Informatie

Kan een reservoirgastheer als vector fungeren?


Is het mogelijk om een ​​infectie te krijgen door contact met een reservoirgastheer?

Kan een reservoirgastheer als vector fungeren?

Wat is het verschil tussen deze twee concepten (reservoirgastheer vs vector) ?


Een reservoirgastheer is het duidelijkst een langdurig dragerorganisme van een bepaald pathogeen dat: vertoont niet de ziekte veroorzaakt door de ziekteverwekker.

Een vector is letterlijk elke tussenpersoon die de ziekteverwekker overbrengt naar een ander organisme. Als je erover nadenkt, hoeft een reservoir geen vector te zijn, dwz er is geen transmissieroute waaraan ze deelnemen, maar een vector kan zeker een reservoir zijn, zoals vleermuizen, die vaak fungeren als een vector voor de ziekteverwekkers die ze huisvesten (denk aan hondsdolheid). Aan de andere kant zijn teken veelvoorkomende vectoren voor de ziekte van Lyme, maar kleine knaagdieren fungeren eigenlijk als reservoir voor B. burgdorferi (1).


Kan een reservoirgastheer als vector fungeren? - Biologie

SOORTEN GASTEN

Gastheren zijn de dieren die parasieten huisvesten. Ze zijn groter dan de parasieten. Verschillende soorten hosts zijn,

1. PRIMAIRE HOST: Het is de gastheer die het volwassen stadium of het geslachtsrijpe stadium van een parasiet herbergt of de gastheer waarin de parasiet seksuele voortplanting ondergaat.

bijv. Man is de primaire host voor Wuchereria bancrofti,

Vrouwelijke anopheles mug is de primaire gastheer voor Plasmdium vivax.

2.SECUNDAIRE GASTHEER: Is de gastheer die de zich ontwikkelende larvale of onvolgroeide of aseksuele stadia van een parasiet herbergt of de gastheer waarin de parasiet ongeslachtelijke voortplanting ondergaat.

bijv. Man is de secundaire host voor plasmodium vivax,

vrouwelijke culex mug is de secundaire gastheer voor Wuchereria bancrofti.

3.RESERVOIR-GASTHEER: Het is de gastheer die de infectieuze stadia van een paraiet in zijn lichaam onderbrengt wanneer de hoofdgastheer niet beschikbaar is. In de reservoirgastheer ondergaat de parasiet geen ontwikkeling en veroorzaakt hij ook geen ziekte.

bijv. Aap voor plasmodium,

Afrikaanse antilope voor Trypanosoma gambientie, enz.,

4.VECTOR: Vector is een organisme dat de infectieuze stadia van een parasiet van de ene hoofdgastheer naar de andere overbrengt.

Vectoren zijn van twee soorten, namelijk

EEN) MECHANISCHE VECTOR: Het is de vector die alleen de infectieuze stadia van een parasiet overdraagt, maar er vindt geen deel van de parasitaire ontwikkeling plaats.

bijv. Huisvliegen en kakkerlakken in het geval van Entamoeba.

B) BIOLOGISCHE VECTOR: Het is de vector waarin de parasiet een deel van de ontwikkeling doormaakt voordat hij naar een andere gastheer wordt overgebracht.


Inhoud

De grote diversiteit aan infectieuze pathogenen, hun mogelijke gastheren en de manieren waarop hun gastheren op infectie reageren, heeft geleid tot meerdere definities voor "natuurlijk reservoir", waarvan er vele tegenstrijdig of onvolledig zijn. In een conceptuele verkenning uit 2002, gepubliceerd in de CDC's, Opkomende infectieziekten, wordt het natuurlijke reservoir van een bepaald pathogeen gedefinieerd als "een of meer epidemiologisch verbonden populaties of omgevingen waarin het pathogeen permanent kan worden gehandhaafd en van waaruit infectie wordt overgedragen naar de gedefinieerde doelpopulatie." [2] De doelpopulatie is de populatie of soort waarin het pathogeen ziekte veroorzaakt, het is de populatie van belang omdat het aan een ziekte lijdt wanneer het door het pathogeen wordt geïnfecteerd (mensen zijn bijvoorbeeld de doelpopulatie in de meeste medische epidemiologische onderzoeken). [3]

Een algemeen criterium in andere definities onderscheidt reservoirs van niet-reservoirs door de mate waarin de geïnfecteerde gastheer ziektesymptomen vertoont. Volgens deze definities is een reservoir een gastheer die de ziektesymptomen niet ervaart wanneer deze door de ziekteverwekker wordt geïnfecteerd, terwijl niet-reservoirs symptomen van de ziekte vertonen. [4] De ziekteverwekker voedt, groeit en reproduceert nog steeds in een reservoirgastheer, maar heeft verder geen significante invloed op zijn gezondheid. de ziekteverwekker wordt als parasitair beschouwd.

Wat een reservoir voor een specifiek pathogeen verder definieert, is waar het kan worden onderhouden en van waaruit het kan worden overgedragen. Een "multi-host" organisme is in staat om meer dan één natuurlijk reservoir te hebben.

Natuurlijke reservoirs kunnen worden onderverdeeld in drie hoofdtypen: menselijk, dierlijk (niet-menselijk) en milieu. [1]

Menselijke reservoirs Bewerken

Menselijke reservoirs zijn mensen die besmet zijn met ziekteverwekkers die op of in het menselijk lichaam voorkomen. [1] Poliomyelitis en pokken komen uitsluitend voor in een menselijk reservoir. [5] Mensen kunnen fungeren als reservoirs voor seksueel overdraagbare aandoeningen, mazelen, bof, streptokokkeninfecties, verschillende respiratoire pathogenen en het pokkenvirus. [1]

Dierenreservoirs Bewerken

Dierlijke (niet-menselijke) reservoirs bestaan ​​uit gedomesticeerde en wilde dieren die besmet zijn met ziekteverwekkers. [1] [2] Bijvoorbeeld de bacterie Vibrio cholerae, dat bij mensen cholera veroorzaakt, heeft natuurlijke reservoirs in roeipootkreeftjes, zoöplankton en schaaldieren. Parasitaire bloedbotten van het geslacht Schistosoma, die verantwoordelijk zijn voor schistosomiasis, brengen een deel van hun leven door in zoetwaterslakken voordat ze hun levenscyclus in gewervelde gastheren voltooien. [7] Virussen van het taxon ebolavirus, die de Ebola-virusziekte veroorzaakt, wordt verondersteld een natuurlijk reservoir te hebben in vleermuizen of andere dieren die aan het virus zijn blootgesteld. [8] Andere zoönotische ziekten die van dieren op mensen zijn overgedragen, zijn: hondsdolheid, blastomycose, psittacose, trichinose, kattenkrabziekte, histoplasmose, coccidiomycose en salmonella. [9]

Gemeenschappelijke dierlijke reservoirs zijn onder meer: ​​vleermuizen, knaagdieren, koeien, varkens, schapen, varkens, konijnen, wasberen, honden en andere zoogdieren. [1]

Gemeenschappelijke dierlijke reservoirs

Vleermuizen Bewerken

Talrijke zoönotische ziekten zijn terug te voeren op vleermuizen. [10] Er zijn een paar theorieën die als mogelijke verklaring dienen waarom vleermuizen zoveel virussen bij zich dragen. Een voorgestelde theorie is dat er zoveel door vleermuizen overgedragen ziekten bestaan ​​omdat er een grote hoeveelheid vleermuissoorten en individuen bestaat. De tweede mogelijkheid is dat iets in de fysiologie van vleermuizen ze bijzonder goede reservoirgastheren maakt. [10] Misschien zijn de "voedselkeuzes, populatiestructuur, vliegvermogen, seizoensmigratie en dagelijkse bewegingspatronen, verdoving en winterslaap, levensduur en rustgedrag" van vleermuizen ervoor verantwoordelijk dat ze bijzonder geschikte reservoirgastheren zijn. [11] Lyssavirussen (inclusief het rabiësvirus), Henipavirussen, Menangle- en Tioman-virussen, SARS-CoV-achtige virussen en Ebola-virussen zijn allemaal terug te voeren op verschillende soorten vleermuizen. [11] Vooral fruitvleermuizen dienen als reservoirgastheer voor het Nipah-virus (NiV). [12]

Ratten Bewerken

Van ratten is bekend dat ze de reservoirgastheer zijn voor een aantal zoönotische ziekten. Noorse ratten bleken besmet met de spirocheten van de ziekte van Lyme. [13] In Mexico staan ​​ratten bekend als dragers van Trypanosoma cruzi, die de ziekte van Chagas veroorzaakt. [14]

Muizen Bewerken

Witvoetmuizen (Peromyscus leucopus) zijn een van de belangrijkste dierlijke reservoirs voor de spirocheet van de ziekte van Lyme (Borrelia burgdorferi). [15] Hertenmuizen dienen als reservoirgastheren voor het Sin Nombre-virus, dat het Hantavirus Pulmonary Syndrome (HPS) veroorzaakt. [16]

Apen Bewerken

Het zikavirus is afkomstig van apen in Afrika. In São José do Rio Preto en Belo Horizonte, Brazilië is het zikavirus gevonden bij dode apen. Genoomsequencing heeft onthuld dat het virus erg lijkt op het type dat mensen infecteert. [17]

Milieureservoirs Bewerken

Milieureservoirs omvatten levende en niet-levende reservoirs die besmettelijke ziekteverwekkers buiten de lichamen van dieren herbergen. Deze reservoirs kunnen zich op het land (planten en bodem), in het water of in de lucht bevinden. [1] Ziekteverwekkers die in deze reservoirs worden aangetroffen, leven soms vrij. de bacteriën Legionella pneumophila, een facultatieve intracellulaire parasiet die de veteranenziekte veroorzaakt, en Vibrio cholerae, dat cholera veroorzaakt, kan zowel voorkomen als vrijlevende parasieten in bepaalde waterbronnen als in ongewervelde dierlijke gastheren. [1] [18]

Een ziektereservoir fungeert als een overdrachtspunt tussen een pathogeen en een vatbare gastheer. [1] Verzending kan direct of indirect plaatsvinden.

Directe verzending Bewerken

Directe overdracht kan plaatsvinden door direct contact of directe druppelverspreiding. Directe contactoverdracht tussen twee mensen kan plaatsvinden door huidcontact, kussen en seksueel contact. Mensen die als ziektereservoirs dienen, kunnen symptomatisch zijn (die ziekte vertonen) of asymptomatisch (die geen ziekte vertonen), fungeren als ziektedragers en vaak ziekte verspreiden zonder het te weten. Menselijke dragers dragen vaak ziekten over omdat ze niet beseffen dat ze besmet zijn en daarom geen speciale voorzorgsmaatregelen nemen om overdracht te voorkomen. Symptomatische personen die zich bewust zijn van hun ziekte, hebben minder kans om infectie over te dragen omdat ze voorzorgsmaatregelen nemen om mogelijke overdracht van de ziekte te verminderen en/of behandeling zoeken om de verspreiding van de ziekte te voorkomen. [1] Directe druppelverspreiding is te wijten aan vaste deeltjes of vloeibare druppeltjes die enige tijd in de lucht zijn gesuspendeerd. Druppelverspreiding wordt beschouwd als de overdracht van de ziekteverwekker naar een gevoelige gastheer binnen een meter afstand, ze kunnen zich verspreiden door hoesten, niezen en praten.

  • Neisseria gonorrhoeae (Gonorroe) wordt overgedragen door seksueel contact met de penis, vagina, mond en anus via directe contactoverdracht.
  • Bordetella pertussis (Pertussis) wordt overgedragen door hoest van menselijk reservoir naar gevoelige gastheer via directe verspreiding van druppeltjes.

Indirecte transmissie Bewerken

Indirecte overdracht kan plaatsvinden door overdracht via de lucht, door voertuigen (inclusief fomites) en door vectoren.

Overdracht via de lucht verschilt van directe verspreiding van druppeltjes, omdat het wordt gedefinieerd als overdracht van ziekten die plaatsvindt over een afstand groter dan een meter. Ziekteverwekkers die via luchtbronnen kunnen worden overgedragen, worden gedragen door deeltjes zoals stof of opgedroogd residu (aangeduid als druppelkernen).

Voertuigen zoals voedsel, water, bloed en fomites kunnen fungeren als passieve transmissiepunten tussen reservoirs en gevoelige gastheren. Fomites zijn levenloze objecten (deurknoppen, medische apparatuur, enz.) Die besmet raken door een reservoirbron of iemand/iets dat een drager is. Een voertuig, zoals een reservoir, kan ook een gunstige omgeving zijn voor de groei van een infectieus agens, omdat contact met een voertuig leidt tot de overdracht ervan.

Vectoroverdracht vindt meestal plaats door insectenbeten van muggen, vliegen, vlooien en teken. Er zijn twee subcategorieën van vectoren: mechanisch (een insect brengt de ziekteverwekker over op een gastheer zonder dat het insect zelf wordt aangetast) en biologisch (reproductie van het pathogeen vindt plaats in de vector voordat het pathogeen naar een gastheer wordt overgedragen). Om een ​​paar voorbeelden te geven, Morbillivirus (mazelen) wordt overgedragen van een geïnfecteerde menselijke gastheer op een gevoelige gastheer, aangezien ze worden overgedragen door ademhaling via de lucht. Campylobacter (campylobacteriose) is een veel voorkomende bacteriële infectie die wordt verspreid vanuit menselijke of niet-menselijke reservoirs door voertuigen zoals besmet voedsel en water. Plasmodium falciparum (malaria) kan worden overgedragen van een geïnfecteerde mug, een dierlijk (niet-menselijk) reservoir, op een menselijke gastheer door biologische vectoroverdracht.


Controle van infectie

Praktische ziektebestrijding vereist antwoorden op twee vragen: 1) Kan een acceptabel niveau van bestrijding worden bereikt zonder rekening te houden met een reservoir? 2) Zo niet, uit welke populaties bestaat het reservoir? Gegeven een systeem met een doelreservoir, kan het beleid om infectie te beheersen elementen van drie zeer verschillende tactieken bevatten: 1) doelcontrole: het sturen van inspanningen binnen de doelpopulatie zonder verwijzing naar het reservoir (bijv. menselijke vaccinatie tegen gele koorts [23]) 2 ) blokkeringstactieken: het sturen van controle-inspanningen om de overdracht tussen bron- en doelpopulaties te blokkeren (bijv. Wildhekken om MKZV bij rundvee te bestrijden) en 3) reservoirbeheer: het beheersen van infectie in het reservoir (bijv. ruimingsprogramma's, vaccinatie of behandeling van reservoirs) . Deze drie benaderingen vereisen steeds meer begrip van de structuur en functie van reservoirs.

Doelcontrole heeft het belangrijke voordeel dat er geen kennis van potentieel complexe reservoirdynamica nodig is. Een volledig begrip van de infectiedynamiek in het reservoir is ook niet nodig om blokkerende tactieken te implementeren, hoewel het identificeren van bronpopulaties in het reservoir essentieel is. Hoe nauwkeuriger bronpopulaties kunnen worden geïdentificeerd en hoe meer kwantitatieve gegevens beschikbaar zijn over hun relatieve bijdrage aan transmissie, hoe efficiënter de toewijzing van middelen voor ziektebestrijding is. Reservoirbeheerstactieken vereisen een veel vollediger begrip van de structuur en transmissieprocessen die plaatsvinden in het reservoir. Het is bijvoorbeeld onwaarschijnlijk dat inspanningen gericht op het beheersen van infectie in niet-onderhoudscomponenten van een reservoir effectief zijn als infectie in de onderhoudscomponent van het reservoir ongecontroleerd blijft.

Het praktische probleem van het identificeren van reservoirs van hondsdolheid voor mensen in Zimbabwe biedt een nuttige illustratie van een aantal betrokken problemen. Na een stijging van de incidentie van jakhals en hondsdolheid in de jaren negentig, is het debat toegespitst op de vraag of jakhalzen (Canis adustus) zijn reservoirs van deze ziekte, een kwestie die belangrijke implicaties heeft voor het formuleren van nationale programma's voor de bestrijding van rabiës (10,11). In Zimbabwe zijn huishonden een onderhouds- en bronpopulatie van hondsdolheid voor mensen. Jakhalzen zijn echter verantwoordelijk voor 25% van alle bevestigde gevallen van hondsdolheid bij dieren en zijn ook een belangrijke bron van infectie voor mensen (10,11). Jakhalzen kunnen belangrijke componenten van het reservoir zijn als onderhouds- of niet-onderhoudspopulatie (Figuur 2). Omdat hondsdolheid kan worden gehandhaafd bij honden zonder jakhalzen, vormen jakhalzen geen essentiële samenstellende populatie van het reservoir. Maar kan infectie aanhouden bij jakhalzen zonder honden (Figuur 2B)? Jakhalzen kunnen deel uitmaken van een onderhoudsgemeenschap in combinatie met een verzameling andere wilde carnivoren (Figuur 2A). De vraag is belangrijk, want als honden de enige onderhoudspopulatie in het reservoir zijn, zouden effectieve vaccinatiecampagnes gericht op honden met succes menselijke hondsdolheid uit Zimbabwe moeten elimineren. Als jakhalzen echter een geheel of een deel van een onderhoudsgemeenschap vormen die onafhankelijk is van honden, zal het elimineren van hondsdolheid alleen succesvol zijn als jakhalshondsdolheid ook wordt bestreden (10,11). De recente hoge incidentie van rabiës van jakhals in Zimbabwe zou erop kunnen wijzen dat jakhalzen onderhoudspopulaties zijn. Een hoge incidentie van ziekte alleen is noch noodzakelijk noch voldoende bewijs voor deze bewering, vooral niet wanneer er grote schommelingen in de incidentie van ziekten optreden (zoals bij jakhals hondsdolheid). Wiskundige modellen suggereren dat jakhalzen waarschijnlijk geen infectie kunnen ondersteunen zonder frequente herintroductie van externe bronnen (24). Echter, Bingham et al. (11) stellen dat ruimtelijke patronen van cruciaal belang zijn en dat jakhalsepidemieën onafhankelijk van elkaar kunnen bestaan ​​in belangrijke geografische gebieden. Het probleem kan ondubbelzinnig worden opgelost door de implementatie van een massale vaccinatiecampagne voor honden, wat een logische eerste fase van een nationaal programma zou zijn. Als de hondsdolheid van jakhals aanhoudt zonder hondsdolheid, zal een effectief programma voor de eliminatie van hondsdolheid waarschijnlijk orale vaccinatie van jakhalzen omvatten.

Potentiële complexiteit van rabiësreservoirs in Zimbabwe. Als jakhalzen met (A) of zonder (B) andere wilde carnivoorpopulaties een onderhoudsgemeenschap vormen die onafhankelijk is van honden, dan zal vaccinatie van honden alleen niet leiden tot eliminatie van rabiës in het doelwit. Als jakhalzen geen onderhoudsgemeenschap vormen die onafhankelijk is van honden (C), dan moet vaccinatie tegen hondsdolheid rabiës uit het reservoir verwijderen (symbolen zoals in figuur 1).

Rabiës is ook een voorbeeld van de noodzaak om een ​​doelpopulatie te identificeren bij het definiëren van reservoirs. In de Serengeti-vlakte in Tanzania lijkt een aparte rabiësstam onafhankelijk in stand te worden gehouden in gevlekte hyena's, zonder ze enige klinische ziekte te veroorzaken, en zonder bewijs van overloopinfectie of ziekte die voorkomt bij andere soorten (binnen de grenzen van de huidige kennis) (25). Volgens onze definitie kunnen hyena's in de Serengeti niet worden beschouwd als een reservoir van hondsdolheid, tenzij deze stam wordt geïdentificeerd als de oorzaak van ziekte bij een andere soort (d.w.z. een doelpopulatie).


Kan een reservoirgastheer als vector fungeren? - Biologie

Ernstige koorts met trombocytopeniesyndroom (SFTS) is een opkomende hemorragische koorts in Oost-Azië die wordt veroorzaakt door het SFTS-virus (SFTSV), een nieuw ontdekt flebovirus. De Haemaphysalis longicornis teek is vermoedelijk de vector van SFTSV. Om te bepalen of SFTSV kan worden overgedragen tussen teken, van teken op dieren en van dieren op teken, hebben we transmissiestudies uitgevoerd tussen ontwikkelingsstadia van H. longicornis teken en tussen teken en muizen. Met behulp van reverse transcriptie PCR analyseerden we ook de prevalentie van SFTSV-infectie onder H. longicornis teken verzameld uit vegetatie in de provincie Shandong, China. Onze resultaten toonden een lage prevalentie van SFTSV onder verzamelde teken (0,2%, 8/3300 teken), en we toonden aan dat teken die gevoed werden met SFTSV-geïnfecteerde muizen het virus konden verwerven en het transstadiaal en transovariaal konden doorgeven aan andere ontwikkelingsstadia van teken. Bovendien kunnen met SFTSV geïnfecteerde teken het virus tijdens het voeren op muizen overbrengen. Onze bevindingen geven aan dat teken kunnen dienen als een vector en reservoir van SFTSV.

Ernstige koorts met trombocytopeniesyndroom (SFTS) is een opkomende hemorragische koorts veroorzaakt door SFTS-virus (SFTSV), een nieuw ontdekt flebovirus in de familie Bunyaviridae (1,2). SFTS werd in 2009 in China gemeld (1) en vervolgens in Korea en Japan (3,4). In China worden elk jaar ongeveer 1.000 SFTS-gevallen gemeld (5), waarbij het sterftecijfer 6,3%-12,0% is (1,5). SFTS-gevallen komen voor in landelijke gebieden van China, waar struiken, graslanden of beide zijn, en een hoge dichtheid van Haemaphysalis longicornis teken (1,69). Sinds de eerste ontdekking van SFTSV, overdracht van het virus door teken, vooral de H. longicornis aanvinken, is voorgesteld (1). Het is echter niet vastgesteld of SFTSV transstadiaal en transovariaal in teken kan worden overgedragen of dat teken SFTSV op dieren kunnen overbrengen. Om de mogelijkheid van een dergelijke overdracht te bepalen en om te bepalen of teken een reservoir voor SFTSV kunnen zijn, hebben we teken als een mogelijke vector onderzocht door de overdracht van SFTSV door teken te bepalen tijdens de ontwikkelingsstadia van teken en de overdracht van SFTSV op dieren.

Materialen en methodes

Verzameling van teken van vegetatie

In juni en juli 2013 hebben we teken (op zoek naar larven, nimfen en adulten) verzameld in Jiaonan County, provincie Shandong, China (119°30′–120°30′, 35°35′–36°08′), door te markeren over vegetatie met een 1 m 2 flanellen vlag. Tekenverzameling werd uitgevoerd gedurende 4 dagen gedurende de eerste week van elke maand tussen 10.00 en 12.00 uur en tussen 14.00 en 17.00 uur werden voor elke verzameling verschillende locaties gebruikt. De teken werden tot gebruik ingevroren bij -80°C. Tekensoorten en ontwikkelingsstadia werden morfologisch geïdentificeerd en de tekensoort werd moleculair bevestigd. Het gebruik van de dieren en het verzamelen van monsters werden goedgekeurd door de bio-ethische commissie van de School of Public Health, Shandong University.

Vink Nucleotide-extractie en identificatie door PCR . aan

Teken werden gegroepeerd volgens hun ontwikkelingsstadium, elke groep bevatte 40 larven, 20 nimfen of 5 volwassen teken. Het geslacht van de teken werd genegeerd. Teken in elke groep werden gehomogeniseerd met behulp van metalen kralen en Buffer RLT in een TissueLyser LT (beide van QIAGEN, Hilden, Duitsland). De totale nucleotiden (DNA en RNA) werden gelijktijdig geëxtraheerd met behulp van de AllPrep DNA/RNA Mini Kit (QIAGEN) volgens de instructies van de fabrikant. Twee larvale teken, 1 nimfenteek en 2 volwassen teken werden afzonderlijk verwerkt voor rRNA-extractie en PCR-amplificatie van het mitochondriale 16S-rRNA-gen van de teek. De teek mitochondriale 16S RNA-gen forward primer (5'-AGTATTTTGACTATACAAAGGTATTG-3') en reverse primer (5'-GTAGGATTTTAAAAGTTGAACAAACTT-3') werden in deze studie ontworpen met behulp van een eerder gepubliceerde sequentie (GenBank-toegangsnummer KC203361) als sjabloon. De PCR-cyclus bestond uit een initiële DNA-denaturatiestap bij 95°C gedurende 2 min 35 cycli van 30 s bij 92°C, 30 s bij 55°C en 45 s bij 72°C en een laatste verlengingsstap van 10 min bij 72 °C. Het PCR-product was 402 bp en werd op beide strengen gesequenced.

Detectie van SFTSV bij teken door PCR met omgekeerde transcriptie (RT-PCR)

Het geëxtraheerde SFTSV-RNA werd geamplificeerd met behulp van een eenstaps RT-PCR (Access RT-PCR System Kit, Promega, Madison, WI, VS) met primers afgeleid van het kleine RNA-segment van het virus. De RT-PCR-primers (CAGCCAGTTTACCCGAACAT en GAAAGACGCAAAGGAGT) en het PCR-protocol werden eerder beschreven (10). De eenstaps RT-PCR bestond uit 45 min bij 45°C en 2 min bij 94°C 40 cycli van 30 s bij 94°C, 1 min bij 60°C en 2 min bij 68°C en een laatste verlenging van 10 min bij 68°C. Het RT-PCR-product werd gebruikt als template voor een geneste PCR, die bestond uit een denatureringscyclus van 5 min bij 95°C, 30 cycli van 20 s bij 94°C, 30 s bij 56°C en 1 min bij 72° C en een laatste verlenging van 10 min bij 72 °C. Een negatieve controle met gesteriliseerd gedestilleerd water werd gelijktijdig uitgevoerd. Geneste PCR werd uitgevoerd met primers (5'-TGGCTCCGCGCATCTTCACA-3' en 5'-AGAGTGGTCCAGGATTGCTGTGG-3'), met behulp van het RT-PCR-product als sjabloon (11). Het geamplificeerde DNA werd onderworpen aan elektroforese op een 0,8% agarosegel en zichtbaar gemaakt onder ultraviolet licht. De gewenste DNA-band van 560 bp werd uit de gel gesneden en gezuiverd met behulp van de Gel Extraction Kit (QIAGEN). Het gezuiverde PCR-product werd gekloneerd in een pMD 19-T-vector (TaKaRa Bio Inc., Shiga, Japan), volgens de instructies van de fabrikant. Van positieve klonen werd de sequentie bepaald op beide strengen.

Fylogenetische analyse

De SFTSV-sequenties en teek mitochondriale 16S rRNA-gensequenties afgeleid van teeknucleotiden werden vergeleken met sequenties in GenBank met behulp van BLAST (//blast.ncbi.nlm.nih.gov/Blast.cgi). Fylogenetische bomen werden geconstrueerd met behulp van de buurman-joining-methode in MEGA5 (12), en de robuustheid van de bomen werd getest met behulp van 1.000 bootstrap-replicaties. De sequenties die in deze studie werden gegenereerd, werden gedeponeerd in GenBank (toegangsnummers KP300821, KR259990-KR25993 voor teken en KP197680-KP197687 voor SFTSV).

Oprichting van een tekenkolonie en experimenten met het voeren van transmissies

Een kolonie parthenogene H. longicornis teek werd vastgesteld in ons laboratorium. Aanvankelijk werden volwassen vrouwelijke teken verzameld uit vegetatie in een zak geplaatst die aan een konijnenoor was bevestigd om te voeden. Elke gezwollen teek mocht eieren leggen in een plastic buis. Ongeveer een halve legsel eieren van elke vrouwelijke teek werd gebruikt voor RNA-extractie en testen op SFTSV door RT-PCR. Larven mochten uitkomen uit de resterende halve legsels, en larven van een enkele teek die negatief was voor SFTSV door RT-PCR werden gebruikt voor alle volgende experimenten.

SFTSV-acquisitie en transmissievoeding werden uitgevoerd voor alle stadia van teken met behulp van Kunming-muizen (Shandong University Experimental Animal Center, Jinan City, China). Voor de experimenten werden teken in voedingscapsules geplaatst, die werden bereid uit de bovenkant van cryovials met schroefdop van 1 ml. Het bovenste deel van de buis onder de dop werd doorgesneden en de dop van de buis werd doorboord met behulp van een 26-gauge naald voor voldoende luchtuitwisseling. Muizen werden verdoofd door intraperitoneale injectie van 0,1 ml 10% chloraalhydraat. Haar op de rug van elke muis werd dicht bij de huid geknipt met behulp van een klein elektrisch scheerapparaat en een capsule werd op de rug bevestigd met Kamar-lijm (Kamar Products Inc., Zionsville, IN, VS). Om de capsule op zijn plaats te houden, werd een ronde lap stof (≈1 cm diameter) met een gat in het midden dat iets kleiner was dan de capsule (om toegang tot de capsule mogelijk te maken) over de capsule geplaatst en op de huid bevestigd met lijm. Een kraag van dun plastic werd rond het lichaam van de muis voor de capsule geplaatst om te voorkomen dat de muis de capsule tijdens het verzorgen zou verwijderen.

Een totaal van 50 larven, 15 nimfen of 1 volwassen teek werd in de capsule op elke muis geplaatst 24 uur nadat de capsule op de muis was aangebracht. Teken in de capsule werden dagelijks geobserveerd en verzameld na voltooiing van de voeding. Voor de virusverwervingsvoeding werd elke muis intraperitoneaal geïnoculeerd met DH82-cellen die 106 plaquevormende eenheden van SFTSV bevatten, en teken werden gedurende 3-8 dagen op de SFTSV-geïnfecteerde muizen gevoerd totdat ze vol waren. Voor het voeden met virustransmissie werden met SFTSV geïnfecteerde teken 3-8 dagen op niet-geïnfecteerde muizen gevoerd totdat ze volgezogen waren. We verzamelden bloedmonsters van elke muis 7, 14 en 21 dagen na het voeren van teken voor detectie van SFTSV. De SFTSV in de in het laboratorium gekweekte teken en in het muizenbloed werd gedetecteerd door RT-PCR met behulp van het primerpaar CAGCCACTTCACCCGAACAT en AAGGAAAGACGCAAAGGAG, dat in deze studie is ontworpen. De amplificatiecycli waren dezelfde als die hierboven beschreven voor de RT-PCR voor detectie van SFTSV in teken van vegetatie. Het PCR-product was 560 bp.

Detectie van SFTSV-RNA en antilichaam in bloed van muizen na tekenvoeding

Muizenbloedmonsters werden gedurende 3 weken wekelijks verzameld. Totaal RNA werd uit elk bloedmonster geëxtraheerd met behulp van de RNeasy Mini Kit (QIAGEN) en werd gebruikt als een sjabloon voor amplificatie (Access RT-PCR System Promega) van SFTSV. Primers voor RT-PCR en het PCR-protocol waren zoals beschreven in de voorgaande paragraaf. SFTSV-antilichaam werd getest door SFTSV-geïnfecteerde DH82-cellen als antigenen te gebruiken. De cellen werden gekweekt in een plaat met 96 putjes, gefixeerd met 4% paraformaldehyde en gebruikt als antigenen voor immunofluorescentietests (IFA's) om SFTSV-antilichamen te detecteren in serummonsters van muizen die gevoed werden door SFTSV-geïnfecteerde teken.

Resultaten

De prevalentie van SFTSV bij teken van vegetatie

Figuur 1. Fylogenetische analyse van mitochondriaal 16S rRNA-gen van teken verzameld in juni-juli 2014 uit Jiaonan County, provincie Shandong, China. De resultaten toonden aan dat de larvale, nimfen en volwassen teken (aangeduid met.

Figuur 2. Fylogenetische analyse van ernstige koorts met trombocytopeniesyndroomvirus (SFTSV) kleine segmentsequenties van teken verzameld in juni-juli 2014 uit Jiaonan County, provincie Shandong, China. Punten geven SFTSV-sequenties aan die zijn geamplificeerd van.

We verzamelden 3.300 teken uit vegetatie en identificeerden ze morfologisch als: H. longicornis teken, en moleculair de identificatie bevestigd door het mitochondriale 16S RNA-gen van vertegenwoordigers van larvale, nimfen en volwassen teken te sequencen (Figuur 1). Om SFTSV te detecteren, hebben we de teken samengevoegd op basis van hun ontwikkelingsstadium en elke pool getest op SFTSV-RNA door RT-PCR en geneste PCR. De prevalentie van SFTSV-infectie in elk stadium van de teek werd bepaald door de aanname dat een positieve pool van teken 1 SFTSV-geïnfecteerde teek bevatte. De prevalentie van SFTSV-infectie was 0,2% (8/3300) onder teken van alle stadia. De prevalentie van SFTSV-infectie was 0 bij 120 larven, 0,1% (2/1.620) bij nimfen en 0,4% (6/1.560) bij volwassen teken. Fylogenetische analyse toonde aan dat alle sequenties van SFTSV geamplificeerd uit teken waren geclusterd met SFTSV uit de provincie Shandong en andere plaatsen in China (Figuur 2). Deze resultaten suggereerden dat nimf- en volwassen teken geïnfecteerd waren met SFTSV, maar de mate van dragerschap was erg laag.

SFTSV-infectie van teken door verwerving en transovariale transmissie van SFTSV

Om te bepalen of teken door SFTSV kunnen worden geïnfecteerd, voerden we alle stadia (larven, nimfen en volwassenen) van H. longicornis teken op SFTSV-geïnfecteerde muizen. Bij het voederen van larven werden de gezwollen larven getest op SFTSV door RT-PCR voor of na het vervellen. Vijf larvale teken werden gegroepeerd als een pool voor RNA-extractie en RT-PCR-amplificatie van SFTSV. Het minimale infectiepercentage (ervan uitgaande dat een geïnfecteerde pool van teken 1 SFTSV-geïnfecteerde teek bevatte) was 18% (9/50) voor gezwollen larvenpools en 11,7% (14/120) voor vervelde nimfen (Tabel 1). Deze resultaten gaven aan dat larven SFTSV van geïnfecteerde muizen konden verwerven en SFTSV transstadiaal naar nimfen konden overbrengen.

Bij het voeden van nimfen werden 10 gezwollen nimfen afzonderlijk getest en ze bleken allemaal geïnfecteerd te zijn met SFTSV, maar slechts 20% (2/10) van de volwassen teken afkomstig van de nimfen was geïnfecteerd met SFTSV (tabel 1). Deze resultaten gaven aan dat nimfen SFTSV kunnen verwerven van geïnfecteerde muizen en SFTSV transstadiaal kunnen doorgeven aan volwassen teken.

Voor volwassen tekenacquisitievoeding werden niet-geïnfecteerde volwassen teken gevoed met SFTSV-geïnfecteerde muizen tot voltooiing van de voeding. Dertien volgezogen volwassen teken werden individueel getest op SFTSV, en 6 (46,2%) van hen waren geïnfecteerd met SFTSV, zoals bepaald met RT-PCR. Dertien volgezogen volwassen teken hadden hun eitjes gelegd en de larven kwamen uit. Larven afgeleid van elke teek werden als een groep getest op SFTSV-RNA door RT-PCR en 53,8% (7/13) van de larvale pools was geïnfecteerd met SFTSV (Tabel 1). De resultaten van deze experimenten gaven aan dat volwassen vrouwelijke teken transovarieel SFTSV konden overbrengen.

Vink Transmissie van SFTSV naar muizen aan

Om te bepalen of SFTSV door een tekenbeet op muizen kon worden overgedragen, voerden we met SFTSV geïnfecteerde nimfen en volwassenen op Kunming albino-muizen. Voor onderzoek naar de overdracht van SFTSV door nimfvoeding, werden 10 niet-geïnfecteerde muizen gevoed door 10 nimfen die waren verveld uit larven die zich voedden met SFTSV-geïnfecteerde muizen tot ze vol waren. Op 7, 14 en 21 dagen na de voeding werden bloedmonsters genomen van de muizen en onderzocht met RT-PCR om te detecteren dat SFTSV-viraal RNA werd gedetecteerd in 40% (4/10) van de muizen. Deze resultaten gaven aan dat nimfen SFTSV door middel van voeding aan muizen overdroegen.

Voor onderzoek naar de transmissie van SFTSV door volwassen teken als voeding, werden de volwassen teken verveld uit gezwollen nimfen die waren verkregen van de 10 hierboven genoemde muizen. Om te bepalen of SFTSV werd overgedragen van nimfen op volwassen teken en of volwassen teken SFTSV op muizen konden overbrengen, werden 20 volwassen teken individueel gevoerd op 20 naïeve muizen totdat ze vol waren. Op 7, 14 en 21 dagen na de voeding werden bloedmonsters genomen van de muizen en onderzocht met RT-PCR om te detecteren dat SFTSV-viraal RNA werd gedetecteerd in 10,0% (2/20) van de muizen op dag 7 en 14. Deze resultaten gaven aan dat de volwassen teken die in dit onderzoek werden gebruikt, in het larvale stadium waren geïnfecteerd door zich te voeden met SFTSV-geïnfecteerde muizen.

Figuur 3. Immunofluorescentietest detectie van ernstige koorts met trombocytopeniesyndroomvirus (SFTSV) antilichamen in serummonsters van muizen gevoed door SFTSV-geïnfecteerde teken. A) Normaal muizenserum (negatieve controle) dat reageert met SFTSV-geïnfecteerde DH82.

Met behulp van een IFA bepaalden we of SFTSV-antilichamen aanwezig waren in serummonsters van muizen die werden gevoed door nimfen en volwassen teken. Alle SFTSV RT-PCR-positieve muizenserummonsters waren ook positief volgens IFA bij verschillende titers (tabel 2, figuur 3), maar geen van de SFTSV RT-PCR-negatieve muizenmonsters was positief volgens IFA. De resultaten gaven aan dat larven SFTSV verkregen van geïnfecteerde muizen en het virus transstadiaal overdroegen aan nimfen en volwassen teken, en nimfen en volwassen teken brachten SFTSV over aan muizen tijdens het voeren.

Discussie

Van SFTSV wordt aangenomen dat het een door teken overgedragen virus is sinds het voor het eerst werd ontdekt omdat het werd gedetecteerd in teken verzameld van dieren (1). However, detection of a virus in feeding ticks collected from animals does not confirm that the tick is a vector or reservoir of the virus it is possible that ticks can acquire a virus from the blood of an infected animal but not maintain it transstadially and transmit it during feeding. Several studies have tried to demonstrate that ticks are a vector and reservoir of SFTSV (13,14). These studies either failed to detect SFTSV in a large quantity of ticks (n = 11,739) (13) or demonstrated very low prevalence of SFTSV in ticks collected from vegetation (14). A recent study from South Korea demonstrated that SFTSV was detected in all developmental stages of H. longicornis ticks, but the prevalence of infection was low in larvae (0.6% [2/350]) and nymphs (0.4% [38/10, 436]) (14). In this study, we demonstrated that the prevalence of SFTSV infection in ticks collected from vegetation is also low (0.2%). A recent study reported a slightly higher prevalence of SFTSV infection (2.2%) in H. longicornis ticks collected from vegetation from Shandong Province (15). The findings from these studies demonstrate that the prevalence of SFTSV infection in tick populations is very low. The reason for the low SFTSV infection rate in nature is not clear. It may be that SFTSV is detrimental to the infected tick and affects its survival. The low SFTSV prevalence in ticks suggests that ticks alone may not be sufficient to maintain SFTSV in nature circulation of SFTSV between the tick vector and mammalian amplifying hosts may be required for SFTSV maintenance in nature. In previous studies, we and others demonstrated that SFTSV can infect domesticated animals (goats, sheep, cattle, dogs, and chickens) (69) and wild small mammals (mice, rats, and Asian house shrews) (16). These animals may be amplifying hosts and ticks may be a vector and reservoir host of SFTSV.

This study and previous studies (15,17) demonstrated that H. longicornis is the predominant tick species in eastern China. H. longicornis ticks feed on domesticated and wild animals, including goats, sheep, cattle, pigs, deer, cats, dogs, rats, mice, hedgehogs, chickens, and other birds, as well as on humans (18). In rural China, domesticated animals, especially goats and dogs, often roam freely in the environment and maintain a high tick population around farm houses and may increase the risk of SFTSV infection in humans.

One limitation of this study is that a single species of tick was evaluated as a vector and reservoir of SFTSV. The virus has also been detected in Rhipicephalus microplus (voorheen Boophilus microplus), Amblyomma testudinarium, en Ixodes nipponensis ticks in China and South Korea (19,20). However, these ticks are not dominant ticks in eastern China, and whether these tick species play a role in the natural cycle of SFTSV needs to be further investigated. SFTSV has also been detected by RT-PCR in Leptotrombidium scutellare mites collected from Apodemus agrarius mice and from Laelaps echidnina mites collected from A. agrarius mice and goats in Jiangsu Province, China (21), and from the gadfly (species not defined) in the family Tabanidae in Henan Province, China (17). Other than ticks, the role of other bloodsucking insects as the vector and reservoir for SFTSV needs to be further investigated.

In this study, we demonstrated that H. longicorn ticks at each developmental stage acquired SFTSV during feeding on experimentally infected mice and transmitted SFTSV to mice during feeding. For acquisition feeding, the larval tick appeared to be less efficient than nymphal and adult ticks at acquiring SFTSV from infected mice. However, the difference between infection acquisition for larval ticks and for nymphal and adult ticks may be due to the manner in which we determined the prevalence of SFTSV infection among the different stages of ticks. For larval ticks, prevalence was determined on the basis of the minimum infection rate that was calculated by using pools of ticks for nymphal and adult ticks, prevalence was determined on the basis of the infection rate that was calculated by using individual ticks. The minimum infection rate may underestimate the true infection rate because a positive pool is counted for only 1 positive tick even though the pool may contain >1 positive tick. We also demonstrated that SFTSV can be transstadially transmitted from larvae to nymphal and adult ticks. However, we may have underestimated the efficiency of transstadial transmission in each tick developmental stage because a larval population fed on an infected mouse was used for transstadial transmission, and the larvae may have included SFTSV-infected and noninfected ticks.

In this study, tick acquisition of SFTSV and transstadial transmission of SFTSV were demonstrated by RT-PCR detection of SFTSV RNA in ticks and confirmed by IFA detection of antibodies to SFTSV in mice fed on by SFTSV-infected nymphal and adult ticks. However, transovarial transmission of SFTSV in ticks was demonstrated only by RT-PCR, which may need further confirmation by isolation of SFTSV from tick eggs or larvae or from mice fed on by hatched larvae or by detection of antibodies to SFTSV in mice fed on by hatched larvae.

In conclusion, all developmental stages of H. longicorn ticks can acquire SFTSV by feeding on experimentally infected mice, and the ticks can transmit SFTSV to mice during feeding. The virus can be passed transstadially and transovarially in the developmental stages of the tick. However, the prevalence of SFTSV infection among ticks collected from vegetation is quite low, suggesting that ticks alone (at least H. longicorn ticks) may not be sufficient to maintain the virus in nature.

Ms. Luo is a PhD student in the School of Public of Health, Shandong University. Her research interest is the epidemiology of tickborne infectious diseases.


From Vector To Zoonotic: A Glossary For Infectious Diseases

The world is in a hyperinfectious era. And that means there are a lot of words being tossed around that you might not be familiar with. Or maybe you have a general idea of what they mean but wish you knew more.

Here are some key terms and definitions. And yes, there will be a quiz (coming in March so you have time to study).

What Causes Pandemics? We Do

In this series, NPR explores the causes behind our new hyperinfectious era. Join the conversation with the hashtag #KillerViruses or tweet us @NPRGoatsAndSoda

Epidemic: A sudden increase in the number of cases of a disease in a particular geographic area, beyond the number health officials typically expect. An increase that occurs in a relatively small geographic area or among a small group of people may be called an "outbreak."

For example, the Centers for Disease Control and Prevention calls HIV/AIDS, which affects 1.2 million people in the United States, an "epidemic." By contrast, the CDC called two cases of sickness from drinking raw milk (listeriosis) in the United States an "outbreak."

Goats and Soda

MAP: Find Out What New Viruses Are Emerging In Your Backyard

Pandemic: An epidemic spanning many countries and/or several continents. The difference between an outbreak, an epidemic and a pandemic can be murky and depends on the opinions of scientists and health officials.

Emerging disease: A disease that occurs in the population of a certain geographic region for the first time, or a disease that's been present at low levels in a region but then rapidly reaches new peaks in the number of cases reported.

Animal-human interface: The points of contact between animals and humans — when people cut down forests and set up dwellings where forest animals are still prevalent, for example. Some types of diseases spread from animals to humans at this interface. (Note: In all these definitions "animal" refers to nonhuman animals.)

Germ History: Episode 1

VIDEO: When Humans Got Cozy, Germs Got Deadly

Germ History: Episode 2

VIDEO: From Measles To Syphilis, How We Created The Golden Age Of Germs

Reservoir: An animal, plant or environment in which a disease can persist for long periods of time. For example, some bats serve as a reservoir for rabies and can spread the disease by biting humans. But the bats — and other reservoir species — may not experience symptoms because of built-in immunity.

Germ History: Episode 3

Germ History: Milkmaids Inspire Vaccines, But The Germs Keep Coming

A disease reservoir is analogous to a water reservoir. But instead of supplying water, a disease reservoir serves as a supply for a virus or other pathogen.

Vector: Any living creature that can pass an infection to another living creature. Humans are technically vectors, but the term is more commonly applied to nonhuman organisms.

Spillover: The transmission of a disease from one species to another. Sometimes a disease may reside in a plant or animal or even in soil, and then spread to humans. This spread of disease is called a "spillover event."

Index case: The first case of a disease known to health officials. Some epidemiologists may refer to an index case as "patient zero."

Zoonotic: Any disease that spreads from animals to people. The animals can range from tiny ticks to lumbering cattle.

One Health: This two-word phrase embodies the view that there's no such thing as just human health or just animal health or just the health of the environment — they're all part of One Health. That's because the health of humans is closely linked to the health of the environment and other animals. Proponents of One Health believe medical doctors, ecologists, veterinarians and other specialists should work together to improve a community's health.

Microbe: A living thing too small for the eye to see, such as bacteria, fungi or viruses. Many microbes are harmless and may even benefit other living things. But some can cause disease among humans, other animals and plants. Microbes that cause disease are called "pathogens" and are informally referred to as "germs."

Epidemioloog Peter Krause of the Yale School of Public Health provided invaluable input for these definitions.

What do you want to know about pandemics? Share your questions by submitting them in our special tool here. Our global health team will answer some of them in an upcoming story.


Minor cultures as hosts for vectors of extensive crop diseases: Does Salvia sclarea act as a pathogen and vector reservoir for lavender decline?

Stolbur is a phytoplasma disease affecting crops worldwide. The planthopper Hyalesthes obsoletus is the main natural vector of ‘kandidaat Phytoplasma solani’ responsible of stolbur. In France, lavender (Lavandula angustifolia) and lavandin (Lavandula × intermedia) are strongly affected by this phytoplasma. These plant species are both hosts for the phytoplasma and its insect vector. In 2011, catches of adults were exceptionally sizable on one of the clones of lavandin most tolerant to lavender decline. A high population level of ‘Ca. P. solani’ vector was also observed on the adjacent plot of clary sage, Salvia sclarea. In order to clarify the potential role of S. sclarea as a host plant for H. obsoletus and ‘Ca. P. solani,’ we conducted field surveys and laboratory experiments. The uprooting of clary sage and root examination showed the presence of nymphs during winter. Harvested nymphs have been reared on S. sclarea from seedlings in a greenhouse for many generations. By performing its whole lifecycle on clary sage, we demonstrated for the first time that S. sclarea is a host plant of H. obsoletus and could be a source of stolbur vector. Nevertheless, status of clary sage as host plant of phytoplasma in the field up to now is not so clear. On 42 Q-PCR runs done on S. sclarea, 41 were negative to the phytoplasma, and one positive. Experimental transmission with infected H. obsoletus sampled on infected lavender showed that clary sage plant could be infected, expressed symptoms and multiplied ‘Ca. P. solani.’

Dit is een voorbeeld van abonnementsinhoud, toegang via uw instelling.


Reservoirs en dragers

For pathogens to persist over long periods of time they require reservoirs waar ze normaal verblijven. Reservoirs kunnen levende organismen of niet-levende locaties zijn. Niet-levende reservoirs kunnen bodem en water in de omgeving omvatten. Deze kunnen van nature het organisme herbergen omdat het in die omgeving kan groeien. Deze omgevingen kunnen ook besmet raken met ziekteverwekkers in menselijke uitwerpselen, ziekteverwekkers die worden uitgestoten door tussengastheren of ziekteverwekkers die zich in de overblijfselen van tussengastheren bevinden.

Ziekteverwekkers kunnen mechanismen van rust of veerkracht hebben waardoor ze kunnen overleven (maar meestal niet om zich voort te planten) gedurende verschillende perioden in niet-levende omgevingen. Bijvoorbeeld, Clostridium tetani overleeft in de bodem en in aanwezigheid van zuurstof als resistente endospore. Hoewel veel virussen snel worden vernietigd als ze eenmaal in contact komen met lucht, water of andere niet-fysiologische omstandigheden, kunnen bepaalde typen gedurende verschillende tijd buiten een levende cel blijven bestaan. For example, a study that looked at the ability of influenza viruses to infect a cell culture after varying amounts of time on a banknote showed survival times from 48 hours to 17 days, depending on how they were deposited on the banknote. [1] On the other hand, cold-causing rhinoviruses are somewhat fragile, typically surviving less than a day outside of physiological fluids.

Een mens die fungeert als reservoir van een ziekteverwekker kan al dan niet in staat zijn om de ziekteverwekker over te dragen, afhankelijk van het stadium van infectie en de ziekteverwekker. Om de verspreiding van ziekten onder schoolkinderen te helpen voorkomen, heeft de CDC richtlijnen ontwikkeld op basis van het risico van overdracht in de loop van de ziekte. Kinderen met waterpokken worden bijvoorbeeld vijf dagen vanaf het begin van de uitslag als besmettelijk beschouwd, terwijl kinderen met de meeste gastro-intestinale aandoeningen tot 24 uur na het verdwijnen van de symptomen thuis moeten worden gehouden.

Een persoon die een ziekteverwekker kan overbrengen zonder symptomen te vertonen, wordt een drager genoemd. EEN passive carrier is contaminated with the pathogen and can mechanically transmit it to another host however, a passive carrier is not infected. Een beroepsbeoefenaar in de gezondheidszorg die bijvoorbeeld zijn handen niet wast nadat hij een patiënt heeft gezien die een infectieus agens draagt, kan een passieve drager worden en de ziekteverwekker doorgeven aan een andere patiënt die geïnfecteerd raakt.

By contrast, an active carrier is an infected individual who can transmit the disease to others. Een actieve drager kan al dan niet tekenen of symptomen van infectie vertonen. For example, active carriers may transmit the disease during the incubation period (before they show signs and symptoms) or the period of convalescence (after symptoms have subsided). Active carriers who do not present signs or symptoms of disease despite infection are called asymptomatic carriers. Pathogens such as hepatitis B virus, herpes simplex virus, en HIV are frequently transmitted by asymptomatic carriers. Mary Mallon, better known as Typhoid Mary, is a famous historical example of an asymptomatic carrier. An Irish immigrant, Mallon worked as a cook for households in and around New York City between 1900 and 1915. In each household, the residents developed typhoid fever (caused by Salmonella typhi) een paar weken nadat Mallon begon te werken. Later onderzoek wees uit dat Mallon verantwoordelijk was voor ten minste 122 gevallen van buiktyfus, waarvan vijf met dodelijke afloop. [2] See “Typhoid Mary” in Bacterial Infections of the Gastrointestinal Tract for more about the Mallon case.

Een ziekteverwekker kan meer dan één levend reservoir hebben. Bij zoönotische ziekten fungeren dieren als reservoirs van ziekten bij de mens en brengen ze het infectieuze agens via direct of indirect contact over op de mens. In sommige gevallen treft de ziekte ook het dier, maar in andere gevallen is het dier asymptomatisch.

In parasitic infections, the parasite’s preferred host is called the definitive host. Bij parasieten met complexe levenscycli is de definitieve gastheer de gastheer waarin de parasiet geslachtsrijp wordt. Some parasites may also infect one or more intermediate hosts waarin de parasiet verschillende onvolwassen stadia van de levenscyclus doorloopt of zich ongeslachtelijk voortplant.

Denk er over na

  • List some nonliving reservoirs for pathogens.
  • Explain the difference between a passive carrier and an active carrier.

What is a Vector

A vector is a living organism, mostly an arthropod, that carries a disease-causing pathogen from one to another host. Basically, there can be two types of vector transmission. They are the mechanical and biological transmission. In the mechanical transmission, the vector that transmits the pathogen from one to another host is not infected by the pathogen. For example, flies that land on the faecal matter can come into contact with bacteria in the faeces . But later, they shed these bacteria to food when they land on it. Although these bacteria cause diseases, including diarrhoea , dysentery, etc. in humans, flies are not infected with bacteria.

Figuur 2: Anopheles stephensi – Malarial vector

Moreover, in biological transmission, the vector responsible for the transmission is also infected by the disease-causing pathogen. Generally, most arthropods that serve as vectors bite the host , producing a wound, which in turn facilitates the entry of the pathogen into the host. Moreover, the saliva of these arthropods contains infectious particles produced by the pathogen inside its gut. Thus, pathogens to be transmitted into the host spend a part of their reproductive life cycle inside the vector. Therefore, the vector serves as the intermediate host, and it transmits pathogens to the definitive host.

Furthermore, mosquitoes transmitting malaria, lice transmitting typhus, arachnids and ticks transmitting Lyme disease, mites transmitting scrub typhus, etc. are some examples of biological transmission of pathogens. Some mammals also serve as vectors by transmitting rabies to humans and chicken and other domestic poultry transmitting avian influenza to human.


How is NIAID addressing this critical topic?

NIAID conducts and supports a comprehensive vector biology research program to advance science and identify approaches that will help control or prevent the transmission of vector-borne pathogens to humans. This includes a variety of basic research projects that will contribute to a better understanding of key aspects of the biology of arthropod vectors. The program also supports translational and clinical research projects to identify and evaluate products and techniques designed to prevent the transmission of pathogens. These include the development of traps and repellents, the use of biologicals such as Wolbachia bacteria, and the evaluation of novel candidate vaccines based on mosquito saliva.


Bekijk de video: Boeren hebben genoeg gedaan! #Boerenprotest (November 2021).