten en klimaat, die instabiliteit en variabiliteit in deze geografisch geconcentreerde toeleveringsketen kunnen introduceren, wat resulteert in druk om het aanbod te diversifiëren (4). Ondanks uiteenlopende marktvragen en toenemende leveringsrisico's, blijft de papaverteelt de enige bron van opioïden, deels omdat de chemische synthese van deze complexe moleculen commercieel niet concurrerend is. Er zijn ongeveer 30 chemische syntheses van morfine en derivaten gerapporteerd (5), maar geen enkele is haalbaar voor grootschalige productie.

Een op microben gebaseerd productieproces voor opioïden of opioïde-precursoren, die deel uitmaken van de grotere klasse van benzylisochinoline-alkaloïden (BIA's), heeft het potentieel om veel van de uitdagingen aan te pakken die gepaard gaan met de op papaver gebaseerde toeleveringsketen. Industriële teelt van micro-organismen, zoals bakkersgist Saccharomyces cerevisiae, gebeurt over dagen, terwijl klaprozen eenjarigen zijn. Omdat microben worden gekweekt in gesloten fermentatievaten, is het productieproces ook niet gevoelig voor externe omgevingsfactoren en kan het zorgen voor een grotere consistentie in productsamenstelling en onzuiverheidsprofielen over batches.

In de afgelopen jaren hebben onderzoekers gist ontwikkeld om een ​​verscheidenheid aan plantaardige natuurlijke producten te produceren (6), met name artemisinezuur, een voorloper van het antimalariamiddel artemisinine (7). De halfsynthetische productie van artemisinine heeft nu de markt bereikt en voorziet in een derde van de wereldwijde behoefte (8, 9). Op gist gebaseerde productie van artemisinezuur vereiste de introductie van drie tot zes heterologe plantengenen en talrijke genetische modificaties om de productiviteit te verhogen (7, 9). Hoewel de vooruitgang in de synthetische biologie de complexiteit van plantroutes die kunnen worden gereconstrueerd, heeft vergroot (6), alle inspanningen om gist te manipuleren om BIA's stroomafwaarts van (S)-reticuline, inclusief morfinanen, vertrouwden op een externe levering van BIA-precursoren (1015). Escherichia coli (16) en, zeer recent, gist (17, 18) zijn ontwikkeld om vroege BIA-tussenproducten de novo te produceren. Deze prestaties suggereren dat gist in staat zou kunnen zijn om opioïden te synthetiseren uit eenvoudige koolstof- en stikstofbronnen. Wij en anderen hebben het eerste deel van de biosyntheseroute ontwikkeld, van tyrosine tot (S)-reticuline (17, 18). Afzonderlijk hebben we een tweede deel van de route ontwikkeld, van thebaïne naar morfine (13) anderen ontwikkelden later een pad van (R)-reticuline naar codeïne (15). Het functioneel tot expressie brengen van de meer dan 20 heterologe genen die nodig zijn voor volledige biosynthese van deze complexe moleculen was echter een uitdaging vanwege de verlagingen van de titer die werden waargenomen bij elke extra enzymatische stap. Ook het belangrijkste enzym dat de (S)-benzylisochinoline-steiger naar de (R)-enantiomeer, dat de biosynthetische voorloper is van de promorphinan- en morfinan-steigers, is zelfs na tientallen jaren van studie tot voor kort onbekend gebleven door twee groepen (19, 20) en door ons team, zoals hieronder beschreven.

Tien jaar geleden, toen we begonnen te werken aan het realiseren van totale biosynthese van opioïden in gist, waren we gemotiveerd door de vele voorzienbare voordelen, maar waren we ons bewust van mogelijke negatieve effecten. In het bijzonder waren en blijven we bezorgd dat een opioïdenvoorraad op basis van gist zou kunnen bijdragen aan misbruik van opioïden (21, 22). Dus, voordat we met dit project begonnen, hebben we toestemming gevraagd en gekregen om het uit te voeren via de institutionele onderzoeksregistratie van Stanford University bij de Amerikaanse Drug Enforcement Agency (DEA). Verkrijgen van toestemming vereist (i) achtergrondscreening voor onderzoekers die werken met Schedule II-verbindingen of giststammen die dergelijke verbindingen kunnen maken (ii) gedetailleerde protocollen die fermentatievolumes en verbindingsconcentraties beperken en inclusief voorzieningen voor kweek en productvernietiging en verwijdering onmiddellijk na experimenten (iii) verhoogde fysieke inperking van de stammen en gecontroleerde verbindingen (iv) verhoogde laboratoriumbeveiliging en (v) expliciet beheer en rapportage. Alles bij elkaar genomen verkleinen deze vereisten de kans dat eventuele verbindingen of stammen die in ons onderzoek worden gegenereerd, individuen rechtstreeks in staat zouden stellen opioïden te misbruiken.

We hebben eerst een giststam gebouwd om te produceren (S) -reticuline, een belangrijk biosynthetisch tussenproduct voor veel stroomafwaartse BIA's, waaronder de morfinanen. Deze soort is gebouwd met een nieuw modulair genetisch ontwerp met aanpassingen die zijn ontworpen om een ​​grotere koolstofstroom door tyrosine om te leiden naar (S)-reticuline. De reticuline biosynthetische route werd opgesplitst in vier genetische modules die de coderende sequenties voor 17 biosynthetische enzymen bevatten (Fig. 1A, Fig. S1 en S2 en tabel S1). We selecteerden chromosomale regio's waarvan we geen groeidefect en actieve expressie verwachtten als integratieloci (2325). Een module voor overproductie van precursoren (I), ontworpen om de accumulatie van l-tyrosine en 4-hydroxyfenylacetaldehyde (4-HPAA) te verhogen, codeerde voor de overexpressie van drie of vier gisteiwitten - mutanten van 3-deoxy-d-arabino-2-heptulonzuur 7-fosfaat (DAHP) synthase en chorismaat mutase (Aro4p Q166K , Aro7p T226I ) die minder worden geremd door l-tyrosine, en transketolase (Tkl1p) bovendien, fenylpyruvaat decarboxylase (Aro10p) werd opgenomen in een tweede versie van deze module (afb. S2). Een tetrahydrobiopterine (BH4) module (II) ontworpen om deze zoogdier-redox-cofactor te synthetiseren en te recyclen, codeerde voor de expressie van vier eiwitten van Bruine rat: sepiapterinereductase (SepR), 6-pyruvoyltetrahydrobiopterinesynthase (PTPS), chinonoïde dihydropteridinereductase (QDHPR) en pterinecarbinolaminedehydratase (PCD). Een (S)-norcoclaurinemodule (III), ontworpen om het eerste BIA-ruggengraatmolecuul te synthetiseren, codeerde voor de expressie van vier eiwitten: een mutant van tyrosinehydroxylase (TyrH WR-mutaties R37E, R38E, W166Y) die minder wordt geremd door l-tyrosine en catecholamines, van R. norvegicus de BH4 bergingsenzym dihydrofolaatreductase (DHFR), ook van R. norvegicus DOPA-decarboxylase (DoDC) uit de bacteriën Pseudomonas putida en norcoclaurinesynthase (NCS) uit de plant Coptis japonica. Een (S)-reticulinemodule (IV), ontworpen om het belangrijkste BIA-vertakkingspuntmolecuul te synthetiseren, codeerde voor de expressie van vijf plantaardige eiwitten, vier van P. somniferum—norcoclaurine 6-O-methyltransferase (6OMT), coclaurine-N-methyltransferase (CNMT), 4′-O-methyltransferase (4′OMT) en cytochroom P450-reductase (CPR) - evenals N-methylcoclaurine hydroxylase (NMCH) van Eschscholzia californica. De enzymvarianten werden geselecteerd op basis van onderzochte activiteiten in gemanipuleerde gist (11, 18) en omvatte de toevoeging van verschillende nieuwe activiteiten (d.w.z. Aro10p, DHFR) om de flux naar de biosynthese van reticuline te vergroten.

(EEN) Biosynthetisch schema voor de productie van thebaïne en hydrocodon uit suiker. Thebaïne is een uitgangsmateriaal voor veel opioïde geneesmiddelen via biosynthetische en semi-synthetische routes. Blokpijlen geven door enzym gekatalyseerde stappen aan. Lichtgrijze pijlen, ongemodificeerde gistenzymen donkergrijze pijlen, tot overexpressie gebrachte en gemodificeerde gistenzymen paarse pijlen, zoogdier (Bruine rat) enzymen oranje pijlen, bacterieel (Pseudomonas putida) enzymen groene pijlen, plant (Papaver somniferum, P. bracteatum, Coptis japonica, Eschscholzia californica) enzymen. Gele contouren highlights DRS-DRR rode contouren highlights ontworpen SalSyn. E4P, erythrose 4-fosfaat PEP, fosfoenolpyruvaat DAHP, 3-deoxy- d -arabino-2-heptulonzuur 7-fosfaat 4-HPP, 4-hydroxyfenylpyruvaat 4-HPAA, 4-hydroxyfenylaceetaldehyde BH4, 5,6,7,8-tetrahydrobiopterine Tkl1p, transketolase CPR, cytochroom P450-reductase Aro4p Q166K , DAHP-synthase Aro1p, pentafunctioneel aroma enzym Aro2p, bifunctioneel chorismaatsynthase en flavinereductase Aro7p T226I , chorismaatmutase Tyr1p, prefenaatdehydrogenase Aro8p, aromatisch aminotransferase I Aro9p, aromatisch aminotransferase II Aro10p, fenylpyruvaatdecarboxylase TyrH WR , feedbackremming – DC , l-DOPA decarboxylase NCS, (S) -norcoclaurinesynthase 6OMT, norcoclaurine 6-O-methyltransferase CNMT, coclaurine N-methyltransferase NMCH, N-methylcoclaurinehydroxylase 4′OMT, 3′-hydroxy-N-methylcoclaurine 4′-O-methyltransferase DRS-DRR, 1,2-dehydroreticulinesynthase-1,2-dehydroreticulinereductase SalSyn, salutaridinesynthase SalR, salutaridinereductase SalAT, salutaridinol 7-O-acetyltransferase T6ODM, thebaïne 6-O-demethylase morB, morfinonreductase. Zie vijgen. S1 en S2 voor details van de BH4 biosynthese, recycling en bergingsroute, conversie van (S)-norcoclaurine naar (S)-reticuline en genetische routemodules. (B) Optimalisatie van de reticuline-producerende platformstam door middel van pathway en strain engineering. Reticuline in de groeimedia werd geanalyseerd door LC-MS/MS meervoudige reactiemonitoring (MRM) en gekwantificeerd met een externe standaardcurve. Foutbalken vertegenwoordigen SD van drie biologische replica's. (C) Chirale analyse van reticuline geproduceerd door de platformstam. Reticuline werd geïsoleerd uit het groeimedium van stam CSY1061 en gescheiden op een chirale kolom. Dit chromatogram is een van de twee vergelijkbare sporen van gerepliceerde gistculturen en werd gladgestreken met behulp van een voortschrijdend gemiddelde van een 7-punts boxcar.

De BIA-modules werden geïntegreerd in een wildtype haploïde CEN.PK2-stam. We hebben de reticulineproductie getest door giststammen te kweken in minimale synthetische complete media aangevuld met ascorbinezuur zonder ammoniumsulfaat gedurende 72 uur (fig. S3) en de groeimedia te analyseren op BIA-moleculen door vloeistofchromatografie gekoppeld aan tandemmassaspectrometrie (LC-MS/MS ) (tabel S2). Een minimale reticuline-producerende stam (CSY1057 tabel S3), waarin modules II tot IV waren opgenomen, produceerde reticuline met een titer van 12,3 g/liter (Fig. 1B, Fig. S4A, en Tabel S4). De toevoeging van module I aan de stam, waardoor de toevoer van BIA-precursoren werd verhoogd, resulteerde in een verbetering van de reticulineaccumulatie met een factor 1,6, met of zonder Aro10p (CSY1059, 20,0 g/liter CSY1058, 20,7 g/liter). We observeerden bijna volledige consumptie van l-DOPA (90 μg/liter fig. S4B en tabel S4), aanzienlijke accumulatie van dopamine (10 mg/liter fig. S4C), en accumulatie van 3′-hydroxy-N-methylcoclaurine (fig. S4, D en E) door LC-MS/MS voor de stam die modules I tot IV herbergt (CSY1059). We veronderstelden dat (i) verhoogde expressie van NCS de omzetting van dopamine en de natieve gistmetaboliet 4-HPAA naar norcoclaurine en stroomafwaartse producten zou verhogen, (ii) verhoogde expressie van TyrH WR de toevoer van dopamine zou aanvullen, en (iii) verhoogde expressie van 4′OMT zou de accumulatie van 3′-hydroxy-N-methylcoclaurine en verhogen de flux naar reticuline. Daarom ontwierpen we een knelpuntmodule (V), die codeerde voor de overexpressie van drie eiwitten - TyrH WR, 4'OMT en NCS - door extra genkopieën op te nemen. De module is geïntegreerd in CSY1059 en ontworpen om de native ZWF1 gen (zwf1Δ CSY1061) of om te integreren in een aparte locus (CSY1060). Een gistplatformstam met toevoeging van module V aan de zwf1 locus resulteerde in een verdere factor 4 verbetering in reticulineaccumulatie (82 μg/liter Fig. 1B en tabel S4) en een overeenkomstige factor 2 afname in geaccumuleerde 3′-hydroxy-N-methylcoclaurine ten opzichte van CSY1059 (fig. S4D).

Reticuline geproduceerd door de gistplatformstam CSY1061 werd geïsoleerd door middel van reverse-phase high-performance vloeistofchromatografie en geanalyseerd met chirale LC-MS. De chirale analyse gaf aan dat het grootste deel van het geproduceerde reticuline de (S)-enantiomeer (Fig. 1C), zoals werd verwacht vanwege de stereospecificiteit van de NCS-gekatalyseerde condensatie. De productie van voornamelijk de (S)-enantiomeer in onze platformstam bevestigt vergelijkbare waarnemingen van andere bacteriën en gisten die zijn ontwikkeld met de drie methyltransferase-enzymen, zelfs wanneer racemische substraten worden gevoed (10, 1517). Papaver heeft het unieke vermogen om (S)-reticuline naar (R)-reticuline, waarvan de morfinan-alkaloïden zijn afgeleid (26, 27). Hoewel uitgebreide isotopenvoeding en biochemische studies hebben aangetoond dat de epimerase-activiteit verloopt via oxidatie tot een Schiff-base-intermediair en stereospecifieke reductie (Fig. 2A), de 1,2-dehydroreticulinesynthase (DRS) en 1,2-dehydroreticulinereductase (DRR) enzym(en) waren niet geïsoleerd en gesequenced toen we met onze studie begonnen (2729). Terwijl we dit manuscript aan het voorbereiden waren voor indiening, rapporteerde een groep de ontdekking van dit enzym in P. somniferum door mutante allelen van chemisch gemutageniseerde papaverplanten te karakteriseren (19). Terwijl ons manuscript werd beoordeeld, rapporteerde een andere groep het gebruik van plantentranscriptoomdatabases om kandidaten te identificeren en vervolgens het gen van te klonen P. somniferum cDNA (20). Onze aanpak maakte in plaats daarvan gebruik van planttranscriptoomdatabases, DNA-synthese en de gemanipuleerde (S)-reticuline-producerende giststammen, dus geen toegang tot fysiek plantaardig materiaal.

(EEN) Biosynthetisch schema voor de reactie gekatalyseerd door DRS-DRR Me, methyl. (B) Identificatie van DRS-DRR via bioinformatische analyse van COR-achtige sequenties. Bioinformatische zoekopdracht was COR VIGS-sequentie. Onderwerp sequenties waren de P. bracteatum PhytoMetaSyn-transcriptoom P. bracteatum, P. setigerum, P. somniferum, en P. rhoeas transcriptomen van het 1000 Plants Project en alle gedeponeerde sequenties in GenBank die behoren tot Papaveraceae. De schaalbalk geeft de hoeveelheid genetische verandering in aminozuursubstituties per site aan. Rood gemarkeerde takken geven sequenties aan die zowel CYP- als COR-achtige domeinen bevatten. Fylogenetische boom werd gegenereerd met behulp van ClustalX bootstrap buur-joining tree met 1000 proeven. (C) Chirale analyse van reticuline geproduceerd door giststammen die het enzym DRS-DRR tot expressie brengen en niet tot expressie brengen. Chirale analyse van reticuline geaccumuleerd in de groeimedia van stam CSY1071 met lege vector of DRS-DRR (pCS3301) werd uitgevoerd zoals beschreven in Fig. 1C. Dit chromatogram is een van de twee vergelijkbare sporen van gerepliceerde gistculturen en werd gladgestreken met behulp van een voortschrijdend gemiddelde van een 7-punts boxcar.

Meer specifiek merkten we op dat twee onafhankelijke onderzoeken naar genuitschakeling van planten hebben aangetoond dat de knockdown van codeïnonreductase (COR) resulteert in accumulatie van reticuline, en in één geval specifiek (S)-reticuline accumulatie (30, 31). We veronderstelden dat een COR-achtig enzym de stereospecifieke reductie kan katalyseren en gebruikten de gepubliceerde virus-geïnduceerde gen-uitschakeling (VIGS)-sequentie als een BLAST-query tegen Papaver soorten in het 1000 Plants Project (32) en PhytoMetaSyn (33, 34) transcriptoomdatabases. Hit-identiteit werd bepaald door een omgekeerde BLAST-zoekopdracht tegen sequenties die in GenBank waren gedeponeerd. Van de 38 geïdentificeerde COR-achtige sequenties die ook langer waren dan 300 nucleotiden, hadden er vier een cytochroom P450-oxidase (CYP) 82Y1-achtig domein en een COR-achtig domein in een enkel open leesraam (DRS-DRR Fig. 2B ). We waren van mening dat dit natuurlijke fusie-eiwit zowel de oxidatie als de reductie zou kunnen katalyseren die nodig is voor (S)-reticuline epimerisatie. We stellen voor dat de oxidatie tot 1,2-dehydroreticuline kan plaatsvinden via een carbinolamine of een enamine-tussenproduct, en dat 1,2-dehydroreticuline vervolgens stereospecifiek wordt gereduceerd tot (R)-reticuline door het COR-achtige DRR-domein (fig. S5).

Om aanvullende varianten van deze coderende sequentie te identificeren en te bepalen hoe wijdverbreid het in de natuur is, gebruikten we de aminozuursequentie van P. bracteatum DRS-DRR (Pbr.89405) om beide databases te doorzoeken op getranslateerde BLAST-nucleotiden (tBLASTn). Een zoektocht naar alle sequenties in de PhytoMetaSyn-database (67 plantensoorten) en de transcriptoomdatabase van het 1000 Plants Project (1328 samenstellingen afgeleid van een paar honderd plantensoorten) identificeerde in totaal vijf schijnbare volledige lengte en 10 gedeeltelijke unieke sequenties die beide domeinen herbergden (fig. S6), afkomstig uit P. somniferum (papaver), P. setigerum (papaver van Troje), P. bracteatum (Iraanse papaver), of Chelidonium majus (grote stinkende gouwe). Uit deze secundaire zoekopdracht (fig. S6) identificeerden we a P. somniferum DRS-DRR-sequentie van belang, Pso.2062398, een sequentie van volledige lengte die consensus had met verschillende individuele transcriptoomhits.

Om te bepalen of het geïdentificeerde DRS-DRR-enzym epimerase-activiteit bezit, hebben we het DRS-DRR-enzym gekarakteriseerd in de context van een giststam die is ontwikkeld om (S)-reticuline van gevoed rac-norlaudanosoline (CSY1071 fig. S1C) (11). In voorlopige experimenten hebben we de drie varianten gescreend van P. bracteatum die samenklonterden in de eerste zoekopdracht - Pbr.89405, Pbr.12180 en Pbr.4328 - in stam CSY1071 met low-copy plasmiden die expressiecassettes herbergen voor voor gistcodon geoptimaliseerde DRS-DRR en voor gistcodon geoptimaliseerde P. somniferum salutaridinesynthase (yPsSalSyn). Codon-optimalisatie van alle synthetische genen werd uitgevoerd door Life Technologies (35). Wanneer 1 mM norlaudanosoline werd gevoed, produceerde alleen de stam die codeert voor DRS-DRR-variant Pbr.89405 substantieel salutaridine. We hebben stam CSY1071 gekweekt die het low-copy plasmide bevat dat dit herbergt DRS-DRR (Pbr.89405, pCS3301) met 1 mM rac-norlaudanosoline gedurende 72 uur en geïsoleerd reticuline uit de groeimedia voor chirale LC-MS-analyse. In stammen die de DRS-DRR tot expressie brengen, was meer dan de helft van de geproduceerde reticuline de (R)-enantiomeer, terwijl uitsluitend (S)-reticuline werd gedetecteerd in stammen die het DRS-DRR-gen missen (Fig. 2C).

Vervolgens onderzochten we de activiteit van DRS-DRR-enzymvarianten in de context van de stroomafwaartse conversiestappen naar thebaïne, het eerste morfinan-alkaloïde in opiaatbiosynthese. In voorlopige experimenten, gistcodon-geoptimaliseerde salutaridinereductase (SalR) varianten van P. bracteatum en P. somniferum en plaatsgerichte mutanten waarvan werd gemeld dat ze substraatremming verminderen en de maximale reactiesnelheid verhogen Vmax (36, 37) werden onderzocht op hun vermogen om de omzetting van salutaridine naar thebaïne te katalyseren met voor gistcodon geoptimaliseerde salutaridinolacetyltransferase (SalAT) varianten van P. somniferum, P. bracteatum, en P. orientale. De P. bracteatum SalR (PbSalR) en P. somniferum SalAT (PsSalAT) enzymen vertoonden de hoogste activiteiten in gist (fig. S7, A en B). Een kunstmatig gist-chromosoom (YAC, pCS3308) dat codeert voor expressiecassettes voor yPsSalSyn, PbSalR en PsSalAT werd geassembleerd in stam CSY1071 en DRS-DRR-varianten werden tot expressie gebracht vanuit plasmiden met een lage kopie (pCS3300-3305). De resulterende stammen werden getest door 1 mM . te voeren race-norlaudanosoline gedurende 72 uur, en het groeimedium werd geanalyseerd op thebaïneproductie. P. bracteatum en P. somniferum DRS-DRR-enzymen (Pbr.89405, Pso.2062398) resulteerden in vergelijkbare thebaïneproductie (fig. S7C), en de P. bracteatum In volgende experimenten werd DRS-DRR (PbDRS-DRR) gebruikt. Expressiecassettes voor de vier genen werden geassembleerd tot een YAC (pCS3309) in stam CSY1071 en de resulterende stam werd getest op thebaïneproductie uit gevoederd rac-norlaudanosoline. Deze stam produceerde thebaïne in een concentratie van 17 g/liter wanneer gekweekt met 1 mM rac-norlaudanosoline gedurende 96 uur (Fig. 3C en tabel S5). Echter, aanzienlijke accumulatie van de intermediaire reticuline (

(EEN) Schema van de chimere SalSyn-engineeringstrategie om onjuiste verwerking en glycosylering van het wildtype SalSyn in gist aan te pakken. Oranje diamanten vertegenwoordigen glycosylering. (B) Vergelijking van salutaridine geproduceerd uit SalSyn-varianten, plaatsgerichte glycosyleringsmutanten en gemanipuleerde fusies in gist. Giststammen die de aangegeven SalSyn-variant tot expressie brengen, kregen 10 μM (R)-reticuline, en het groeimedium werd geanalyseerd met LC-MS/MS MRM. Piekgebieden werden genormaliseerd naar wildtype SalSyn (zwart). (C) Vergelijking van thebaïne geproduceerd uit SalSyn-varianten in gist. Giststammen kregen 1 mM rac-norlaudanosoline en thebaïne in het groeimedium werd gekwantificeerd met LC-MS/MS MRM met een externe standaardcurve. Strepen omlijnd in zwart duiden wildtype en best ontworpen variant aan. Foutbalken zijn SD van ten minste drie biologische replica's.

Omdat DRS-DRR redelijk efficiënt is in de conversie van (S)- tot (R)-reticuline (Fig. 2C), gaf de accumulatie van reticuline aan dat de omzetting van (R)-reticuline naar salutaridine, gekatalyseerd door SalSyn, rechtvaardigde verdere optimalisatie. Western-blot-analyse gaf aan dat door gist tot expressie gebracht SalSyn-eiwit aanwezig was als drie vormen die konden worden onderscheiden door schijnbaar molecuulgewicht, terwijl SalSyn tijdelijk tot expressie werd gebracht in Nicotiana benthamiana (tabak) was voornamelijk aanwezig bij het laagste van deze drie schijnbare molecuulgewichten (fig. S8A). Plaatsgerichte mutagenese van drie potentiële N-gekoppelde glycosyleringsplaatsen [Asn-X-Thr/Ser (N-X-T/S)] gaf aan dat de drie banden voortkwamen uit glycosylering van het eiwit op twee plaatsen, Asn 105 en Asn 331. N-gekoppelde glycosylering in gist is indicatief voor onjuiste N-terminale sortering van het ontluikende SalSyn-polypeptide naar het lumen van het endoplasmatisch reticulum (ER), waar het N-geglycosyleerd is in plaats van het N-uiteinde in het buitenste ER-membraan te verankeren en de katalytisch domein in het cytosol, zoals typisch is voor microsomale CYP's (Fig. 3A en Fig. S8B) (38, 39). We veronderstelden dat deze verkeerde verwerking de SalSyn-activiteit in gist verminderde. Het modificeren van het glycosyleringspatroon van SalSyn door de glycosyleringsplaatsen te muteren, verminderde echter de conversie van (R) -reticuline tot salutaridine ten opzichte van het wildtype gistcodon-geoptimaliseerde enzym (Fig. 3B).

We hebben eiwitengineering uitgevoerd om de N-terminale sortering van het ontluikende SalSyn-polypeptide te corrigeren, N-gebonden glycosylering te voorkomen en de activiteit van het enzym in gist te verbeteren. Cheilanthifolinesynthase (CVS) is een plantaardig cytochroom P450 dat 61 tot 68% identiek is aan SalSyn, een hoge activiteit vertoont wanneer het tot expressie wordt gebracht in gist (14), en is niet geglycosyleerd in gist ondanks het feit dat één N-X-T/S-plaats identiek is aan de SalSyn-sequentie (fig. S8C). We ontwierpen gistcodon-geoptimaliseerde coderende sequenties voor chimere eiwitten met een of meer N-terminale a-helices van CVS die die van SalSyn-varianten van P. somniferum en P. bracteatum, met verbindingspunten voor de fusies geselecteerd op basis van aminozuuruitlijningen en/of secundaire eiwitstructuurmotieven. Western-blot-analyse van de chimere eiwitten gaf aan dat verschillende van de gemanipuleerde SalSyn-enzymen aanwezig waren als een enkele band in gist, vergelijkbaar met het expressiepatroon dat werd waargenomen voor het in planten tot expressie gebrachte ouderenzym (fig. S8D). De gegevens gaven aan dat de verkeerde verwerking van het ontluikende eiwit in gist dat resulteerde in N-gekoppelde glycosylering werd hersteld door de gemanipuleerde fusies. Als alternatieve strategie werd de coderende sequentie voor het SalSyn CYP-domein gekloond in plaats van het CYP-domein in het cytosolische Bacillus megaterium P450 mono-oxygenase CYP102A1 (BM3), resulterend in een chimeer eiwit met gefuseerde CYP- en cytochroom P450-reductasedomeinen. De chimere SalSyn-eiwitten werden tot expressie gebracht vanuit een laag-kopie plasmide in CSY1071 en getest op salutaridineproductie van gevoed (R)-reticuline. Verschillende van de gemanipuleerde SalSyn-varianten vertoonden verbeterde activiteit ten opzichte van zowel de wild-type als codon-geoptimaliseerde enzymen, met de gemanipuleerde P. bracteatum variant yEcCFS 1-83 -yPbSalSyn 92-504 met een grotere conversie van (R)-reticuline tot salutaridine met een factor

6 (Fig. 3B) en grotere conversie van rac-norlaudanosoline tot thebaïne met een factor van >3 (55 g/liter Fig. 3C en tabel S5) ten opzichte van wildtype PsSalSyn.

Om een ​​giststam te ontwikkelen die thebaïne produceert uit eenvoudige koolstof- en stikstofbronnen, hebben we een thebaïnemodule (VI) ontworpen die codeert voor de expressie van de beste enzymvarianten die in ons werk zijn geïdentificeerd: PbDRS-DRR, yEcCFS 1-83 -yPbSalSyn 92-504 , PbSalR en PsSalAT—om te converteren (S)-reticuline aan het morfinaan-alkaloïde thebaïne. Thebaïne wordt gewonnen uit papaver voor gebruik bij de halfsynthese van een aantal opioïden. Deze module werd toegevoegd aan de reticuline-producerende platformstam (CSY1060) als een chromosomale integratie (CSY1064). De resulterende stammen werden gedurende 120 uur in minimaal medium gekweekt en de groeimedia werden getest op thebaïne (Fig. 4, A en B). Deze stammen - met 24 heterologe expressiecassettes, 21 nieuwe enzymactiviteiten, overexpressie van twee natieve enzymen en inactivering van één natuurlijk enzym - produceerden thebaïne in concentraties van 6,4 ± 0,3 g/liter (tabel S6). We hebben de gereconstrueerde biosynthetische route verder uitgebreid tot een stroomafwaarts opioïde medicijn, hydrocodon (Fig. 1A), dat een hoofdcomponent is in het op één na meest verstrekte receptgeneesmiddel in de Verenigde Staten (40). Een hydrocodonmodule (VII), die codeert voor de expressie van thebaïne 6-O-demethylase (T6ODM) van P. somniferum en morfinereductase (morB) van P. putida M10 (13), werd geïntroduceerd als een YAC (pCS2765) in de thebaïne-producerende stam CSY1064. De resulterende stam werd gekweekt in minimaal medium met 50 mM 2-oxoglutaraat om T6ODM-activiteit gedurende 120 uur te ondersteunen en de groeimedia werden getest op opioïde verbindingen (Fig. 4, C en D, en tabel S6). De gemanipuleerde gist was in staat om lage niveaus van hydrocodon te produceren,

0,3 g/liter. We hebben dus de haalbaarheid aangetoond van het uitbreiden van de route naar verbindingen van belang via een biosynthetische route die niet aanwezig is in de natieve papaver zonder de stroomafwaartse chemische synthese te moeten incorporeren.

(EEN) Chromatogrammen van thebaïne gedetecteerd in CSY1064-media en in een thebaïne-standaard (7,8 g/liter, 25 nM). (B) Spectra van acht MRM-overgangen van thebaïne geproduceerd door gemanipuleerde gist en de thebaïne-standaard. (C) Chromatogrammen van hydrocodon gedetecteerd in CSY1064+pCS2765-media en in een hydrocodonstandaard (0,3 g/liter, 1 nM). (NS) Spectra van vier MRM-overgangen van hydrocodon geproduceerd door gemanipuleerde gist en de hydrocodonstandaard. Groeimedium werd geanalyseerd op opioïden door LC-MS/MS MRM. Sporen zijn representatief voor vier biologische replicaten.

Dit werk vertegenwoordigt de volledige biosynthese van opiaten in een heterologe gastheer, beginnend bij het centrale metabolisme. Door onze synthetische benadering hebben we het vermogen van DRS-DDR-varianten van verschillende fabrieken om de (S)- tot (R)-epimerisatie van reticuline in de context van de heterologe opiaatbiosyntheseroute. De engineering van gist die in staat is om centrale metabolieten om te zetten in de complexe pentacyclische morfinan-scaffold, vereiste enzymengineering om de verwerking te corrigeren en de activiteit van de sleutelroute cytochroom P450 te verhogen, leidend tot de promorfinan-scaffold (SalSyn), evenals route- en stamoptimalisatie, waaronder de expressie van 21 heterologe enzymen van planten, zoogdieren, bacteriën en gisten, overexpressie van twee natieve gistenzymen en deletie van één natuurlijk gistgen. Het huidige rapport vertegenwoordigt een principebewijs voor het genereren van morfinan-steigers de novo in gist, en opent de mogelijkheid om deze en andere moleculen te derivatiseren door nieuwe biosynthetische of semi-synthetische routes om hun therapeutische eigenschappen te verbeteren.

5 g/liter zou nodig zijn voor de op gist gebaseerde productie van opioïden om een ​​haalbaar alternatief te zijn voor de papaverteelt voor commerciële productie. Aangezien dit een opbrengstverhoging van meer dan vijf ordes van grootte vertegenwoordigt, zouden de hier gerapporteerde stammen niet geschikt zijn voor commerciële opschaling. Toekomstige technische inspanningen zouden kunnen profiteren van de rol van de route als elektronenput voor fermentatieve productie om een ​​grotere elektronen- en koolstofstroom naar de opiaten te leiden in plaats van naar ethanol of andere fermentatieproducten. Bij commerciële productiviteiten,

5 ml gist die over meerdere dagen is gekweekt, zou een dosis pijnmedicatie opleveren, die momenteel wordt verkregen uit 0,2 m2 papaverveld in de loop van een jaar door opiaten uit suiker en gist te halen in plaats van papaver zou het totale landoppervlak kunnen verkleinen vereist voor productie met een factor >500.

Er bestaat enige bezorgdheid dat de biosynthese van opioïden in gist binnenkort kan leiden tot opiaten die ‘zelfgemaakt’ worden (41). De productieniveaus die hier onder gecontroleerde fermentatieomstandigheden worden bereikt, maken het thuisbrouwen van deze medicijnen niet mogelijk en zijn ook niet economisch concurrerend met de papaverteelt voor het leveren van legale of illegale markten. Met name bij de hier vermelde titers (<1 g/liter), zou een enkele dosis hydrocodon, zoals gebruikt in Vicodin (5 mg), duizenden liters fermentatiebouillon vereisen, wat geen enkele thuisbrouwer redelijkerwijs zou nastreven. Dergelijke verbeteringen zijn niet alleen een kwestie van fermentatie-opschaling en vereisen aanvullend onderzoek om de noodzakelijke stam- en padverbeteringen te bereiken. Het hier gerapporteerde werk biedt dus geen "recept" voor het maken van opioïde medicijnen op een manier die de volksgezondheid of veiligheid rechtstreeks ondermijnt. Desalniettemin produceren onze giststammen, als waarborg voor de toekomstige volksgezondheid, alleen opioïden (bijv. hydrocodon, thebaïne) met een verminderd potentieel voor omleiding naar illegale markten vanwege de extra stappen en kosten van het chemisch omzetten van deze specifieke verbindingen in heroïne. Hoewel dergelijke stammen mogelijk verder ontwikkeld zouden kunnen worden om direct morfine te produceren, leverde voorafgaand werk om thebaïne om te zetten in morfine slechts een opbrengst van 1,5% op (13). Dus, als een ruwe schatting, zou een stam die suiker omzet in morfine een verbetering van de totale opbrengst met een factor van

7 × 106 ten opzichte van het hier gerapporteerde werk.

Ondanks deze voorzorgsmaatregel mag in de komende jaren een aanzienlijk verbeterde productie van opioïden via gist worden verwacht. Meer in het algemeen benadrukt ons werk het potentieel van gist als chassis voor de biogebaseerde productie van veel complexe chemicaliën en materialen. Synthetische biologie staat klaar om veel toeleveringsketens te vervangen of aan te vullen met geavanceerde biogebaseerde productie. Een sterk uitgebreide capaciteit om te bouwen met biologie zal bijdragen aan veranderingen in het gebruik van land en natuurlijke hulpbronnen, werkgelegenheid en beleid. Praktische strategieën die problemen aanpakken en tegelijkertijd innovatie en het realiseren van voordelen mogelijk maken, moeten nu worden ontwikkeld om onze toekomstige bio-economie veilig te stellen. Gezien de complexiteit en diversiteit van zowel de potentiële zorgen als de mogelijke voordelen, zouden we sterk voorstander zijn van een open overlegproces dat opties ontwikkelt voor de governance (42) van de biosynthese van medicinale verbindingen voordat economisch concurrerende processen worden gerealiseerd.


Carotenoïden in de natuur

Dit uitgebreide, geredigeerde boek onderzoekt carotenoïden en hun belangrijke functionele rollen in gisten, bacteriën en planten en een diepgaande uiteenzetting over de structuren van carotenoïde moleculen, met de nadruk in het eerste van drie delen op de biosynthese van carotenoïden. De regulatie van de biosynthese van carotenoïden in zowel fotosynthese als in planten, fruit, opslagwortels en algen staat centraal in het tweede deel, en ontdekkingen over de functie van carotenoïden in de menselijke gezondheid komen aan bod in het derde en laatste deel. Veel nuttige illustraties, uitleg, overzichten en voorbeelden helpen de lezers op de hoogte te houden van relevante thema's, waaronder carotenogene genen, carotenoïden in fruit en metabolic engineering.

Het boek onderzoekt waar carotenoïden in de natuur worden gesynthetiseerd, ook in wortelen en algen. Bijdragende deskundige auteurs onderzoeken enzymfuncties en plantmodellen en analyseren de structuur van carotenoïde moleculen. Vervolgens wordt de functie van carotenoïden in de fotosynthese en in fotosynthetische organen en tijdens het rijpen van fruit onderzocht. Een heel hoofdstuk is gewijd aan het laatste onderzoek naar apocarotenoïden en andere hoofdstukken behandelen interessante en nieuwe thema's over de ontwikkeling van plastiden en de epigenetische regulatie die de carotenoïdensynthese in planten beïnvloedt. De metabolische engineering van carotenoïden die is gedaan in fruit, planten en zaden is een ander gebied dat lezers kunnen verkennen, samen met bewijzen over de functie van carotenoïden in menselijke voeding, als antioxidanten, zoals bij de controle van het lipidenmetabolisme en in de absorptie van carotenoïden.

Dit is een zeer informatief en veelomvattend werk dat onderzoekers in het veld zal updaten, evenals het ondersteunen van studenten plantenfysiologie en biotechnologie, als aanvullende lectuur.


Akhter, S., Aziz, R.K., en Edwards, R.A., 2012. Phispy: een nieuw algoritme voor het vinden van profagen in bacteriële genomen dat op gelijkenis en samenstelling gebaseerde strategieën combineert. Onderzoek naar nucleïnezuren, 40. (16): 329–334.

Arrach, N., Fernandez-Martin, R., Cerda-Olmedo, E., en Ava-los, J., 2001. Een enkel gen voor lycopeencyclase, fytoeensynthase en regulatie van caroteenbiosynthese in Phyco-myces. Proceedings van de National Academy of Sciences van de Verenigde Staten van Amerika, 98. (4): 1687–1692.

Buzzini, P., Innocenti, M., Turchetti, B., Libkind, D., van Broock, M., en Mulinacci, N., 2007. Carotenoïde profielen van gisten die tot de geslachten behoren Rhodotorula, Rhodosporidium, Sporobolomyces, en sporidiobolus. Canadian Journal of Microbiologie, 53. (8): 1024–1031.

Chin, CS, Peluso, P., Sedlazeck, FJ, Nattestad, M., Conception, GT, Clum, A., Dunn, C, O'Malley, R., Figueroa-Balderas, R., en Morales-Cruz, A., 2016.Gefaseerde diploïde genoomassemblage met realtime sequencing van één molecuul. Natuurmethoden, 13. (12): 1050–1054.

Dasgupta, D., Sharma, T., Bhatt, A., Bandhu, S., en Ghosh, D., 2017. Teelt van olieachtige gist Rhodotorula mucilaginos. IIPL32 in luchtbrugreactor met gesplitste kolom en de invloed ervan op brandstofeigenschappen. Biokatalyse en landbouwbiotechnologie, 10: 308–316.

Deligios, M., Fraumene, C., Abbondio, M., Mannazu, I., Tanca, A., Addis, M.F., en Uzzau, S., 2015. Ontwerp-genoomsequentie van Rhodotorula mucilaginosa, een opkomende opportunistische ziekteverwekker. Genoomaankondigingen, 3 (2): 1–2.

Frengova, G.I., en Beshkova, D.M., 2009. Carotenoïden van Rhodotorul. en Phaffia. Gisten van biotechnologisch belang. Journal of Industrial Microbiology & Biotechnology, 36 (2): 163–180.

Gan, H.M., Thomas, B.N., Cavanaugh, N.T., Morales, G.H., Mayers, A.N., Savka, M.A., en Hudson, A.O., 2017. Gehele genoomsequencing van Rhodotorula mucilaginos. geïsoleerd van de kauwstok (Distemonanthus bentha-mianus): Inzichten in Rhodotorula-fylogenie, mitogenoomdynamica en carotenoïde biosynthese. PeerJ, 5 (1): e4030.

Hawksworth, D.L., Kirk, P.M., Sutton, B.C., en Pegler, D.N., 1996. Ainsworth & Bisby's woordenboek van de schimmels. Revista do Instituto de Medicina Tropical de Sao Paulo, 38. (4): 17–19.

Hernandez-Almanza, A., Montanez, J.C., Aguilar-Gonzalez, M.A., Martinez-Avila, C, Rodriguez-Herrera, R., en Aguilar, C.N., 2014. Rhodotorula glutini. als bron van pigmenten en metabolieten voor de voedingsindustrie. Voedsel Biowetenschap, 5. (Volledig): 64-72.

Huerta-Cepas, J., Szklarczyk, D., Forslund, K., Cook, H., Heller, D., Walter, MC, Rattei, T., Mende, DR, Sunagawa, S., en Kuhn, M. , 2016. eggNOG 4.5: Een hiërarchisch orthologisch raamwerk met verbeterde functionele annotaties voor eukaryote, prokaryotische en virale sequenties. Onderzoek naar nucleïnezuren, 44: D286-D293.

Ignatova, L.V., Brazhnikova, Y.V., Berzhanova, R.Z., en Mukasheva, T.D., 2015. Plantgroeibevorderende en antischimmelactiviteit van gisten uit donkere kastanjegrond. Microbiologisch onderzoek, 175: 78–83.

Koonin, EV, Fedorova, ND, Jackson, JD, Jacobs, AR, Krylov, DM, Makarova, KS, Mazumder, R., Mekhe-dov, SL, Nikolskaya, AN, en Rao, BS, 2004. Een uitgebreide evolutionaire classificatie van eiwitten die worden gecodeerd in volledige eukaryote genomen. Genoombiologie, 5 (2): R7-R7.

Kot, A. M., Blazejak, S., Gientka, I., Kieliszek, M., en Brys, J., 2018. Toruleen en torularhodin: "nieuwe" schimmelcarotenoïden voor de industrie? Microbiële celfabrieken, 17. (1): 49.

Landolfo, S., Ianiri, G., Camiolo, S., Porceddu, A., Mulas, G., Chessa, R., Zara, G., en Mannazzu, I., 2018. CAR-gencluster en transcriptniveaus van carotenogene genen in Rhodotorula mucilaginosa. Microbiologie, 164. (1): 78–87.

Li, C., Zhang, N., Li, B., Xu, Q., Song, J., Wei, N., Wang, W., en Zou, H., 2017. Verhoogde toruleenaccumulatie in rode gist Sporidiobolus pararoseu. NGR als stressreactie op omstandigheden met veel zout. Voedsel scheikunde, 237: 1041–1047.

Lomsadze, A., Terhovhannisyan, V., Chernoff, Y. O., en Bo-rodovsky, M., 2005. Genidentificatie in nieuwe eukaryote genomen door zelftrainingsalgoritme. Onderzoek naar nucleïnezuren, 30. (20): 6494–6506.

Ma, W., Chen, X., Wang, B., Lou, W., Chen, X., Hua, J., Sun, YJ, Zhao, Y., en Peng, T., 2017. Karakterisering, antioxidant -ativiteit en anti-carcinoomactiviteit van exopolysaccharide-extract van Rhodotorula mucilaginos. CICC 33014. Koolhydraatpolymeren, 181: 768.

Mata-Gomez, L.C., Montanez, J.C., Mendez-Zavala, A., en Aguilar, C.N., 2014. Biotechnologische productie van carotenoïden door gisten: een overzicht. Microbiële celfabrieken, 13. (1): 12.p.

Medema, MH, Blin, K., Cimermancic, P., De Jager, V., Zakrzewski, P., Fischbach, MA, Weber, T., Takano, E., Breitling, R., 2011. AntiSMASH: snelle identificatie , annotatie en analyse van secundaire metabolietbiosynthesegenclusters in bacteriële en schimmelgenoomsequenties. Onderzoek naar nucleïnezuren, 39. (webserverprobleem): W339.

Minora, K., Goto, S., Kawashima, S., Okuno, Y., en Hattori, M., 2004. De KEGG-bron voor het ontcijferen van het genoom. Onderzoek naar nucleïnezuren, 32: 277–280.

Akhtyamova, N., en Sattarova, R.K., 2013. Endofytische gist Rhodotorula rubr. stam TG-1: Antagonistische en gewasbeschermingsactiviteiten. Biochemie & Rhysiologie, 2. (1): 1000104. DOI: 10.4172/2168-9652.1000104.

Prado-Cabrero, A., Scherzinger, D., Avalos, J., en Al-Babili, S., 2007. Retinale biosynthese in schimmels: karakterisering van de carotenoïde oxygenase CarX van Fusarium fujikuroi. Eukar-yotische cel, 6 (4): 650–657.

Rodriguez-Saiz, M., de la Fuente, J.L., en Barredo, J.L., 2010. Xanthophyllomyces dendrorhou. voor de industriële productie van astaxanthine. Toegepaste Microbiologie & Biotechnologie, 88: 645–658.

Saha, C., en Seal, A., 2015. Vroege veranderingen in de opname van rijst als reactie op Rhodotorula mucilaginos. JGTA-S1. Genomics-gegevens, 6: 237–240.

Salvadori, M.R., Ando, ​​R.A., Oiler do Nascimento, C.A., en Correa, B., 2014. Intracellulaire biosynthese en verwijdering van kopernanodeeltjes door dode biomassa van gist geïsoleerd uit het afvalwater van een mijn in het Braziliaanse Amazonegebied. Plos One, 9(1):e87968.

Sanz, C., Velayos, A., Alvarez, M.I., Benito, E.R., en Eslava, A.P., 2011. Functionele analyse van de Phycomyces autoR. gen dat codeert voor de enzymen fytoeensynthase en lycopeencyclase. PloS One, 6. (8): e23102.

Singh, P., Tsuji, M., Singh, S.M., Roy, U., en Hoshino, T., 2013. Taxonomische karakterisering, aanpassingsstrategieën en biotechnologisch potentieel van cryofiele gisten uit ijskernen van de Midre Lovenbreen-gletsjer, Svalbard, Arctic. Cryobiologie, 66. (2): 167–175.

Tamura, K., Nei, M., en Kumar, S., 2004. Vooruitzichten voor het afleiden van zeer grote fylogenieën met behulp van de buurman-joining-methode. Proceedings van de National Academy of Sciences van de Verenigde Staten van Amerika, 101. (30): 11030–11035.

Wirth, F., en Goldani, L.Z., 2012. Epidemiologie van Rhodotorula. Een opkomende ziekteverwekker. Interdisciplinaire perspectieven op infectieziekten, 7.p, DOI: 10.1155/2012/465717.

Wozniak, A., Lozano, C., Barahona, S., Niklitschek, M., Marcoleta, A., Alcaino, J., Sepulveda, D., Baeza, M., en Cifuentes, V, 2011. Differentiële productie van carotenoïden en genexpressie in Xanthophyllomyces dendrorhou. gekweekt in een niet-vergistbare koolstofbron. Onderzoek naar varensgist, 11. (3): 252–262.

Zhang, H., Ge, L., Chen, K., Zhao, L.N., en Zhang, X.Y., 2014. Verbeterde biologische bestrijdingsactiviteit van Rhodotorula mucilaginosa, gekweekt in media die chitosan bevatten tegen ziekten na de oogst bij aardbeien: mogelijke onderliggende mechanismen van het effect. Journal of Agricultural and Food Chemistry, 62. (18): 4214–4224.


Materialen en methodes

Klonen en plaatsgerichte mutagenese van crtI en crtYB

De cDNA's die overeenkomen met crtI (GenBank-toetredingsnummer AY177424.1) en crtYB (GenBank-toetredingsnummer AY177204.1) werden geïsoleerd uit X. dendrorhous door RT-PCR, en gekloond in de pMD18-T-vector om de constructen pMD18-T- te verkrijgencrtI en pMD18-T-crtYBrespectievelijk voor DNA-sequencing. Om de nucleotide-sites te bepalen waarvan de gebruiksfrequentie < 15% is in S. cerevisiae, de cDNA-sequenties van volledige lengte van crtI en crtYB werden geanalyseerd met behulp van een grafische codongebruikanalysator (GCUA Fuhrmann et al., 2004) met de codongebruikstabel van S. cerevisiae. Vervolgens vijf nucleotiden van crtI en acht nucleotiden van crtYB werden geïdentificeerd als slechte sites (gebruiksfrequentie van < 15%) met betrekking tot de vertaalefficiëntie in S. cerevisiae. Op basis van deze resultaten zijn de slechte codonplaatsen van crtI en crtYB werden onderworpen aan mutatie om hun codongebruiksfrequentie te verbeteren. Alle plaatsgerichte mutageneseprocessen werden bereikt door overlappende extensie-PCR met primers 5-30, met behulp van het plasmide pMD18-T-crtI of pMD18-T-crtYB als de sjabloon ( Kanoksilapatham et al., 2007). de gemuteerde crtI en crtYB werden aangeduid als McrtI en McrtYB, respectievelijk. Alle primers die in deze studie voor de PCR zijn gebruikt, staan ​​vermeld in tabel 1.

Primers die in dit onderzoek zijn gebruikt

Primer nr. Beschrijving Volgorde (5′ tot 3′)
1 crtI-F GGCGGATCCATGGGAAAAGAACAAGATCAG
2 crtI-R AAAGCGGCCGCTCAGAAAGCAAGAACACCA
3 crtYB-F GCGGGATCCATGACGGCTCTCGCATATTAC
4 crtYB-R AAAGCGGCCGCTTACTGCCCTTCCCATCCG
5 crtI-116-F CAACCGACATGGCGTTGCTCAAGAGAGAAGTCGAGCG
6 crtI-116-R CGCTCGACTTCTCTCTTGAGCAACGCCATGTCGGTTG
7 crtI-129-F GGCAAAGATGGATTTGATAGATTCTTGTCGTTTATCCAAGAAGCCCAC
8 crtI-129-R GTGGGCTTCTTGGATAAAACGACAAGAATCTATCAAATCCATCTTTGCC
9 crtI-161-F CCCTGGCTTCGCAGCATTCTTAAGACTACAGTTCATTGGCC
10 crtI-161-R GGCCAATGAACTGTAGTCTTAAGAATGCTGCGAAGCCAGGG
11 crtI-244-F CCTAATACTCTTCTTCAGATCGTCAAGAGAAACAATCCCTCAGCC
12 crtI-244-R GGCTGAGGGATTGTTTCTCTTGACGATCTGAAGAAGAGTATTAGG
13 crtI-420-F GCTTGTTGCTAGAGCAAGGAAGTTTGTGATCCACACGCTTTCC
14 crtI-420-R GGAAAGCGTGTGGATCACAAACTTCCTTGCTCTAGCAACAAGC
15 crtYB-155-F CTACTTCTACATGAGAGCACTCTCCTTACTCATCACCCCACC
16 crtYB-155-R GGTTGGGGTGATGAGTAAGGAGAGTGCTCTCATGTAGAAGTAG
17 crtYB-310-F GTTGGAGGAAAAGAGCAGAAGCTTTTTTGTTGCCTCGGCTGG
18 crtYB-310-R CCAGCCGAGGCAACAAAAAAGCTTCTGCTCTTTTCCTCCAAC
19 crtYB-335-F GGCTGGTTGGACTATACGCATTCTGCAGAGTGACTGATGATC
20 crtYB-335-R GATCATCAGTCACTCTGCAGAATGCGTATAGTCCAACCAGCC
21 crtYB-462-F CGACAGAGGCAGTCCAGGCTAGAAAGACGCCTATCG
22 crtYB-462-R CGATAGGCGTCTTTCTAGCCTGGACTGCCTCTGTCG
23 crtYB-548-F CTCTCATTCTTTTGGTCTTAGAGATGAATCAAAGCTTGCGATCCCG
24 crtYB-548-R CGGGATCGCAAGCTTTGATTCATCTCTAAGACCAAAGAATGAGAG
25 crtYB-563-F CCCGACTGATTGGAGGAACCTAGACCTCAAGATTTCGAC
26 crtYB-563-R GTCGAAATCTTGAGGTCTAGGTTCCGTCCAATCAGTCGGG
27 crtYB-589-F CGCCTCAGAAAGCTTCAGATTCGAATGGAAGACGTACTCGC
28 crtYB-589-R GCGAGTACGTCTTCCATTCGAATCTGAAGCTTTCTGAGGCG
29 crtYB-660-F GGATGGAGGAGAGTAAGAAAAGTCTTGAGTGTGGTCATGAGCG
30 crtYB-660-R CGCTCATGACCACACTCAAGACTTTTCTTACTCTCCTCCATCC
31 TDH3p-F GCGCTCGAGACTAGTCAGTTCGAGTTTATCA
32 TDH3p-R GCCGGATCCTTTGTTTGTTTATGTG
33 CYC1t-F TTTGCGGCCGCATCCGCTCTAACCGAAA
34 CYC1t-R GCCGGATCCTTTGTTTGTTTATGTG
35 Pr-crtI-Tr-F GCGCTCGAGACTAGTCAGTTCGAGTTTATCA
36 Pr-crtI-Tr-R GCCGGATCCTTTGTTTGTTTATGTG
37 Pr-crtYB-Tr-F GCGCTCGAGACTAGTCAGTTCGAGTTTATCA
38 Pr-crtYB-Tr-R GCCGGATCCTTTGTTTGTTTATGTG
39 tHMG1-F CACATAAACAAACAAAATGGACCAATTGGTGAAAACTGAAG
40 tHMG1-R GGCGGATCCTTAGGATTTAATGCAGGTGACG
41 mva-F CACATAAACAAACAAAAATGCAAAGTTTAGATAAGAATTTCCG
42 mva-R GGCGGATCCTTATTGTTGGCTTCTTAAATCTTG
43 Pr-tHMG1-F GCGACTAGTCAGTTCGAGTTTTATCA
44 Pr-tHMG1-R GGCGGATCCTTAGGATTTAATGCAGGTGACG
45 Pr-mva-F GCGACTAGTCAGTTCGAGTTTATCA
46 Pr-mva-R GGCGGATCCTTATTGTTGGCTTCTTAAATCTTG
Primer nr. Beschrijving Volgorde (5′ tot 3′)
1 crtI-F GGCGGATCCATGGGAAAAGAACAAGATCAG
2 crtI-R AAAGCGGCCGCTCAGAAAGCAAGAACACCA
3 crtYB-F GCGGGATCCATGACGGCTCTCGCATATTAC
4 crtYB-R AAAGCGGCCGCTTACTGCCCTTCCCATCCG
5 crtI-116-F CAACCGACATGGCGTTGCTCAAGAGAGAAGTCGAGCG
6 crtI-116-R CGCTCGACTTCTCTCTTGAGCAACGCCATGTCGGTTG
7 crtI-129-F GGCAAAGATGGATTTGATAGATTCTTGTCGTTTATCCAAGAAGCCCAC
8 crtI-129-R GTGGGCTTCTTGGATAAAACGACAAGAATCTATCAAATCCATCTTTGCC
9 crtI-161-F CCCTGGCTTCGCAGCATTCTTAAGACTACAGTTCATTGGCC
10 crtI-161-R GGCCAATGAACTGTAGTCTTAAGAATGCTGCGAAGCCAGGG
11 crtI-244-F CCTAATACTCTTCTTCAGATCGTCAAGAGAAACAATCCCTCAGCC
12 crtI-244-R GGCTGAGGGATTGTTTCTCTTGACGATCTGAAGAAGAGTATTAGG
13 crtI-420-F GCTTGTTGCTAGAGCAAGGAAGTTTGTGATCCACACGCTTTCC
14 crtI-420-R GGAAAGCGTGTGGATCACAAACTTCCTTGCTCTAGCAACAAGC
15 crtYB-155-F CTACTTCTACATGAGAGCACTCTCCTTACTCATCACCCCACC
16 crtYB-155-R GGTTGGGGTGATGAGTAAGGAGAGTGCTCTCATGTAGAAGTAG
17 crtYB-310-F GTTGGAGGAAAAGAGCAGAAGCTTTTTTGTTGCCTCGGCTGG
18 crtYB-310-R CCAGCCGAGGCAACAAAAAAGCTTCTGCTCTTTTCCTCCAAC
19 crtYB-335-F GGCTGGTTGGACTATACGCATTCTGCAGAGTGACTGATGATC
20 crtYB-335-R GATCATCAGTCACTCTGCAGAATGCGTATAGTCCAACCAGCC
21 crtYB-462-F CGACAGAGGCAGTCCAGGCTAGAAAGACGCCTATCG
22 crtYB-462-R CGATAGGCGTCTTTCTAGCCTGGACTGCCTCTGTCG
23 crtYB-548-F CTCTCATTCTTTTGGTCTTAGAGATGAATCAAAGCTTGCGATCCCG
24 crtYB-548-R CGGGATCGCAAGCTTTGATTCATCTCTAAGACCAAAGAATGAGAG
25 crtYB-563-F CCCGACTGATTGGAGGAACCTAGACCTCAAGATTTCGAC
26 crtYB-563-R GTCGAAATCTTGAGGTCTAGGTTCCGTCCAATCAGTCGGG
27 crtYB-589-F CGCCTCAGAAAGCTTCAGATTCGAATGGAAGACGTACTCGC
28 crtYB-589-R GCGAGTACGTCTTCCATTCGAATCTGAAGCTTTCTGAGGCG
29 crtYB-660-F GGATGGAGGAGAGTAAGAAAAGTCTTGAGTGTGGTCATGAGCG
30 crtYB-660-R CGCTCATGACCACACTCAAGACTTTTCTTACTCTCCTCCATCC
31 TDH3p-F GCGCTCGAGACTAGTCAGTTCGAGTTTATCA
32 TDH3p-R GCCGGATCCTTTGTTTGTTTATGTG
33 CYC1t-F TTTGCGGCCGCATCCGCTCTAACCGAAA
34 CYC1t-R GCCGGATCCTTTGTTTGTTTATGTG
35 Pr-crtI-Tr-F GCGCTCGAGACTAGTCAGTTCGAGTTTATCA
36 Pr-crtI-Tr-R GCCGGATCCTTTGTTTGTTTATGTG
37 Pr-crtYB-Tr-F GCGCTCGAGACTAGTCAGTTCGAGTTTATCA
38 Pr-crtYB-Tr-R GCCGGATCCTTTGTTTGTTTATGTG
39 tHMG1-F CACATAAACAAACAAAATGGACCAATTGGTGAAAACTGAAG
40 tHMG1-R GGCGGATCCTTAGGATTTAATGCAGGTGACG
41 mva-F CACATAAACAAACAAAAATGCAAAGTTTAGATAAGAATTTCCG
42 mva-R GGCGGATCCTTATTGTTGGCTTCTTAAATCTTG
43 Pr-tHMG1-F GCGACTAGTCAGTTCGAGTTTTATCA
44 Pr-tHMG1-R GGCGGATCCTTAGGATTTAATGCAGGTGACG
45 Pr-mva-F GCGACTAGTCAGTTCGAGTTTTATCA
46 Pr-mva-R GGCGGATCCTTATTGTTGGCTTCTTAAATCTTG

Primers die in dit onderzoek zijn gebruikt

Primer nr. Beschrijving Volgorde (5′ tot 3′)
1 crtI-F GGCGGATCCATGGGAAAAGAACAAGATCAG
2 crtI-R AAAGCGGCCGCTCAGAAAGCAAGAACACCA
3 crtYB-F GCGGGATCCATGACGGCTCTCGCATATTAC
4 crtYB-R AAAGCGGCCGCTTACTGCCCTTCCCATCCG
5 crtI-116-F CAACCGACATGGCGTTGCTCAAGAGAGAAGTCGAGCG
6 crtI-116-R CGCTCGACTTCTCTCTTGAGCAACGCCATGTCGGTTG
7 crtI-129-F GGCAAAGATGGATTTGATAGATTCTTGTCGTTTATCCAAGAAGCCCAC
8 crtI-129-R GTGGGCTTCTTGGATAAAACGACAAGAATCTATCAAATCCATCTTTGCC
9 crtI-161-F CCCTGGCTTCGCAGCATTCTTAAGACTACAGTTCATTGGCC
10 crtI-161-R GGCCAATGAACTGTAGTCTTAAGAATGCTGCGAAGCCAGGG
11 crtI-244-F CCTAATACTCTTCTTCAGATCGTCAAGAGAAACAATCCCTCAGCC
12 crtI-244-R GGCTGAGGGATTGTTTCTCTTGACGATCTGAAGAAGAGTATTAGG
13 crtI-420-F GCTTGTTGCTAGAGCAAGGAAGTTTGTGATCCACACGCTTTCC
14 crtI-420-R GGAAAGCGTGTGGATCACAAACTTCCTTGCTCTAGCAACAAGC
15 crtYB-155-F CTACTTCTACATGAGAGCACTCTCCTTACTCATCACCCCACC
16 crtYB-155-R GGTTGGGGTGATGAGTAAGGAGAGTGCTCTCATGTAGAAGTAG
17 crtYB-310-F GTTGGAGGAAAAGAGCAGAAGCTTTTTTGTTGCCTCGGCTGG
18 crtYB-310-R CCAGCCGAGGCAACAAAAAAGCTTCTGCTCTTTTCCTCCAAC
19 crtYB-335-F GGCTGGTTGGACTATACGCATTCTGCAGAGTGACTGATGATC
20 crtYB-335-R GATCATCAGTCACTCTGCAGAATGCGTATAGTCCAACCAGCC
21 crtYB-462-F CGACAGAGGCAGTCCAGGCTAGAAAGACGCCTATCG
22 crtYB-462-R CGATAGGCGTCTTTCTAGCCTGGACTGCCTCTGTCG
23 crtYB-548-F CTCTCATTCTTTTGGTCTTAGAGATGAATCAAAGCTTGCGATCCCG
24 crtYB-548-R CGGGATCGCAAGCTTTGATTCATCTCTAAGACCAAAGAATGAGAG
25 crtYB-563-F CCCGACTGATTGGAGGAACCTAGACCTCAAGATTTCGAC
26 crtYB-563-R GTCGAAATCTTGAGGTCTAGGTTCCGTCCAATCAGTCGGG
27 crtYB-589-F CGCCTCAGAAAGCTTCAGATTCGAATGGAAGACGTACTCGC
28 crtYB-589-R GCGAGTACGTCTTCCATTCGAATCTGAAGCTTTCTGAGGCG
29 crtYB-660-F GGATGGAGGAGAGTAAGAAAAGTCTTGAGTGTGGTCATGAGCG
30 crtYB-660-R CGCTCATGACCACACTCAAGACTTTTCTTACTCTCCTCCATCC
31 TDH3p-F GCGCTCGAGACTAGTCAGTTCGAGTTTATCA
32 TDH3p-R GCCGGATCCTTTGTTTGTTTATGTG
33 CYC1t-F TTTGCGGCCGCATCCGCTCTAACCGAAA
34 CYC1t-R GCCGGATCCTTTGTTTGTTTATGTG
35 Pr-crtI-Tr-F GCGCTCGAGACTAGTCAGTTCGAGTTTATCA
36 Pr-crtI-Tr-R GCCGGATCCTTTGTTTGTTTATGTG
37 Pr-crtYB-Tr-F GCGCTCGAGACTAGTCAGTTCGAGTTTATCA
38 Pr-crtYB-Tr-R GCCGGATCCTTTGTTTGTTTATGTG
39 tHMG1-F CACATAAACAAACAAAATGGACCAATTGGTGAAAACTGAAG
40 tHMG1-R GGCGGATCCTTAGGATTTAATGCAGGTGACG
41 mva-F CACATAAACAAACAAAAATGCAAAGTTTAGATAAGAATTTCCG
42 mva-R GGCGGATCCTTATTGTTGGCTTCTTAAATCTTG
43 Pr-tHMG1-F GCGACTAGTCAGTTCGAGTTTTATCA
44 Pr-tHMG1-R GGCGGATCCTTAGGATTTAATGCAGGTGACG
45 Pr-mva-F GCGACTAGTCAGTTCGAGTTTTATCA
46 Pr-mva-R GGCGGATCCTTATTGTTGGCTTCTTAAATCTTG
Primer nr. Beschrijving Volgorde (5′ tot 3′)
1 crtI-F GGCGGATCCATGGGAAAAGAACAAGATCAG
2 crtI-R AAAGCGGCCGCTCAGAAAGCAAGAACACCA
3 crtYB-F GCGGGATCCATGACGGCTCTCGCATATTAC
4 crtYB-R AAAGCGGCCGCTTACTGCCCTTCCCATCCG
5 crtI-116-F CAACCGACATGGCGTTGCTCAAGAGAGAAGTCGAGCG
6 crtI-116-R CGCTCGACTTCTCTCTTGAGCAACGCCATGTCGGTTG
7 crtI-129-F GGCAAAGATGGATTTGATAGATTCTTGTCGTTTATCCAAGAAGCCCAC
8 crtI-129-R GTGGGCTTCTTGGATAAAACGACAAGAATCTATCAAATCCATCTTTGCC
9 crtI-161-F CCCTGGCTTCGCAGCATTCTTAAGACTACAGTTCATTGGCC
10 crtI-161-R GGCCAATGAACTGTAGTCTTAAGAATGCTGCGAAGCCAGGG
11 crtI-244-F CCTAATACTCTTCTTCAGATCGTCAAGAGAAACAATCCCTCAGCC
12 crtI-244-R GGCTGAGGGATTGTTTCTCTTGACGATCTGAAGAAGAGTATTAGG
13 crtI-420-F GCTTGTTGCTAGAGCAAGGAAGTTTGTGATCCACACGCTTTCC
14 crtI-420-R GGAAAGCGTGTGGATCACAAACTTCCTTGCTCTAGCAACAAGC
15 crtYB-155-F CTACTTCTACATGAGAGCACTCTCCTTACTCATCACCCCACC
16 crtYB-155-R GGTTGGGGTGATGAGTAAGGAGAGTGCTCTCATGTAGAAGTAG
17 crtYB-310-F GTTGGAGGAAAAGAGCAGAAGCTTTTTTGTTGCCTCGGCTGG
18 crtYB-310-R CCAGCCGAGGCAACAAAAAAGCTTCTGCTCTTTTCCTCCAAC
19 crtYB-335-F GGCTGGTTGGACTATACGCATTCTGCAGAGTGACTGATGATC
20 crtYB-335-R GATCATCAGTCACTCTGCAGAATGCGTATAGTCCAACCAGCC
21 crtYB-462-F CGACAGAGGCAGTCCAGGCTAGAAAGACGCCTATCG
22 crtYB-462-R CGATAGGCGTCTTTCTAGCCTGGACTGCCTCTGTCG
23 crtYB-548-F CTCTCATTCTTTTGGTCTTAGAGATGAATCAAAGCTTGCGATCCCG
24 crtYB-548-R CGGGATCGCAAGCTTTGATTCATCTCTAAGACCAAAGAATGAGAG
25 crtYB-563-F CCCGACTGATTGGAGGAACCTAGACCTCAAGATTTCGAC
26 crtYB-563-R GTCGAAATCTTGAGGTCTAGGTTCCGTCCAATCAGTCGGG
27 crtYB-589-F CGCCTCAGAAAGCTTCAGATTCGAATGGAAGACGTACTCGC
28 crtYB-589-R GCGAGTACGTCTTCCATTCGAATCTGAAGCTTTCTGAGGCG
29 crtYB-660-F GGATGGAGGAGAGTAAGAAAAGTCTTGAGTGTGGTCATGAGCG
30 crtYB-660-R CGCTCATGACCACACTCAAGACTTTTCTTACTCTCCTCCATCC
31 TDH3p-F GCGCTCGAGACTAGTCAGTTCGAGTTTATCA
32 TDH3p-R GCCGGATCCTTTGTTTGTTTATGTG
33 CYC1t-F TTTGCGGCCGCATCCGCTCTAACCGAAA
34 CYC1t-R GCCGGATCCTTTGTTTGTTTATGTG
35 Pr-crtI-Tr-F GCGCTCGAGACTAGTCAGTTCGAGTTTATCA
36 Pr-crtI-Tr-R GCCGGATCCTTTGTTTGTTTATGTG
37 Pr-crtYB-Tr-F GCGCTCGAGACTAGTCAGTTCGAGTTTATCA
38 Pr-crtYB-Tr-R GCCGGATCCTTTGTTTGTTTATGTG
39 tHMG1-F CACATAAACAAACAAAATGGACCAATTGGTGAAAACTGAAG
40 tHMG1-R GGCGGATCCTTAGGATTTAATGCAGGTGACG
41 mva-F CACATAAACAAACAAAAATGCAAAGTTTAGATAAGAATTTCCG
42 mva-R GGCGGATCCTTATTGTTGGCTTCTTAAATCTTG
43 Pr-tHMG1-F GCGACTAGTCAGTTCGAGTTTTATCA
44 Pr-tHMG1-R GGCGGATCCTTAGGATTTAATGCAGGTGACG
45 Pr-mva-F GCGACTAGTCAGTTCGAGTTTTATCA
46 Pr-mva-R GGCGGATCCTTATTGTTGGCTTCTTAAATCTTG

Plasmide constructies

Een DNA-cassette voor gistexpressie werd bereid in de vector PUC19 om het construct pLQ01 te verkrijgen (Fig. 1). Het plasmide pLQ01 omvatte 680-bp TDH3 genpromotor en 250-bp CYC1 genterminatorsequenties, die werden geamplificeerd uit het genomische DNA van S. cerevisiae met behulp van primers 31-34. De open leeskaders (ORF's) van crtI, crtYB, McrtI en McrtYB waren gekoppeld aan de TDH3 promotor en CYC1 terminator door de ORF's in het plasmide pLQ01 op de BamHI/NotI-plaats in te voegen. De expressiecassette ‘TDH3 promotor-gen-CYC1 terminator' werd vervolgens geamplificeerd met behulp van primers 35-38. De DNA-cassettes ‘TDH3 promotor-crtI-CYC1 terminator' en 'TDH3 promotor-McrtI-CYC1 terminator' werden gedigereerd met Spel- en SalI-restrictie-enzymen en geïntroduceerd in een integratieve gistexpressievector pRS406 op Spel/SalI-plaatsen, resulterend in de constructies pRS406-crtI en pRS406-McrtI, respectievelijk. Het SalI/XhoI-fragment van ‘TDH3 promotor-crtYB-CYC1 terminator' werd vervolgens geligeerd in pRS406-crtI op de SalI/XhoI-plaats om het construct pRS406W te verkrijgen (Fig. 1). Dezelfde benadering werd toegepast om pRS406M te construeren door het SalI/XhoI-fragment van 'TDH3 promotor-McrtYB-CYC1 terminator' en introduceren in pRS406-McrtI.

Structuur van de vectoren. (a) pLQ01 met a TDH3 promotor en a CYC1 terminator. (b) pRS406. (c) pRS406W die de wild-type genen draagt ​​die verantwoordelijk zijn voor de expressie van carotenoïden. (d) pRS406M die de geoptimaliseerde carotenoïden-expressiegenen draagt. (e) pESC-TDH3-tHMG1 met het katalytische domein van tHMG1 gen in Saccharomyces cerevisiae. (f) pESC-TDH3-tHMG1 de vasthouden mva gen afgeleid van Staphylococcus aureus.

Structuur van de vectoren. (a) pLQ01 met a TDH3 promotor en a CYC1 terminator. (b) pRS406. (c) pRS406W die de wild-type genen draagt ​​die verantwoordelijk zijn voor de expressie van carotenoïden. (d) pRS406M die de geoptimaliseerde carotenoïden-expressiegenen draagt. (e) pESC-TDH3-tHMG1 met het katalytische domein van tHMG1 gen in Saccharomyces cerevisiae. (f) pESC-TDH3-tHMG1 de vasthouden mva gen afgeleid van Staphylococcus aureus.

De ORF van tHMG1 cDNA (NCBI-referentiesequentie NM_001182434.1) werd geïsoleerd door RT-PCR met primers 39-40 van S. cerevisiae WAT11-stam en het cDNA dat overeenkomt met mva (NCBI-referentiesequentie NC_017342.1) werd geamplificeerd met behulp van primers 41-42 van het genomische DNA van S. aureus (ATCC25923). De S. aureus stam werd vriendelijk ter beschikking gesteld door Dr. Qiang Gao (Biological Control of Arborvirus Vectors, Wuhan Institute of Virology, Chinese Academy of Sciences). Door overlappende extensie-PCR met primers 43-44, werd de ORF van tHMG1 was gekoppeld aan de TDH3 promotor om het fragment te verkrijgen 'TDH3-tHMG1’. Het DNA-fragment ‘TDH3-tHMG1' werd vervolgens gedigereerd en geligeerd in een gistexpressievector pESC-HIS (Stratagene) op de Spel/BamHI-plaats om het construct pESC-HIS- te verkrijgen.TDH3-tHMG1. Evenzo is de ORF van mva werd gekloond bij de TDH3 promotor door overlappende PCR met behulp van primers 45-46, en vervolgens geligeerd in pESC-HIS op de EcoRI/BamHI-plaats om de pESC-HIS-TDH3-mva vector. In de constructies pESC-HIS-TDH3-tHMG1 en pESC-HIS-TDH3-mva, de endogene galactose-inducerende promotors (Gal1 en Gal10) in pESC-HIS werden verwijderd (Fig. 1).

Constructie en teelt van giststam

De integratievectoren pRS406, pRS406W en pRS406M werden gelineariseerd met StuI en geïntegreerd in de ura3-52 plaats van S. cerevisiae WAT11-stam om de giststammen WAT11/pRS406, WAT11/pRS406W en WAT11/pRS406M te maken met behulp van de PEG/LiAc-methode (Gietz & Woods, 2002). De episomale vector pESC-HIS-TDH3-tHMG1 werd getransformeerd in de giststam WAT11/pRS406M om WAT11/pRS406M-tHMG1. Evenzo is de stam WAT11/pRS406M-mva werd bereid door het construct pESC-HIS- te transformerenTDH3-mva in de giststam WAT11/pRS406M. Als controle werd de lege vector pESC-HIS overgebracht naar de giststam WAT11/pRS406M om WAT11/pRS406M-HIS te construeren. Gedetailleerde informatie over de geconstrueerde giststammen wordt weergegeven in tabel 2.

Stammen en plasmiden die in dit onderzoek zijn gebruikt

Stam of plasmide Relevante functies
Giststammen WAT11 MATα (leu2-3.112 trp1-1 can1-100 ura3-1 ade2-1 his3-11,15)
Integratieve vector transformanten
WAT11/pRS406 WAT11+ pRS406
WAT11/pRS406W WAT11+ pRS406W
WAT11/pRS406M WAT11+ pRS406M
Episomale vectortransformanten
WAT11/pESC-HIS WAT11+ pRS406M + pESC-HIS
WAT11/pRS406M-tHMG1 WAT11+ pRS406M + pESC-TDH3-tHMG1
WAT11/pRS406M-mva WAT11+ pRS406M + pESC-TDH3-mva
Plasmiden
pRS406W pRS406 TDH3-WCrtYB-CYC1, TDH3-WCrtI-CYC1
pRS406M pRS406 TDH3-MCrtYB-CYC1, TDH3-MCrtI-CYC1
pESC-TDH3-tHMG1 pESC-TDH3-tHMG1-CYC1
pESC-TDH3-mva pESC-TDH3-mva-CYC1
Stam of plasmide Relevante functies
Giststammen WAT11 MATα (leu2-3.112 trp1-1 can1-100 ura3-1 ade2-1 his3-11,15)
Integratieve vectortransformanten
WAT11/pRS406 WAT11+ pRS406
WAT11/pRS406W WAT11+ pRS406W
WAT11/pRS406M WAT11+ pRS406M
Episomale vectortransformanten
WAT11/pESC-HIS WAT11+ pRS406M + pESC-HIS
WAT11/pRS406M-tHMG1 WAT11+ pRS406M + pESC-TDH3-tHMG1
WAT11/pRS406M-mva WAT11+ pRS406M + pESC-TDH3-mva
Plasmiden
pRS406W pRS406 TDH3-WCrtYB-CYC1, TDH3-WCrtI-CYC1
pRS406M pRS406 TDH3-MCrtYB-CYC1, TDH3-MCrtI-CYC1
pESC-TDH3-tHMG1 pESC-TDH3-tHMG1-CYC1
pESC-TDH3-mva pESC-TDH3-mva-CYC1

Stammen en plasmiden die in dit onderzoek zijn gebruikt

Stam of plasmide Relevante functies
giststammen WAT11 MATα (leu2-3.112 trp1-1 can1-100 ura3-1 ade2-1 his3-11,15)
Integratieve vectortransformanten
WAT11/pRS406 WAT11+ pRS406
WAT11/pRS406W WAT11+ pRS406W
WAT11/pRS406M WAT11+ pRS406M
Episomale vectortransformanten
WAT11/pESC-HIS WAT11+ pRS406M + pESC-HIS
WAT11/pRS406M-tHMG1 WAT11+ pRS406M + pESC-TDH3-tHMG1
WAT11/pRS406M-mva WAT11+ pRS406M + pESC-TDH3-mva
Plasmiden
pRS406W pRS406 TDH3-WCrtYB-CYC1, TDH3-WCrtI-CYC1
pRS406M pRS406 TDH3-MCrtYB-CYC1, TDH3-MCrtI-CYC1
pESC-TDH3-tHMG1 pESC-TDH3-tHMG1-CYC1
pESC-TDH3-mva pESC-TDH3-mva-CYC1
Stam of plasmide Relevante functies
giststammen WAT11 MATα (leu2-3.112 trp1-1 can1-100 ura3-1 ade2-1 his3-11,15)
Integratieve vector transformanten
WAT11/pRS406 WAT11+ pRS406
WAT11/pRS406W WAT11+ pRS406W
WAT11/pRS406M WAT11+ pRS406M
Episomale vectortransformanten
WAT11/pESC-HIS WAT11+ pRS406M + pESC-HIS
WAT11/pRS406M-tHMG1 WAT11+ pRS406M + pESC-TDH3-tHMG1
WAT11/pRS406M-mva WAT11+ pRS406M + pESC-TDH3-mva
Plasmiden
pRS406W pRS406 TDH3-WCrtYB-CYC1, TDH3-WCrtI-CYC1
pRS406M pRS406 TDH3-MCrtYB-CYC1, TDH3-MCrtI-CYC1
pESC-TDH3-tHMG1 pESC-TDH3-tHMG1-CYC1
pESC-TDH3-mva pESC-TDH3-mva-CYC1

De giststammen werden gekweekt bij 250 rpm en 30°C in een geschikt vloeibaar gistmedium. De stammen WAT11/pRS406, WAT11/pRS406W en WAT11/pRS406M werden gekweekt in SD-URA-medium (aminozuuruitvalmedium) en de stammen WAT11/pRS406M-tHMG1, WAT11/pRS406M-mvaen WAT11/pRS406M-HIS werden gekweekt in SD-HIS-URA-medium (aminozuuruitvalmedium). Om de gistgroei te volgen, werd een enkele kloon van elk van de giststammen aanvankelijk gekweekt in 5 ml gistmedium bij 30 ° C onder constant schudden tot een optische dichtheid (gemeten bij 600 nm OD600) van 0,6. De gistculturen werden vervolgens geënt in vers SD-medium in een verhouding van 1: 40. Vervolgens werd 200 μL van de monsters verzameld bij 0, 6, 12, 24, 30, 36, 48, 60, 72, 96 en 120 h om OD te meten600.

Extractie en kwantificering van bètacaroteen

De gistcellen die 72 uur bij 30 ° C in 50 ml gistmedium waren gekweekt, werden gepelleteerd door centrifugatie bij 3500 G gedurende 5 minuten, tweemaal gewassen met 0,9% (w/v) NaCl en gevriesdroogd (Lange & Steinbuchel, 2011). Ongeveer 100 mg van de gevriesdroogde cellen werd gesuspendeerd in 2 ml aceton/0,2% pyrogallol in methanol (w/v 80:20, v/v), en 1 g glasparels (diameter, 425-600 m) werd toegevoegd. Het mengsel werd 3 minuten geschud in een weefselmolen met hoge doorvoer en de aceton-methanolfractie werd verzameld door centrifugatie bij 6000 G gedurende 5 minuten. De extractie werd vier tot vijf keer herhaald. De organische extracties werden samengevoegd, drooggedampt en opnieuw opgelost in 1 ml aceton voor HPLC-analyse. Om foto-oxidatie te voorkomen, werden alle extractieprocedures in het donker uitgevoerd.

De HPLC-analyse werd uitgevoerd op een LC-20AT-instrument uitgerust met een binaire pomp, een autosampler en een fotodiodearraydetector (Shimadzu, Kyoto, Japan). Een Agilent HC-C18 (2) omgekeerde-fasekolom (4,6 x 250 mm, 5 m) werd gebruikt met acetonitril/methanol (50:50 v/v) als de mobiele fase bij een stroomsnelheid van 1 ml min-1. De kolomtemperatuur was ingesteld op 25°C en de detectiegolflengte was 450 nm. Beta-caroteen gegenereerd uit de gistculturen werd gekwantificeerd op basis van een standaard kalibratiecurve gemaakt met authentiek beta-caroteen (Sigma Aldrich GmbH, China) van verschillende concentraties.


Carotenoïde biosynthese in gist - Biologie

Alle door MDPI gepubliceerde artikelen worden direct wereldwijd beschikbaar gesteld onder een open access licentie. Er is geen speciale toestemming nodig om het door MDPI gepubliceerde artikel geheel of gedeeltelijk te hergebruiken, inclusief figuren en tabellen. Voor artikelen die zijn gepubliceerd onder een open access Creative Common CC BY-licentie, mag elk deel van het artikel zonder toestemming worden hergebruikt, op voorwaarde dat het originele artikel duidelijk wordt geciteerd.

Feature Papers vertegenwoordigen het meest geavanceerde onderzoek met een aanzienlijk potentieel voor grote impact in het veld. Feature Papers worden ingediend op individuele uitnodiging of aanbeveling door de wetenschappelijke redacteuren en ondergaan peer review voorafgaand aan publicatie.

De Feature Paper kan ofwel een origineel onderzoeksartikel zijn, een substantiële nieuwe onderzoeksstudie waarbij vaak verschillende technieken of benaderingen betrokken zijn, of een uitgebreid overzichtsdocument met beknopte en nauwkeurige updates over de laatste vooruitgang in het veld dat systematisch de meest opwindende vooruitgang in de wetenschappelijke literatuur. Dit type paper geeft een blik op toekomstige onderzoeksrichtingen of mogelijke toepassingen.

Editor's Choice-artikelen zijn gebaseerd op aanbevelingen van de wetenschappelijke redacteuren van MDPI-tijdschriften van over de hele wereld. Redacteuren selecteren een klein aantal artikelen die recentelijk in het tijdschrift zijn gepubliceerd en waarvan zij denken dat ze bijzonder interessant zijn voor auteurs, of belangrijk zijn op dit gebied. Het doel is om een ​​momentopname te geven van enkele van de meest opwindende werken die in de verschillende onderzoeksgebieden van het tijdschrift zijn gepubliceerd.


ORIGINEEL ONDERZOEK artikel

Jia Li 1† , Jia Shen 1† , Zhiqiang zo 1 , Jing Li 1 , Changfu Li 1 , Xiaohua Li 1,2 en Yansheng Zhang 1*
  • 1 CAS Key Laboratory of Plant Germplasm Enhancement and Specialty Agriculture, Wuhan Botanical Garden, Chinese Academy of Sciences, Wuhan, China
  • 2 Universiteit van de Chinese Academie van Wetenschappen, Peking, China

β-Caroteen is de voorloper van vitamine A en heeft op zichzelf ook meerdere farmaceutische functies. In vergelijking met chemische synthese is de productie van β-caroteen in microben door middel van een metabolische engineeringstrategie relatief goedkoop. Het identificeren van genen die de productie van β-caroteen in microben verbeteren, is belangrijk voor het construeren van een stam die hogere opbrengsten van β-caroteen produceert. De meeste eerdere inspanningen bij het identificeren van de gentargets waren gericht op de isoprenoïde route waar de biosynthese van β-caroteen thuishoort. Vanwege de complexe interacties tussen metabole fluxen, kunnen schijnbaar irrelevante genen die zich buiten de isoprenoïde route bevinden, echter ook de biosynthese van caroteen beïnvloeden. Hiertoe hebben we hier een voorbeeld gegeven dat verschillende nieuwe gendoelen, die zich buiten de isoprenoïde route bevinden, verbeterende effecten hebben op de synthese van caroteen in gistcellen, wanneer ze tot overexpressie werden gebracht. Van deze doelwitten leidde het klasse E-eiwit van de vacuolaire eiwit-sorteerroute (Did2) tot de hoogste verbetering van de &#-caroteenopbrengst, die 2,1-voudig was ten opzichte van die van de overeenkomstige controle. Deze verbetering werd verder verklaard door de observatie dat de overexpressie van de DID2 gen verhoogde in het algemeen de transcripties van genen van de caroteenroute. Het mechanisme waarmee de andere doelwitten de productie van β-caroteen verbeteren, wordt besproken.


Genetica en moleculaire biologie van de biosynthese van carotenoïdenpigment

Aan wie correspondentie en herdrukverzoeken moeten worden gericht, bij: Instituut voor Plantenwetenschappen, Plantgenetica, Zwitsers Federaal Instituut voor Technologie (ETH), CH-8092 Zürich, Zwitserland. Zoek naar meer artikelen van deze auteur

Afdeling Chemie, Universiteit van Californië, Afdeling Structurele Biologie, Lawrence Berkeley Laboratory, Berkeley, Californië, 94720 VS

Instituut voor Plantenwetenschappen, Plantengenetica, Zwitsers Federaal Instituut voor Technologie, CH-8092 Zürich, Zwitserland

Aan wie correspondentie en verzoeken om herdruk moeten worden gericht, bij: Instituut voor Plantenwetenschappen, Plantgenetica, Zwitsers Federaal Instituut voor Technologie (ETH), CH-8092 Zürich, Zwitserland. Zoek naar meer artikelen van deze auteur

Afdeling Chemie, Universiteit van Californië, Afdeling Structurele Biologie, Lawrence Berkeley Laboratory, Berkeley, Californië, 94720 VS

Abstract

De cruciale rol van carotenoïden en hun metabolieten in foto-oxidatieve bescherming en fotosynthese, om nog maar te zwijgen van voeding, zicht en celdifferentiatie, maken ze tot een belangrijke en complexe klasse van biologische pigmenten. Aanzienlijke vorderingen in de afgelopen jaren hebben ons begrip van de genetica en moleculaire biologie van de biosynthese van carotenoïden in bacteriën, schimmels, algen en planten vergroot. Alle genen die betrokken zijn bij de biosynthese van carotenoïden van Rhodobacter capsulatus, een anoxygene fotosynthetische bacterie, en van verschillende soorten Erwinia, niet-fotosynthetische bacteriën, zijn moleculair gekarakteriseerd. Recente studies hebben aangetoond dat twee vroege enzymen van de biosynthese van carotenoïden, geranylgeranylpyrofosfaatsynthase en fytoeensynthase, structureel en functioneel verwant zijn in alle carotenogene organismen. Daarentegen is de daaropvolgende omzetting van fytoeen, de eerste C40 carotenoïde, tot β-caroteen vereist twee desaturasen en één cyclase in zuurstofrijke fotosynthetische organismen (cyanobacteriën, algen en hogere planten), maar slechts één structureel verschillend desaturase en een structureel verschillend cyclase in andere carotenogene bacteriën en in schimmels. Studies naar de enzymen die zuurstofbevattende functionele groepen in carotenen introduceren om xanthofylen te produceren, de overgrote meerderheid van alle carotenoïden, staan ​​nog in de kinderschoenen. Dit overzicht vat de meest recente ontwikkelingen in de biosynthese van carotenoïden samen vanuit een moleculair genetisch standpunt.—Armstrong, G.A., Hearst, J.E. Genetics and moleculaire biologie van de biosynthese van carotenoïde pigmenten. FASEB J. 10, 228-237 (1996)


Wij danken leden van ons laboratorium en Drs. Foen Peng, Pam Diggle, Jeff Seemann en Qinlong Zhu voor discussies.

Alba, R., Payton, P., Fei, Z., McQuinn, R., Debbie, P., Martin, G.B., et al. (2005). Transcriptoom- en geselecteerde metabolietanalyses onthullen meerdere punten van ethyleencontrole tijdens de ontwikkeling van tomatenfruit. Plantaardige cel 17 (11), 2954�. doi: 10.1105/tpc.105.036053

Alder, A., Jamil, M., Marzorati, M., Bruno, M., Vermathen, M., Bigler, P., et al. (2012). Het pad van β-caroteen naar carlacton, een strigolacton-achtig plantenhormoon. Wetenschap 335 (6074), 1348. doi: 10.1126/science.1218094

Amiour, N., Imbaud, S., Clús, G., Agier, N., Zivy, M., Valot, B., et al. (2012). Het gebruik van metabolomics geïntegreerd met transcriptomische en proteomische studies voor het identificeren van belangrijke stappen die betrokken zijn bij de controle van het stikstofmetabolisme in gewassen zoals maïs. J. Exp. Bot. 63 (14), 5017�. doi: 10.1093/jxb/ers186

Ampomah-Dwamena, C., Thrimawithana, A.H., Dejnoprat, S., Lewis, D., Espley, R.V., Allan, A.C. (2019). Een kiwi (Actinidia deliciosa) R2R3-MYB-transcriptiefactor moduleert de accumulatie van chlorofyl en carotenoïden. Nieuwe fytol. 221 (1), 309�. doi: 10.1111/nph.15362

Andersson, A., Keskitalo, J., Sjøxfdin, A., Bhalerao, R., Sterky, F., Wissel, K., et al. (2004). Een transcriptioneel tijdschema van herfstveroudering. Genoom Biol. 5 (4), R24. doi: 10.1186/gb-2004-5-4-r24

Andrade, P., Caudepäxf3n, D., Altabella, T., Arróxf3, M., Ferrer, A., Manzano, D. (2017). Complexe wisselwerking tussen fytosterolen en de ontwikkeling van plastiden. Plant signaal gedrag. 12 (11), e1387708. doi: 10.1080/15592324.2017.1387708

Arango, J., WÃxfcst, F., Beyer, P., Welsch, R. (2010). Karakterisering van fytoeensynthasen uit cassave en hun betrokkenheid bij abiotische stress-gemedieerde reacties. Planta 232 (5), 1251�. doi: 10.1007/s00425-010-1250-6

Arango, J., Beltrón, J., Nuéxf1ez, J., Chavarriaga, P. (2016). �wijs van epigenetische mechanismen die carotenoïden beïnvloeden,” in Carotenoïden in de natuur (Cham, Zwitserland: Springer) 295�.

Audran, C., Borel, C., Frey, A., Sotta, B., Meyer, C., Simonneau, T., et al. (1998). Expressiestudies van het zeaxanthine-epoxidasegen in Nicotiana plumbaginifolia. J. Plantenfysiol. 118 (3), 1021�. doi: 10.1104/pp.118.3.1021

Audran, C., Liotenberg, S., Gonneau, M., North, H., Frey, A., Tap-Waksman, K., et al. (2001). Lokalisatie en expressie van zeaxanthine-epoxidase-mRNA in Arabidopsis als reactie op droogtestress en tijdens de zaadontwikkeling. Functie Plant Biol. 28 (12), 1161�.

Auldridge, M.E., McCarty, D.R., Klee, H.J. (2006). Plantaardige carotenoïde splitsingsoxygenasen en hun apocarotenoïde producten. Curr. Opin. Plant Biol. 9 (3), 315�. doi: 10.1016/j.pbi.2006.03.005

Avendaño-Vázquez, A., Cordoba, E., Llamas, E., San Román, C., Nisar, N., Torre, D.L., et al. (2014). Een niet-gekarakteriseerd apocarotenoïde-afgeleid signaal gegenereerd in ζ-caroteen desaturasemutanten reguleert de bladontwikkeling en de expressie van chloroplast- en nucleaire genen in Arabidopsis. Plantaardige cel 26 (6), 2524�. doi: 10.1105/tpc.114.123349

Bae, G., Choi, G. (2008). Decodering van lichtsignalen door plantenfytochromen en hun interagerende eiwitten. Ann. Rev. Plant Biol. 59 (1), 281�. doi: 10.1146/annurev.arplant.59.032607.092859

Balazadeh, S., Schildhauer, J., Araújo, W.L., Munn -Bosch, S., Fernie, A.R., Proost, S., et al. (2014). Omkering van veroudering door N-bevoorrading naar N-verhongerd Arabidopsis thaliana: transcriptomische en metabolomische gevolgen. J. Exp. Bot. 65 (14), 3975�. doi: 10.1093/jxb/eru119

Baroli, I., Niyogi, K.K. (2000). Moleculaire genetica van xanthofylafhankelijke fotoprotectie in groene algen en planten. Filos. Trans. R. Soc. Londen, B, Biol. Wetenschap. 355 (1402), 1385�. doi: 10.1098/rstb.2000.0700

Bartley, G.E., Scolnik, P.A. (1995). Plantaardige carotenoïden: pigmenten voor fotoprotectie, visuele aantrekkingskracht en menselijke gezondheid. Plantaardige cel 7 (7), 1027�. doi: 10.1105/tpc.7.7.1027

Bemer, M., Karlova, R., Ballester, A.R., Tikunov, Y.M., Bovy, A.G., Wolters-Arts, M., et al. (2012). De tomaten FRUITFULL-homologen TDR4/FUL1 en MBP7/FUL2 reguleren ethyleenonafhankelijke aspecten van fruitrijping. Plantaardige cel 24 (11), 4437�. doi: 10.1105/tpc.112.103283

Biswal, B. (1995). Carotenoïde katabolisme tijdens bladveroudering en de controle ervan door licht. J. Fotochem. Fotobiol. B, Biol. 30 (1), 3�. doi: 10.1016/1011-1344(95)07197-A

Blanchette, M., Tompa, M. (2002). Ontdekking van regulerende elementen door een computationele methode voor fylogenetische footprinting. Genoom onderzoek. 12 (5), 739�. doi: 10.1101/gr.6902

Bou-Torrent, J., Toledo-Ortiz, G., Ortiz-Alcaide, M., Cifuentes-Esquivel, N., Halliday, KJ, Martinez-Garcóxeda, J., et al. (2015). Regulering van carotenoïde biosynthese door schaduw is afhankelijk van specifieke subsets van antagonistische transcriptiefactoren en cofactoren. J. Plantenfysiol. 169 (3), 1584. doi: 10.1104/pp.15.05552

Bradshaw, H., Jr., Schemske, D.W. (2003). Allelsubstitutie op een bloemkleurlocus produceert een bestuiververschuiving in apenbloemen. Natuur 426 (6963), 176. doi: 10.1038/natuur02106

Breeze, E., Harrison, E., Mchattie, S., Hughes, L., Hickman, R., Hill, C., et al. (2011). Tijdelijke profilering met hoge resolutie van transcripties tijdens Arabidopsis bladveroudering onthult een duidelijke chronologie van processen en regulatie. Plantaardige cel 23 (3), 873�. doi: 10.1105/tpc.111.083345

Britton, G., Young, A.J. (1989). 𠇌hloroplast carotenoïden: functie, biosynthese en effecten van stress en veroudering,” in Trends in onderzoek naar fotosynthese. Ed. Biswal, U.C., Britton, G. (India: Agro Botanical Publishers), 303�.

Brown, B.A., Cloix, C., Jiang, G.H., Kaiserli, E., Herzyk, P., Kliebenstein, D.J., et al. (2005). Een UV-B'x2013-specifieke signaleringscomponent zorgt voor de UV-bescherming van de plant. Proc Natl Acad Science 102 (50), 18225�. doi: 10.1073/pnas.0507187102

Brown, B.A., Jenkins, G.I. (2008). UV-B-signaleringsroutes met verschillende fluence-rate responsprofielen worden onderscheiden in volwassen Arabidopsis bladweefsel door vereiste voor UVR8, HY5 en HYH. J. Plantenfysiol. 146 (2), 576�. doi: 10.1104/pp.107.108456

Catalè1, R., Medina, J., Salinas, J. (2011). Integratie van lage temperatuur- en lichtsignalering tijdens koude acclimatisatiereactie in Arabidopsis. Proc. nat. Acad. Wetenschap. VS. 108 (39), 16475. doi: 10.1073/pnas.1107161108

Cavill, R., Jennen, D., Kleinjans, J., Briedé9, J.J. (2016). Transcriptomische en metabolomische gegevensintegratie. Kort. Bio-informatica 17 (5), 891�. doi: 10.1093/bib/bbv090

Cazzonelli, C.I., Cuttriss, A.J., Cossetto, S.B., Pye, W., Crisp, P., Whelan, J., et al. (2009). Regulering van carotenoïde samenstelling en scheutvertakking in Arabidopsis door een chromatine modificerende histon methyltransferase, SDG8. Plantaardige cel 21 (1), 39�. doi: 10.1105/tpc.108.063131

Cazzonelli, C.I., Pogson, B.J. (2010). Bron om te zinken: regulering van de biosynthese van carotenoïden in planten. Trends Plant Sci. 15 (5), 266�. doi: 10.1016/j.tplants.2010.02.003

Cheminant, S., Wild, M., Bouvier, F., Pelletier, S., Renou, J., Erhardt, M., et al. (2011). DELLA's reguleren de biosynthese van chlorofyl en carotenoïden om foto-oxidatieve schade te voorkomen tijdens de deetiolatie van zaailingen in Arabidopsis. Plantaardige cel 23 (5), 1849. doi: 10.1105/tpc.111.085233

Chiou, C., Pan, H., Chuang, Y., Yeh, K. (2010). Differentiële expressie van carotenoïde-gerelateerde genen bepaalt gediversifieerde carotenoïdekleuring in bloemweefsels van Oncidium cultivars. Planta 232 (4), 937�. doi: 10.1007/s00425-010-1222-x

Chung, M., Vrebalov, J., Alba, R., Lee, J., McQuinn, R., Chung, J., et al. (2010). Een tomaat (Solanum lycopersicum) APETALA2/ERF-gen, SlAP2a, is een negatieve regulator van fruitrijping. Plant J. 64 (6), 936�. doi: 10.1111/j.1365-313X.2010.04384.x

Cloix, C., Jenkins, G.I. (2008). Interactie van de Arabidopsis UV-B'x2013 specifieke signaalcomponent UVR8 met chromatine. Mol. Plant 1 (1), 118�. doi: 10.1093/mp/ssm012

Clotault, J., Peltier, D., Berruyer, R., Thomas, M., Briard, M., Geoffriau, E. (2008). Expressie van genen voor carotenoïde biosynthese tijdens wortelwortelontwikkeling. J. Exp. Bot. 59 (13), 3563�. doi: 10.1093/jxb/ern210

Corona, V., Aracri, B., Kosturkova, G., Bartley, G.E., Pitto, L., Giorgetti, L., et al. (1996). Regulatie van een promotor van het carotenoïde biosynthesegen tijdens de ontwikkeling van planten. Plant J. 9 (4), 505�.

Cutler, S.R., Rodriguez, P.L., Finkelstein, R.R., Abrams, S.R. (2010). Abscisinezuur: opkomst van een kernsignaleringsnetwerk. Ann. Rev. Plant Biol. 61, 651�. doi: 10.1146/annurev-arplant-042809-112122

D𠆚ndrea, L., Simon-Moya, M., Llorente, B., Llamas, E., Marro, M., Loza-Alvarez, P., et al. (2018). Interferentie met clp-protease verslechtert de accumulatie van carotenoïden tijdens het rijpen van tomatenfruit. J. Exp. Bot. 69 (7), 1557�. doi: 10.1093/jxb/erx491

Dalal, M., Chinnusamy, V., Bansal, KC (2010). Isolatie en functionele karakterisering van de lycopeen-β-cyclase (CYC-B) promotor van Solanum habrochaites. BMC Plant Biol. 10 (1), 61. doi: 10.1186/1471-2229-10-61

Dall’Osto, L., Cazzaniga, S., Noord, H., Marion-Poll, A., Bassi, R. (2007). De Arabidopsis aba4-1-mutant onthult een specifieke functie voor neoxanthine bij de bescherming tegen foto-oxidatieve stress. Plantaardige cel 19 (3), 1048. doi: 10.1105/tpc.106.049114

Dall’Osto, L., Holt, N.E., Kaligotla, S., Fuciman, M., Cazzaniga, S., Carbonera, D., et al. (2012). Zeaxanthine beschermt de fotosynthese van planten door de opbrengst van chlorofyltriplet in specifieke antennesubeenheden voor lichtoogst te moduleren. J. Biol. Chem. 287 (50), 41820�. doi: 10.1074/jbc.M112.405498

Delker, C., Sonntag, L., James, G., Janitza, P., Ibaéxf1ez, C., Ziermann, H., et al. (2014). De DET1'x2013COP1'x2013HY5-route vormt een multifunctionele signaalmodule die de fotomorfogenese en thermomorfogenese van planten reguleert. Cel vertegenwoordiger 9 (6), 1983�. doi: 10.1016/j.celrep.2014.11.043

Demmig-Adams, B., Adams, W.W., III (1996). De rol van xanthofylcycluscarotenoïden bij de bescherming van fotosynthese. Trends Plant Sci. 1 (1), 21�. doi: 10.1016/S1360-1385(96)80019-7

Dong, J., Tang, D., Gao, Z., Yu, R., Li, K., He, H., et al. (2014). Arabidopsis DE-ETIOLATED1 onderdrukt fotomorfogenese door fytochroom-interacterende factoren in het donker positief te reguleren. Plantaardige cel 26 (9), 3630. doi: 10.1105/tpc.114.130666

Dong, T., Hu, Z., Deng, L., Wang, Y., Zhu, M., Zhang, J., et al. (2013). Een tomaten MADS-box transcriptiefactor, SlMADS1, werkt als een negatieve regulator van fruitrijping. J. Plantenfysiol. 163 (2), 1026�. doi: 10.1104/pp.113.224436

Dudareva, N., Negre, F., Nagegowda, D.A., Orlova, I. (2006). Plant vluchtige stoffen: recente ontwikkelingen en toekomstperspectieven. Kritiek. Rev. Plant Sci. 25 (5), 417�. doi: 10.1080/07352680600899973

Emiliani, J., D𠆚ndrea, L., Ferreyra, M.L.F., Maulión, E., Rodriguez, E., Rodriguez-Concepción, M., et al. (2018). Een rol voor β, β-xanthofylen in Arabidopsis UV-B fotobescherming. J. Exp. Bot. 69 (20), 4921�. doi: 10.1093/jxb/ery242

Enfissi, E.M.A., Nogueira, M., Bramley, P.M., Fraser, P.D. (2017). De regulering van de vorming van carotenoïden in tomatenfruit. Plant J. 89 (4), 774�. doi: 10.1111/tpj.13428

Eriksson, E.M., Bovy, A., Manning, K., Harrison, L., Andrews, J., De Silva, J., et al. (2004). Effect van de kleurloze niet-rijpende mutatie op celwandbiochemie en genexpressie tijdens de ontwikkeling en rijping van tomatenfruit. J. Plantenfysiol. 136 (4), 4184�. doi: 10.1104/pp.104.045765

Favory, J.J., Stec, A., Gruber, H., Rizzini, L., Oravecz, A., Funk, M., et al. (2009). Interactie van COP1 en UVR8 reguleert door UV-B'x2013 geïnduceerde fotomorfogenese en stress-acclimatisering in Arabidopsis. EMBO J. 28 (5), 591�. doi: 10.1038/emboj.2009.4

Frank, H.A., Cogdell, R.J. (1996). Carotenoïden bij fotosynthese. Fotochem. Fotobiol. 63 (3), 257�. doi: 10.1111/j.1751-1097.1996.tb03022.x

Fraser, P.D., Truesdale, M.R., Bird, C.R., Schuch, W., Bramley, P.M. (1994). Carotenoïde biosynthese tijdens de ontwikkeling van tomatenvruchten (bewijs voor weefselspecifieke genexpressie). J. Plantenfysiol. 105 (1), 405�. doi: 10.1104/pp.105.1.405

Fu, C., Han, Y., Fan, Z., Chen, J., Chen, W., Lu, W., et al. (2016). De papaja-transcriptiefactor CpNAC1 moduleert de biosynthese van carotenoïden door de fytoeendesaturase-genen CpPDS2/4 te activeren tijdens het rijpen van fruit. J. Agric. Voedsel Chem. 64 (27), 5454�. doi: 10.1021/acs.jafc.6b01020

Fu, C., Han, Y., Kuang, J., Chen, J., Lu, W. (2017). Papaya CpEIN3a en CpNAC2 reguleren samen carotenoïde biosynthese-gerelateerde genen CpPDS2/4, CpLCY-e en CpCHY-b tijdens het rijpen van fruit. Plantencel Fysiol. 58 (12), 2155�. doi: 10.1093/pcp/pcx149

Fuentes, P., Pizarro, L., Moreno, J.C., Handford, M., Rodriguez-Concepcion, M., Stange, C. (2012). Lichtafhankelijke veranderingen in plastidedifferentiatie beïnvloeden carotenoïde genexpressie en accumulatie in wortelwortels. Plant Mol. Biol. 79 (1'20132), 47'201359. doi: 10.1007/s11103-012-9893-2

Fujisawa, M., Nakano, T., Ito, Y. (2011). Identificatie van potentiële doelwitgenen voor de rijpingsregulator RIN van tomatenvruchten door chromatine-immunoprecipitatie. BMC Plant Biol. 11 (1), 26. doi: 10.1186/1471-2229-11-26

Fujisawa, M., Shima, Y., Higuchi, N., Nakano, T., Koyama, Y., Kasumi, T., et al. (2012). Directe doelen van de tomatenrijpingsregulator RIN geïdentificeerd door transcriptoom- en chromatine-immunoprecipitatie-analyses. Planta 235 (6), 1107�. doi: 10.1007/s00425-011-1561-2

Fujisawa, M., Nakano, T., Shima, Y., Ito, Y. (2013). Een grootschalige identificatie van directe doelwitten van de tomaten MADS box transcriptiefactor RIPENING INHIBITOR onthult de regulatie van fruitrijping. Plantaardige cel 25 (2), 371�. doi: 10.1105/tpc.112.108118

Fujisawa, M., Shima, Y., Nakagawa, H., Kitagawa, M., Kimbara, J., Nakano, T., et al. (2014). Transcriptionele regulatie van fruitrijping door tomaat FRUITFULL-homologen en geassocieerde MADS-box-eiwitten. Plantaardige cel 26 (1), 89�. doi: 10.1105/tpc.113.119453

Galpaz, N., Ronen, G., Khalfa, Z., Zamir, D., Hirschberg, J. (2006). Een chromoplast-specifieke biosyntheseroute voor carotenoïden wordt onthuld door het klonen van de locus met witte bloemen van tomaten. Plantaardige cel 18 (8), 1947�. doi: 10.1105/tpc.105.039966

Gan, S., Amasino, R.M. (1997). Veroudering begrijpen (moleculaire genetische regulatie en manipulatie van bladveroudering). J. Plantenfysiol. 113 (2), 313. doi: 10.1104/pp.113.2.313

Gandikota, M., Birkenbihl, R.P., Höxf6hmann, S., Cardon, G.H., Saedler, H., Huijser, P. (2007). Het miRNA156/157 herkenningselement in de 3′ UTR van de Arabidopsis SBP-boxgen SPL3 voorkomt vroege bloei door translatieremming in zaailingen. Plant J. 49 (4), 683�. doi: 10.1111/j.1365-313X.2006.02983.x

Giménez, E., Pineda, B., Capel, J., Antón, M.T., Atarés, A., Pérez-Martín, F., et al. (2010). Functionele analyse van de Arlequin-mutant bevestigt de essentiële rol van het Arlequin/TAGL1-gen tijdens de reproductieve ontwikkeling van tomaat. PLoS One 5 (12), e14427. doi: 10.1371/journal.pone.0014427

Giovannoni, JJ (2007). Fruitrijpingsmutanten geven inzicht in de rijpingscontrole. Curr. Opin. Plant Biol. 10 (3), 283�. doi: 10.1016/j.pbi.2007.04.008

Giovannoni, J., Nguyen, C., Ampofo, B., Zhong, S., Fei, Z. (2017). Het epigenoom en transcriptionele dynamiek van fruitrijping. Ann. Rev. Plant Biol. 68, 61�.

Giuliano, G., Bartley, G.E., Scolnik, P.A. (1993). Regulering van de biosynthese van carotenoïden tijdens de ontwikkeling van tomaten. Plantaardige cel 5 (4), 379�. doi: 10.1105/tpc.5.4.379

Goodwin, T., Britton, G.W. (1988). 𠇍istributie en analyse van carotenoïden,” in Plant Pigments. Ed. Goodwin, T.W. (Londen: Academic Press), 62�.

Grassi, S., Piro, G., Lee, J.M., Zheng, Y., Fei, Z., Dalessandro, G., et al. (2013). Vergelijkende genomica onthult kandidaat-carotenoïde routeregulatoren van rijpend watermeloenfruit. BMC Genomics 14 (1), 781. doi: 10.1186/1471-2164-14-781

Guo, J., Hu, Z., Yu, X., Li, A., Li, F., Wang, Y., et al. (2018). Een histondeacetylasegen, SlHDA3, werkt als een negatieve regulator van fruitrijping en carotenoïdenaccumulatie. Plant Cell Rep. 37 (1), 125�. doi: 10.1007/s00299-017-2211-3

Ha, S., Kim, J., Park, J., Lee, S., Cho, K. (2007). Een vergelijking van de carotenoïde-accumulatie in paprikarassen die verschillende rijpingskleuren vertonen: deletie van het capsanthine-capsorubinesynthase-gen is geen voorwaarde voor de vorming van een gele paprika. J. Exp. Bot. 58 (12), 3135�. doi: 10.1093/jxb/erm132

Hao, Y., Hu, G., Breitel, D., Liu, M., Mila, I., Frasse, P., et al. (2015). Auxine-responsfactor SlARF2 is een essentieel onderdeel van het regulerende mechanisme dat de rijping van fruit in tomaat regelt. PLoS Genetica 11 (12), e1005649. doi: 10.1371/journal.pgen.1005649

Hashimoto, H., Uragami, C., Cogdell, R.J. (2016). �rotenoïden en fotosynthese,” in Carotenoïden in de natuur (Cham, Zwitserland: Springer), 111�.

Havaux, M. (1998). Carotenoïden als membraanstabilisatoren in chloroplasten. Trends Plant Sci. 3 (4), 147�. doi: 10.1016/S1360-1385(98)01200-X

Helmy, M., Crits-Christoph, A., Bader, G.D. (2016). Tien eenvoudige regels voor het ontwikkelen van openbare biologische databanken. PLoS-computer. Biol. 12 (11), e1005128. doi: 10.1371/journal.pcbi.1005128

Higo, K., Ugawa, Y., Iwamoto, M., Korenaga, T. (1999). Plant cis-werkende regulerende DNA-elementen (PLACE) database: 1999. Nucleïnezuren Res. 27 (1), 297�. doi: 10.1093/nar/27.1.297

Hirschberg, J. (2001).Carotenoïde biosynthese in bloeiende planten. Curr. Opin. Plant Biol. 4 (3), 210�. doi: 10.1016/S1369-5266(00)00163-1

Hou, X., Rivers, J., León, P., McQuinn, R.P., Pogson, B.J. (2016). Synthese en functie van apocarotenoïde signalen in planten. Trends Plant Sci. 21 (9), 792�. doi: 10.1016/j.tplants.2016.06.001

Howitt, C.A., Pogson, B.J. (2006). Ophoping en functie van carotenoïden in zaden en niet-groene weefsels. Plantencel omgeving. 29 (3), 435�. doi: 10.1111/j.1365-3040.2005.01492.x

Itkin, M., Seybold, H., Breitel, D., Rogachev, I., Meir, S., Aharoni, A. (2009). TOMATO AGAMOUS-LIKE 1 is een onderdeel van het regelgevende netwerk voor fruitrijping. Plant J. 60 (6), 1081�. doi: 10.1111/j.1365-313X.2009.04064.x

Ito, Y., Kitagawa, M., Ihashi, N., Yabe, K., Kimbara, J., Yasuda, J., et al. (2008). DNA-bindingsspecificiteit, transcriptioneel activeringspotentieel en het rin-mutatie-effect voor de rijpingsregulator RIN van tomatenvruchten. Plant J. 55 (2), 212�. doi: 10.1111/j.1365-313X.2008.03491.x

Jahns, P., Holzwarth, AR (2012). De rol van de xanthofylcyclus en van luteïne bij fotoprotectie van fotosysteem II. BBA-Bio-energetica 1817 (1), 182�. doi: 10.1016/j.bbabio.2011.04.012

Jia, K., Baz, L., Al-Babili, S. (2017). Van carotenoïden tot strigolactonen. J. Exp. Bot. 69 (9), 2189�. doi: 10.1093/jxb/erx476

Jiao, Y., Lau, O. S., Deng, X. W. (2007). Lichtgereguleerde transcriptienetwerken in hogere planten. nat. Rev. Genet. 8 (3), 217. doi: 10.1038/nrg2049

Jin, X., Bai, C., Bassie, L., Nogareda, C., Romagosa, I., Twyman, R.M., et al. (2019). ZmPBF- en ZmGAMYB-transcriptiefactoren transactiveren onafhankelijk de promotor van de maïs (Zea mays) β-caroteenhydroxylase 2-gen. Nieuwe fytol. 222 (2), 793�. doi: 10.1111/nph.15614

Karlova, R., Rosin, F.M., Busscher-Lange, J., Parapunova, V., Do, P.T., Fernie, A.R., et al. (2011). Transcriptoom- en metabolietprofilering tonen aan dat APETALA2a een belangrijke regulator is van de rijping van tomatenfruit. Plantaardige cel 23 (3), 923�. doi: 10.1105/tpc.110.081273

Kim, D.H., Yamaguchi, S., Lim, S., Oh, E., Park, J., Hanada, A., et al. (2008). SOMNUS, een CCCH-type zinkvingerproteïne in Arabidopsis, reguleert de lichtafhankelijke zaadkieming stroomafwaarts van PIL5 negatief. Plantaardige cel 20 (5), 1260�. doi: 10.1105/tpc.108.058859

Kim, J., Kang, H., Park, J., Kim, W., Yoo, J., Lee, N., et al. (2016). PIF1-interagerende transcriptiefactoren en hun bindende sequentie-elementen bepalen de in vivo targetingsites van PIF1. Plantaardige cel 28 (6), 1388�. doi: 10.1105/tpc.16.00125

Kishimoto, S., Oda-Yamamizo, C., Ohmiya, A. (2018). Regulering van carotenoïde pigmentatie in bloemkronen van petunia. Plant Mol. Biol. vertegenwoordiger 36 (4), 632�. doi: 10.1007/s11105-018-1107-x

Klee, H.J., Giovannoni, J.J. (2011). Genetica en controle van de rijping van tomatenfruit en kwaliteitskenmerken. Ann. Rev. Genet. 45 (1), 41�. doi: 10.1146/annurev-genet-110410-132507

Kolotilin, I., Koltai, H., Tadmor, Y., Bar-Or, C., Reuveni, M., Meir, A., et al. (2007). Transcriptionele profilering van een hoge pigment-2 dg tomatenmutant verbindt vroege biogenese van fruitplastiden met de overproductie van fytonutriënten. J. Plantenfysiol. 145 (2), 389�. doi: 10.1104/pp.107.102962

Kramer, EM (2015). Een vreemdeling in een vreemd land: het nut en de interpretatie van heterologe expressie. Voorkant. Plant Sci. 6, 734. doi: 10.3389/fpls.2015.00734

Lau, O.S., Deng, X.W. (2012). De fotomorfogene repressoren COP1 en DET1: 20 jaar later. Trends Plant Sci. 17 (10), 584�. doi: 10.1016/j.tplants.2012.05.004

Larsen, P.E., Sreedasyam, A., Trivedi, G., Desai, S., Dai, Y., Cseke, L.J., et al. (2016). Multi-omics-benadering identificeert moleculaire mechanismen van mycorrhiza-interactie met schimmels van planten. Voorkant. Plant Sci. 6, 1061. doi: 10.3389/fpls.2015.01061

Lescot, M., Déhais, P., Thijs, G., Marchal, K., Moreau, Y., de Peer, Y., et al. (2002). PlantCARE, een database met cis-werkende regulerende elementen van planten en een portaal naar hulpmiddelen voor in silico-analyse van promotorsequenties. Nucleïnezuren Res. 30 (1), 325�. doi: 10.1093/nar/30.1.325

Levin, I., Frankel, P., Gilboa, N., Tanny, S., Lalazar, A. (2003). De donkergroene mutatie van tomaten is een nieuw allel van de tomatenhomoloog van het DEETIOLATED1-gen. Theor. toepassing Genet. 106 (3), 454�. doi: 10.1007/s00122-002-1080-4

Li, F., Vallabhaneni, R., Yu, J., Rocheford, T., Wurtzel, E.T. (2008a). De maïsfytoeensynthase-genfamilie: overlappende rollen voor carotenogenese in endosperm, fotomorfogenese en thermische stresstolerantie. J. Plantenfysiol. 147 (3), 1334�. doi: 10.1104/pp.108.122119

Li, F., Vallabhaneni, R., Wurtzel, E.T. (2008b). PSY3, een nieuw lid van de familie van het fytoeensynthasegen, geconserveerd in de Poaceae en regulator van door abiotische stress geïnduceerde wortelcarotenogenese. J. Plantenfysiol. 146 (3), 1333�. doi: 10.1104/pp.107.111120

Li, L., Yuan, H., Zeng, Y., Xu, Q. (2016). “Plastiden en accumulatie van carotenoïden,” in Carotenoids in Nature (Cham, Zwitserland: Springer), 273�.

Li, S., Chen, K., Grierson, D. (2019). Een kritische evaluatie van de rol van ethyleen- en MADS-transcriptiefactoren in het netwerk dat de rijping van vlezige vruchten controleert. Nieuwe fytol. 221 (4), 1724�. doi: 10.1111/nph.15545

Lieberman, M., Segev, O., Gilboa, N., Lalazar, A., Levin, I. (2004). De tomatenhomoloog van het gen dat codeert voor UV-beschadigd DNA-bindend eiwit 1 (DDB1) onderstreepte als het gen dat het hoge pigment-1 mutante fenotype veroorzaakt. Theor. toepassing Genet. 108 (8), 1574�. doi: 10.1007/s00122-004-1584-1

Lim, P.O., Kim, H.J., Gil Nam, H. (2007). Bladveroudering. Ann. Rev. Plant Biol. 58, 115�. doi: 10.1146/annurev.arplant.57.032905.105316

Lin, Z., Hong, Y., Yin, M., Li, C., Zhang, K., Grierson, D. (2008). Een tomaten HD-Zip homeobox-eiwit, LeHB-1, speelt een belangrijke rol in de organogenese en rijping van bloemen. Plant J. 55 (2), 301�. doi: 10.1111/j.1365-313X.2008.03505.x

Liu, G., Ren, G., Guirgis, A., Thornburg, R.W. (2009). De MYB305-transcriptiefactor reguleert de expressie van nectarine-genen in de bloemennectar van siertabak. Plantaardige cel 21 (9), 2672�. doi: 10.1105/tpc.108.060079

Liu, L., Jia, C., Zhang, M., Chen, D., Chen, S., Guo, R., et al. (2014). Ectopische expressie van een BZR1-1D-transcriptiefactor in brassinosteroïde-signalering verbetert de accumulatie van carotenoïden en de kenmerken van fruitkwaliteit in tomaat. Plantaardige biotechnologie. J. 12 (1), 105�. doi: 10.1111/pbi.12121

Liu, L., Wei, J., Zhang, M., Zhang, L., Li, C., Wang, Q. (2012). Ethyleenonafhankelijke inductie van lycopeenbiosynthese in tomatenvruchten door jasmonaten. J. Exp. Bot. 63 (16), 5751�. doi: 10.1093/jxb/ers224

Liu, L., Shao, Z., Zhang, M., Wang, Q. (2015a). Regulering van het carotenoïdemetabolisme in tomaat. Mol. Plant 8 (1), 28�. doi: 10.1016/j.molp.2014.11.006

Liu, M., Pirrello, J., Chervin, C., Roustan, J., Bouzayen, M. (2015b). Ethyleencontrole van fruitrijping: het complexe netwerk van transcriptionele regulatie opnieuw bekijken. J. Plantenfysiol. 169 (4), 2380. doi: 10.1104/pp.15.01361

Liu, X., Zhang, Y., Chen, Y., Li, M., Zhou, F., Li, K., et al. (2017). In situ opname van chromatine-interacties door gebiotinyleerd dCas9. Cel 170 (5), 1028�. doi: 10.1016/j.cell.2017.08.003

Llorente, B., D𠆚ndrea, L., Ruiz-Sola, M.A., Botterweg, E., Pulido, P., Andilla, J., et al. (2016). De biosynthese van carotenoïde uit tomatenvruchten wordt door een lichtafhankelijk mechanisme aangepast aan het werkelijke rijpingsproces. Plant J. 85 (1), 107�. doi: 10.1111/tpj.13094

Llorente, B., Martinez-Garcia, J., Stange, C., Rodriguez-Concepcion, M. (2017). Verhelderende kleuren: regulering van de biosynthese van carotenoïden en accumulatie door licht. Curr. Opin. Plant Biol. 37, 49�. doi: 10.1016/j.pbi.2017.03.011

López-Râxe1ez, J.A., Charnikhova, T., Gâxf3mez-Roldân, V., Matusova, R., Kohlen, W., De Vos, R., et al. (2008). Tomatenstrigolactonen zijn afgeleid van carotenoïden en hun biosynthese wordt bevorderd door fosfaatgebrek. Nieuwe fytol. 178 (4), 863�. doi: 10.1111/j.1469-8137.2008.02406.x

Lu, S., Van Eck, J., Zhou, X., Lopez, A.B., O’Halloran, D.M., Cosman, K.M., et al. (2006). De bloemkool of het gen codeert voor een eiwit dat DnaJ-cysteïne-rijk domein bevat dat hoge niveaus van bèta-caroteenaccumulatie medieert. Plantaardige cel 18 (12), 3594�. doi: 10.1105/tpc.106.046417

Lu, S., Zhang, Y., Zhu, K., Yang, W., Ye, J., Chai, L., et al. (2018). De citrustranscriptiefactor CsMADS6 moduleert het carotenoïdemetabolisme door carotenogene genen direct te reguleren. J. Plantenfysiol. 176 (4), 2657�. doi: 10.1104/pp.17.01830

Luo, Z., Zhang, J., Li, J., Yang, C., Wang, T., Ouyang, B., et al. (2013). Een STAY-GREEN-eiwit SlSGR1 reguleert de accumulatie van lycopeen en β-caroteen door directe interactie met SlPSY1 tijdens rijpingsprocessen in tomaat. Nieuwe fytol. 198 (2), 442�. doi: 10.1111/nph.12175

Ma, N., Feng, H., Meng, X., Li, D., Yang, D., Wu, C., et al. (2014). Overexpressie van tomaat SlNAC1 transcriptiefactor verandert fruitpigmentatie en verzachting. BMC Plant Biol. 14 (1), 351. doi: 10.1186/s12870-014-0351-y

Maass, D., Arango, J., Wóxfcst, F., Beyer, P., Welsch, R. (2009). Carotenoïde kristalvorming in Arabidopsis en wortelwortels veroorzaakt door verhoogde fytoeensynthase-eiwitniveaus. PloS One 4 (7), e6373. doi: 10.1371/journal.pone.0006373

Manning, K., Tör, M., Poole, M., Hong, Y., Thompson, A.J., King, G.J., et al. (2006). Een natuurlijk voorkomende epigenetische mutatie in een gen dat codeert voor een SBP-box-transcriptiefactor remt de rijping van tomatenfruit. nat. Genet. 38 (8), 948. doi: 10.1038/ng1841

Martel, C., Vrebalov, J., Tafelmeyer, P., Giovannoni, JJ (2011). De tomaten MADS-box transcriptiefactor RIPENING INHIBITOR interageert met promotors die betrokken zijn bij tal van rijpingsprocessen op een KLEURLOZE NIET-RIPENING-afhankelijke manier. J. Plantenfysiol. 157 (3), 1568. doi: 10.1104/pp.111.181107

Maruyama, K., Urano, K., Yoshiwara, K., Morishita, Y., Sakurai, N., Suzuki, H., et al. (2014). Geïntegreerde analyse van de effecten van koude en uitdroging op rijstmetabolieten, fytohormonen en gentranscripten. J. Plantenfysiol. 164 (4), 1759�. doi: 10.1104/pp.113.231720

Meier, S., Tzfadia, O., Vallabhaneni, R., Gehring, C., Wurtzel, E.T. (2011). Een transcriptionele analyse van carotenoïde, chlorofyl en plastidiale isoprenoïde biosynthesegenen tijdens ontwikkeling en osmotische stressreacties in Arabidopsis thaliana. BMC Syst. Biol. 5 (1), 77. doi: 10.1186/1752-0509-5-77

Meng, C., Yang, D., Ma, X., Zhao, W., Liang, X., Ma, N., et al. (2016). Onderdrukking van de SlNAC1-transcriptiefactor van tomaten vertraagt ​​de rijping van fruit. J. Plantenfysiol. 193, 88�. doi: 10.1016/j.jplph.2016.01.014

Middleton, E.M., Teramura, A.H. (1993). De rol van flavonolglycosiden en carotenoïden bij het beschermen van soja tegen ultraviolet-B-schade. J. Plantenfysiol. 103 (3), 741�. doi: 10.1104/pp.103.3.741

Mochida, K., Shinozaki, K. (2011). Vooruitgang in omics en bioinformatica tools voor systeemanalyses van plantfuncties. Plantencel Fysiol. 52 (12), 2017�. doi: 10.1093/pcp/pcr153

Moehs, C.P., Tian, ​​L., Osteryoung, K.W., DellaPenna, D. (2001). Analyse van carotenoïde biosynthetische genexpressie tijdens de ontwikkeling van goudsbloembloemblaadjes. Plant Mol. Biol. 45 (3), 281�. doi: 10.1023/A: 1006417009203

Maan, J., Zhu, L., Shen, H., Huq, E. (2008). PIF1 reguleert direct en indirect de biosynthese van chlorofyl om het vergroeningsproces te optimaliseren Arabidopsis. Proc. nat. Acad. Wetenschap. VS. 105 (27), 9433. doi: 10.1073/pnas.0803611105

Mou, W., Li, D., Bu, J., Jiang, Y., Khan, Z.U., Luo, Z., et al. (2016). Uitgebreide analyse van ABA-effecten op de biosynthese en signalering van ethyleen tijdens het rijpen van tomatenfruit. PLoS One 11 (4), e0154072. doi: 10.1371/journal.pone.0154072

Möxfcller, P., Li, X.P., Niyogi, K.K. (2001). Niet-fotochemische blussen. Een reactie op overtollige lichtenergie. J. Plantenfysiol. 125 (4), 1558�. doi: 10.1104/pp.125.4.1558

Mustilli, A.C., Fenzi, F., Ciliento, R., Alfano, F., Bowler, C. (1999). Het fenotype van de tomaat-high pigment-2-mutant wordt veroorzaakt door een mutatie in de tomatenhomoloog van DEETIOLATED1. Plantaardige cel 11 (2), 145�. doi: 10.1105/tpc.11.2.145

Nambara, E., Marion-Poll, A. (2005). Abscisinezuurbiosynthese en katabolisme. Ann. Rev. Plant Biol. 56, 165�. doi: 10.1146/annurev.arplant.56.032604.144046

Nielsen, J., Keasling, J.D. (2016). Engineering cellulair metabolisme. Cel 164 (6), 1185�. doi: 10.1016/j.cell.2016.02.004

Nielsen, K.M., Lewis, D.H., Morgan, E.R. (2003). Karakterisering van carotenoïde pigmenten en hun biosynthese in twee geelbloemige lijnen van Sandersonia aurantiaca (Haak). Euphytica 130 (1), 25�. doi: 10.1023/A: 1022328828688

Nisar, N., Li, L., Lu, S., Khin, N., Pogson, B. (2015). Carotenoïdenmetabolisme in planten. Mol. Plant 8 (1), 68�. doi: 10.1016/j.molp.2014.12.007

Niyogi, KK (1999). Photoprotection Revisited: genetische en moleculaire benaderingen. Ann. Rev. Plant Biol. 50 (1), 333�. doi: 10.1146/annurev.arplant.50.1.333

Oh, E., Kang, H., Yamaguchi, S., Park, J., Lee, D., Kamiya, Y., et al. (2009). Genoombrede analyse van genen die het doelwit zijn van PHYTOCHROME INTERACTING FACTOR 3-LIKE5 tijdens zaadkieming in Arabidopsis. Plantaardige cel 21 (2), 403�. doi: 10.1105/tpc.108.064691

Ohmiya, A., Kishimoto, S., Aida, R., Yoshioka, S., Sumitomo, K. (2006). Carotenoïde splitsingsdioxygenase (CmCCD4a) draagt ​​bij aan de vorming van witte kleur in de bloembladen van chrysanten. J. Plantenfysiol. 142 (3), 1193�. doi: 10.1104/pp.106.087130

Ohmiya, A. (2011). Diversiteit van carotenoïde samenstelling in bloemblaadjes. Jpn. agrarisch. Onderzoek Q. 45 (2), 163�. doi: 10.6090/jarq.45.163

Ohmiya, A. (2013). Kwalitatieve en kwantitatieve controle van de accumulatie van carotenoïden in bloembladen. Wetenschap. Hortisch. 163, 10�. doi: 10.1016/j.scienta.2013.06.018

Ohmiya, A., Kato, M., Shimada, T., Nashima, K., Kishimoto, S., Nagata, M. (2019). Moleculaire basis van carotenoïdenaccumulatie in tuinbouwgewassen. Hortisch. J. 88 (2), 135�. doi: 10.2503/hortj.UTD-R003

Ougham, H.J., Morris, P., Thomas, H. (2005). De kleuren van herfstbladeren als symptomen van cellulaire recycling en verdediging tegen omgevingsstress. Curr. Bovenkant. ontwikkelaar Biol. 66, 136�.

Pecker, I., Chamovitz, D., Linden, H., Sandmann, G., Hirschberg, J. (1992). Een enkel polypeptide dat de omzetting van fytoeen in zeta-caroteen katalyseert, wordt transcriptioneel gereguleerd tijdens het rijpen van tomatenvruchten. Proc. nat. Acad. Wetenschap. VS. 89 (11), 4962�. doi: 10.1073/pnas.89.11.4962

Pfeiffer, A., Shi, H., Tepperman, J.M., Zhang, Y., Quail, P.H. (2014). Combinatorische complexiteit in een transcriptioneel gecentreerde signaleringshub in Arabidopsis. Mol. Plant 7 (11), 1598�. doi: 10.1093/mp/ssu087

Pogson, B.J., Niyogi, K.K., Bjorkman, O., Dellapenna, D. (1998). Veranderde xanthofylsamenstellingen hebben een nadelige invloed op de accumulatie van chlorofyl en niet-fotochemische uitdoving Arabidopsis mutanten. Proc. nat. Acad. Wetenschap. 95 (22), 13324�. doi: 10.1073/pnas.95.22.13324

Pospíšil, P. (2016). Productie van reactieve zuurstofsoorten door fotosysteem II als reactie op licht- en temperatuurstress. Voorkant. Plant Sci. 7, 1950. doi: 10.3389/fpls.2016.01950

Qin, G., Wang, Y., Cao, B., Wang, W., Tian, ​​S. (2012). Het ontrafelen van het regulerende netwerk van de MADS-box-transcriptiefactor RIN bij het rijpen van fruit. Plant J. 70 (2), 243�. doi: 10.1111/j.1365-313X.2011.04861.x

Rai, A., Saito, K., Yamazaki, M. (2017). Geïntegreerde omics-analyse van gespecialiseerd metabolisme in medicinale planten. Plant J. 90 (4), 764�. doi: 10.1111/tpj.13485

Rizzini, L., Favory, JJ, Cloix, C., Faggionato, D., O’Hara, A., Kaiserli, E., et al. (2011). Waarneming van UV-B door de Arabidopsis UVR8-eiwit. Wetenschap 332 (6025), 103�. doi: 10.1126/wetenschap.1200660

Rock, C.D., Zeevaart, J.A. (1991). De aba-mutant van Arabidopsis thaliana is aangetast in de biosynthese van epoxy-carotenoïden. Proc. nat. Acad. Wetenschap. VS. 88 (17), 7496�. doi: 10.1073/pnas.88.17.7496

Rodróxedguez-Leal, D., Lemmon, Z.H., Man, J., Bartlett, M.E., Lippman, Z.B. (2017). Technische kwantitatieve kenmerkvariatie voor gewasverbetering door genoombewerking. Cel 171 (2), 470�. doi: 10.1016/j.cell.2017.08.030

Rodríguez-Villalón, A., Gas, E., Rodríguez-Concepciāxf3n, M. (2009).Fytoeensynthase-activiteit regelt de biosynthese van carotenoïden en de toevoer van hun metabole voorlopers in donker gekweekte Arabidopsis zaailingen. Plant J. 60 (3), 424�. doi: 10.1111/j.1365-313X.2009.03966.x

Ronen, G., Cohen, M., Zamir, D., Hirschberg, J. (1999). Regulering van de biosynthese van carotenoïden tijdens de ontwikkeling van tomatenvruchten: de expressie van het gen voor lycopeen-epsilon-cyclase wordt neerwaarts gereguleerd tijdens het rijpen en is verhoogd in de mutante delta. Plant J. 17 (4), 341�. doi: 10.1046/j.1365-313X.1999.00381.x

Rossel, J.B., Wilson, I.W., Pogson, B.J. (2002). Globale veranderingen in genexpressie als reactie op veel licht in Arabidopsis. J. Plantenfysiol. 130 (3), 1109�. doi: 10.1104/pp.005595

Ruiz-Sola, M., Arbona, V., Gáxf3mez-Cadenas, A., Rodróxedguez-Concepciäxf3n, M., Rodróxedguez-Villalóxf3n, A. (2014). Een wortelspecifieke inductie van de biosynthese van carotenoïden draagt ​​bij aan de ABA-productie bij zoutstress in Arabidopsis. PLoS One 9 (3), e90765. doi: 10.1371/journal.pone.0090765

Ruiz-Sola, M.A., Rodríguez-Concepci&#n, M. (2012). Carotenoïde biosynthese in Arabidopsis: een kleurrijk pad. Arabidopsis-boek 10, e0158. doi: 10.1199/tab.0158

Sagawa, J.M., Stanley, L.E., LaFountain, A.M., Frank, H.A., Liu, C., Yuan, Y. (2016). Een R2R3-MYB-transcriptiefactor reguleert de carotenoïdepigmentatie in Mimulus lewisii bloemen. Nieuwe fytol. 209 (3), 1049�. doi: 10.1111/nph.13647

Sakakibara, H. (2006). Cytokinines: activiteit, biosynthese en translocatie. Ann. Rev. Plant Biol. 57, 431�. doi: 10.1146/annurev.arplant.57.032905.105231

Shen, H., Zhu, L., Castillon, A., Majee, M., Downie, B., Huq, E. (2008). Door licht geïnduceerde fosforylering en afbraak van de negatieve regulator FYTOCHROOM-INTERACTERENDE FACTOR1 van Arabidopsis zijn afhankelijk van de directe fysieke interacties met foto-geactiveerde fytochromen. Plantaardige cel 20 (6), 1586. doi: 10.1105/tpc.108.060020

Shi, H., Wang, X., Mo, X., Tang, C., Zhong, S., Deng, XW (2015). Arabidopsis DET1 degradeert HFR1 maar stabiliseert PIF1 om zaadkieming nauwkeurig te reguleren. Proc. nat. Acad. Wetenschap. VS. 112 (12), 3817. doi: 10.1073/pnas.1502405112

Shima, Y., Kitagawa, M., Fujisawa, M., Nakano, T., Kato, H., Kimbara, J., et al. (2013). Tomaten FRUITFULL-homologen werken bij het rijpen van fruit via het vormen van MADS-box transcriptiefactorcomplexen met RIN. Plant Mol. Biol. 82 (4-5), 427�. doi: 10.1007/s11103-013-0071-y

Shin, J., Kim, K., Kang, H., Zulfugarov, I.S., Bae, G., Lee, C., et al. (2009). Fytochromen bevorderen de lichtreacties van zaailingen door vier negatief werkende, op fytochroom reagerende factoren te remmen. Proc. nat. Acad. Wetenschap. VS. 106 (18), 7660. doi: 10.1073/pnas.0812219106

Shinozaki, K., Yamaguchi-Shinozaki, K. (2007). Gennetwerken die betrokken zijn bij droogtestressrespons en tolerantie. J. Exp. Bot. 58 (2), 221�. doi: 10.1093/jxb/erl164

Snowden, K.C., Simkin, A.J., Janssen, B.J., Templeton, K.R., Loucas, H.M., Simons, J.L., et al. (2005). De verminderde apicale dominantie1Petunia hybrida CAROTENOIDDE CLEAVAGE DIOXYGENASE8-gen beïnvloedt de productie van takken en speelt een rol bij bladveroudering, wortelgroei en bloemontwikkeling. Plantaardige cel 17 (3), 746. doi: 10.1105/tpc.104.027714

Stanley, L.E., Ding, B., Sun, W., Mou, F., Hill, C., Chen, S., et al. (2017). Een herhalend tetratricopeptide-eiwit reguleert de biosynthese van carotenoïden en de ontwikkeling van chromoplasten in apenbloemen (Mimulus). Biorxiv 171249. doi: 10.1101/171249

Su, L., Diretto, G., Purgatto, E., Danoun, S., Zouine, M., Li, Z., et al. (2015). De accumulatie van carotenoïden tijdens het rijpen van tomatenvruchten wordt gemoduleerd door de auxine-etheenbalans. BMC Plant Biol. 15 (1), 114. doi: 10.1186/s12870-015-0495-4

Zon, T., Yuan, H., Cao, H., Yazdani, M., Tadmor, Y., Li, L. (2018a). Carotenoïdemetabolisme in planten: de rol van plastiden. Mol. Plant 11 (1), 58�. doi: 10.1016/j.molp.2017.09.010

Sun, Y., Liang, B., Wang, J., Kai, W., Chen, P., Jiang, L., et al. (2018b). SlPti4 beïnvloedt de regulatie van fruitrijping, zaadkieming en stressreacties door ABA-signalering in tomaat te moduleren. Plantencel Fysiol. 59 (10), 1956�. doi: 10.1093/pcp/pcy111

Szymańska, R., Ślesak, I., Orzechowska, A., Kruk, J. (2017). Fysiologische en biochemische reacties op hoge licht- en temperatuurstress in planten. omgeving. Exp. Bot. 139, 165�. doi: 10.1016/j.envexbot.2017.05.002

Thompson, A.J., Tor, M., Barry, C.S., Vrebalov, J., Orfila, C., Jarvis, M.C., et al. (1999). Moleculaire en genetische karakterisering van een nieuwe pleiotrope tomatenrijpende mutant. J. Plantenfysiol. 120 (2), 383�. doi: 10.1104/pp.120.2.383

Toledo-Ortiz, G., Huq, E., Rodróxedguez-Concepción, M. (2010). Directe regulatie van fytoeensynthase-genexpressie en carotenoïde biosynthese door fytochroom-interagerende factoren. Proc. nat. Acad. Wetenschap. VS. 107 (25), 11626. doi: 10.1073/pnas.0914428107

Toledo-Ortiz, G., Johansson, H., Lee, K.P., Bou-Torrent, J., Stewart, K., Steel, G., et al. (2014). De HY5–PIF-regulatiemodule coördineert de licht- en temperatuurregeling van fotosynthetische gentranscriptie (licht en temperatuur fotosynthetische gentranscriptieregulatie). PLoS Genetica 10 (6), e1004416. doi: 10.1371/journal.pgen.1004416

Ueda, H., Kusaba, M. (2015). Strigolacton reguleert bladveroudering samen met ethyleen in Arabidopsis. J. Plantenfysiol. 169 (1), 138. doi: 10.1104/pp.15.00325

Vallabhaneni, R., Bradbury, L.M.T., Wurtzel, E.T. (2010). De carotenoïde dioxygenase-genfamilie in maïs, sorghum en rijst. Boog. Biochem. Biofysica. 504 (1), 104�. doi: 10.1016/j.abb.2010.07.019

Vardhini, B.V., Rao, S.S.R. (2002). Versnelling van het rijpen van vruchtwandschijven van tomaten door brassinosteroïden. fytochemie 61 (7), 843�. doi: 10.1016/S0031-9422(02)00223-6

Vrebalov, J., Ruezinsky, D., Padmanabhan, V., White, R., Medrano, D., Drake, R., et al. (2002). Een MADS-box-gen dat nodig is voor fruitrijping op de locus van de tomatenrijpingsremmer (rin). Wetenschap 296 (5566), 343�. doi: 10.1126/wetenschap.1068181

Vrebalov, J., Pan, I.L., Arroyo, A.J.M., Mcquinn, R., Chung, M., Poole, M., et al. (2009). Vlezige vruchtexpansie en rijping worden gereguleerd door het tomaat SHATTERPROOF-gen TAGL1. Plantaardige cel 21 (10), 3041�. doi: 10.1105/tpc.109.066936

Wang, J., Tsjechisch, B., Weigel, D. (2009). miR156-gereguleerde SPL-transcriptiefactoren definiëren een endogene bloeiroute in Arabidopsis thaliana. Cel 138 (4), 738�. doi: 10.1016/j.cell.2009.06.014

Wang, W., Liu, G., Niu, H., Timko, MP, Zhang, H. (2014). Het F-box-eiwit COI1 functioneert stroomopwaarts van MYB305 om het primaire koolhydraatmetabolisme in tabak te reguleren (Nicotiana tabacum L. cv. TN90). J. Exp. Bot. 65 (8), 2147�. doi: 10.1093/jxb/eru084

Wang, X., Yamagishi, M. (2019). Mechanismen die de accumulatie van carotenoïden in bloemen onderdrukken, verschillen afhankelijk van de hybride groepen lelies (Lelie spp.). Wetenschap. Hortisch. 243, 159�. doi: 10.1016/j.scienta.2018.08.025

Wei, S., Yu, B., Gruber, M. Y., Khachatourians, G. G., Hegedus, D. D., Hannoufa, A. (2010). Verbeterde niveaus van zaadcarotenoïden en vertakking in transgene Brassica napus uiting geven aan de Arabidopsis miR156b-gen. J. Agric. Voedsel Chem. 58 (17), 9572�. doi: 10.1021/jf102635f

Welsch, R., Medina, J., Giuliano, G., Beyer, P., von Lintig, J. (2003). Structurele en functionele karakterisering van de fytoeensynthase-promoter van Arabidopsis thaliana. Planta 216 (3), 523�. doi: 10.1007/s00425-002-0885-3

Welsch, R., Maass, D., Voegel, T., Dellapenna, D., Beyer, P. (2007). Transcriptiefactor RAP2.2 en zijn interacterende partner SINAT2: stabiele elementen in de carotenogenese van Arabidopsis bladeren. J. Plantenfysiol. 145 (3), 1073�. doi: 10.1104/pp.107.104828

Welsch, R., Wust, F., Bar, C., Al-Babili, S., Beyer, P. (2008). Een derde fytoeensynthase is gewijd aan door abiotische stress veroorzaakte abscisinezuurvorming in rijst en definieert functionele diversificatie van fytoeensynthasegenen. J. Plantenfysiol. 147 (1), 367�. doi: 10.1104/pp.108.117028

Weng, L., Zhao, F., Li, R., Xu, C., Chen, K., Xiao, H. (2015). De zinkvingertranscriptiefactor SlZFP2 reguleert de biosynthese van abscisinezuur en fruitrijping in tomaat negatief. J. Plantenfysiol. 167 (3), 931�. doi: 10.1104/pp.114.255174

Wu, W., Liu, L.L., Yan, Y.C. (2019). TERF1 reguleert nucleaire genexpressie door chloroplast retrograde signalen. Rus. J. Plantenfysiol., 66 (1), 22�. doi: 10.1134/S1021443719010205

Xie, Q., Hu, Z., Zhu, Z., Dong, T., Zhao, Z., Cui, B., et al. (2014). Overexpressie van een nieuw MADS-box-gen SlFYFL vertraagt ​​veroudering, fruitrijping en abscissie in tomaat. Wetenschap. vertegenwoordiger 4, 4367. doi: 10.1038/srep04367

Xiong, C., Luo, D., Lin, A., Zhang, C., Shan, L., He, P., et al. (2019). Een tomaten-B-box-eiwit SlBBX20 moduleert de biosynthese van carotenoïden door PHYTOEEN SYNTHASE 1 direct te activeren en is gericht op de door 26S-proteasoom gemedieerde afbraak. Nieuwe fytol. 221 (1), 279�. doi: 10.1111/nph.15373

Yamagishi, M., Kishimoto, S., Nakayama, M. (2010). Carotenoïde samenstelling en veranderingen in expressie van carotenoïde biosynthetische genen in tepalen van Aziatische hybride lelie. Planten ras. 129 (1), 100�. doi: 10.1111/j.1439-0523.2009.01656.x

Yamamizo, C., Kishimoto, S., Ohmiya, A. (2010). Carotenoïde samenstelling en carotenogene genexpressie tijdens Ipomoea ontwikkeling van de bloembladen. J. Exp. Bot. 61 (3), 709�. doi: 10.1093/jxb/erp335

Yang, J.C., Zhang, J.H., Wang, Z.Q., Zhu, Q.S., Liu, L.J. (2003). Betrokkenheid van abscisinezuur en cytokinines bij de veroudering en remobilisatie van koolstofreserves in tarwe die wordt blootgesteld aan waterstress tijdens het vullen van granen. Plantencel omgeving. 26 (10), 1621�. doi: 10.1046/j.1365-3040.2003.01081.x

Yuan, H., Zhang, J., Nageswaran, D., Li, L. (2015). Carotenoïde metabolisme en regulatie in tuinbouwgewassen. Hortic Res. 2, 15036. doi: 10.1038/hortres.2015.36

Zhang, B., Liu, C., Wang, Y., Yao, X., Wang, F., Wu, J., et al. (2015). Verstoring van een CAROTENOIDDE CLEAVAGE DIOXYGENASE 4-gen zet bloemkleur om van wit naar geel in Brassica soort. Nieuwe fytol. 206 (4), 1513�. doi: 10.1111/nph.13335

Zhang, J., Hu, Z., Yao, Q., Guo, X., Nguyen, V., Li, F., et al. (2018a). Een MADS-box-eiwit van tomaten, SlCMB1, reguleert de biosynthese van ethyleen en de accumulatie van carotenoïden tijdens het rijpen van fruit. Wetenschap. vertegenwoordiger 8 (1), 3413. doi: 10.1038/s41598-018-21672-8

Zhang, M., Yuan, B., Leng, P. (2009). De rol van ABA bij het op gang brengen van de biosynthese van ethyleen en het rijpen van tomatenfruit. J. Exp. Bot. 60 (6), 1579�. doi: 10.1093/jxb/erp026

Zhang, Y., Li, Z., Tu, Y., Cheng, W., Yang, Y. (2018b). Tomaat (Solanum lycopersicum) SLIPT4, dat codeert voor een isopentenyltransferase, is betrokken bij bladveroudering en lycopeenbiosynthese tijdens het rijpen van fruit. BMC Plant Biol. 18 (1), 107. doi: 10.1186/s12870-018-1327-0

Zhong, S., Fei, Z., Yun-Ru, C., Zheng, Y., Huang, M., Vrebalov, J., et al. (2013). Single-base resolutie methylomen van de ontwikkeling van tomatenvruchten onthullen epigenoommodificaties geassocieerd met rijping. nat. Biotechnologie. 31 (2), 154. doi: 10.1038/nbt.2462

Zhou, X., Welsch, R., Yang, Y., Alvarez, D., Riediger, M., Yuan, H., et al. (2015). Arabidopsis OR-eiwitten zijn de belangrijkste posttranscriptionele regulatoren van fytoeensynthase bij het beheersen van de biosynthese van carotenoïden. Proc. nat. Acad. Wetenschap. VS. 112 (11), 3558�. doi: 10.1073/pnas.1420831112

Zhou, D., Shen, Y., Zhou, P., Fatima, M., Lin, J., Yue, J., et al. (2019). Papaya CpbHLH1 / 2 reguleert carotenoïde biosynthese-gerelateerde genen tijdens het rijpen van papajafruit. Hortic Res. 6 (1), 80. doi: 10.1038/s41438-019-0162-2

Zhu, F., Luo, T., Liu, C., Wang, Y., Yang, H., Yang, W., et al. (2017a). Een R2R3-MYB-transcriptiefactor onderdrukt de transformatie van α- en β-takcarotenoïden door de expressie van CrBCH2 en CrNCED5 in flavedo van citrusreticulate negatief te reguleren. Nieuwe fytol. 216 (1), 178�. doi: 10.1111/nph.14684

Zhu, J. (2002). Zout en droogtestress signaaltransductie in planten. Ann. Rev. Plant Biol. 53 (1), 247�. doi: 10.1146/annurev.arplant.53.091401.143329

Zhu, L., Bu, Q., Xu, X., Paik, I., Huang, X., Hoecker, U., et al. (2015). CUL4 vormt een E3-ligase met COP1 en SPA om door licht geïnduceerde afbraak van PIF1 te bevorderen. nat. gemeenschappelijk 6, 7245. doi: 10.1038/ncomms8245

Zhu, M., Chen, G., Zhou, S., Tu, Y., Wang, Y., Dong, T., et al. (2014). Een nieuwe tomaten NAC (NAM/ATAF1/2/CUC2) transcriptiefactor, SlNAC4, functioneert als een positieve regulator van fruitrijping en carotenoïdenaccumulatie. Plantencel Fysiol. 55 (1), 119�. doi: 10.1093/pcp/pct162

Zhu, Q., Zeng, D., Yu, S., Cui, C., Li, J., Li, H., et al. (2018). Van gouden rijst tot aSTARice: bio-engineering van astaxanthine-biosynthese in rijst-endosperm. Mol. Plant 11 (12), 1440�. doi: 10.1016/j.molp.2018.09.007

Zhu, Z., Chen, G., Guo, X., Yin, W., Yu, X., Hu, J., et al. (2017b). Overexpressie van SIPRE2, een atypische bHLH-transcriptiefactor, beïnvloedt de plantmorfologie en de accumulatie van fruitpigment in tomaat. Wetenschap. vertegenwoordiger 7 (1), 5786. doi: 10.1038/s41598-017-04092-y

Zhu, Z., Li, G., Yan, C., Liu, L., Zhang, Q., Han, Z., et al. (2019). DRL1, die codeert voor een NAC-transcriptiefactor, is betrokken bij bladveroudering in wijnstokken. Int. J. Mol. Wetenschap. 20 (11), 2678. doi: 10.3390/ijms20112678

Trefwoorden: carotenoïde biosynthese, transcriptionele regulatie, fotosynthetisch weefsel, bloemen, vruchten, zaden, wortels

Visum: Stanley L en Yuan YW (2019) Transcriptionele regulering van carotenoïde biosynthese in planten: zoveel regelgevers, zo weinig consensus. Voorkant. Plant Sci. 10:1017. doi: 10.3389/fpls.2019.01017

Ontvangen: 17 mei 2019 Geaccepteerd: 22 juli 2019
Gepubliceerd: 09 augustus 2019.

Manuel Rodriguez-Concepcion, Centrum voor Onderzoek in Landbouwgenomica (CRAG), Spanje

Gianfranco Diretto, Energie en duurzame economische ontwikkeling (ENEA), Italië
Gabriela Toledo-Ortiz, Lancaster University, Verenigd Koninkrijk

Copyright © 2019 Stanley en Yuan. Dit is een open-access artikel dat wordt verspreid onder de voorwaarden van de Creative Commons Attribution License (CC BY). Gebruik, verspreiding of reproductie in andere fora is toegestaan, op voorwaarde dat de oorspronkelijke auteur(s) en de auteursrechthebbende(n) worden vermeld en dat de oorspronkelijke publicatie in dit tijdschrift wordt geciteerd, in overeenstemming met de aanvaarde academische praktijk. Geen enkel gebruik, verspreiding of reproductie is toegestaan ​​die niet in overeenstemming is met deze voorwaarden.


Bekijk de video: What is GIST? (Januari- 2022).