Informatie

Waarom zijn sommige menselijke injecties intraperitoneaal?


Welk voordeel bieden intraperitoneale (IP) injecties (oude/goedkope rabiësvaccins of kankergerelateerde injecties) bij mensen ten opzichte van traditionele intramusculaire injecties?

Waar ik woon, wordt de hondsdolheid bijvoorbeeld niet meteen toegediend na een beet vanwege het bijbehorende ongemak (goedkope IP-injecties) of de kosten (nieuwere intramusculaire injecties) die ze vertegenwoordigen versus de lage kans dat een hond hondsdolheid heeft en de lange incubatietijd (in plaats daarvan wordt de aanstootgevende hond gedurende 10 dagen zorgvuldig geobserveerd om te beslissen, of de vaccins worden op de vierde dag toegediend als ze niet worden gevonden). Dus, aangezien snelheid van handelen geen belangrijke factor lijkt te zijn, wat zijn dan de voordelen van IP-injecties?


IP-injecties worden om verschillende redenen gebruikt:

  1. Het peritoneum biedt een groot oppervlak voor absorptie van het geneesmiddel (vergeleken met intramusculair (IM) of subcutaan); kan dus een groter vloeistofvolume injecteren.

  2. Makkelijker om dat intraveneus te injecteren.

  3. Voor sommige chemotherapieën, zoals eierstokkanker, wordt IP-injectie gebruikt om te proberen het medicijn in de buurt van de tumor te lokaliseren (het is via een katheter in plaats van met een spuit en naald). In wezen is het doel om chemotherapie te geven aan de buikstreek waar kanker zich heeft verspreid in plaats van systemisch.

Het wordt vaak gedaan bij dieren, zoals muizen, omdat het moeilijk is om een ​​ader te vinden in kleine wezens.

  • https://en.wikipedia.org/wiki/Intraperitoneale_injection
  • http://www.cancer.org/cancer/ovariancancer/detailedguide/ovariële-kankerbehandeling-chemotherapie
  • http://www.ncbi.nlm.nih.gov/pubmed/20156151 met dank aan @AMR
  • http://cpharm.vetmed.vt.edu/VM8314/Administration.htm

Wat maakt injecties moeilijk te slikken?

Een antropologische beoordeling van de verschillen tussen pillen en injecties kan enig licht werpen op de terughoudendheid van vaccins.

Als je naar een nieuwsshow kijkt of een tijdschriftartikel leest over aarzeling met vaccins, zou je programma kunnen worden afgewisseld met advertenties voor voorgeschreven medicijnen: verleidelijke advertenties van vrolijke, energieke mensen die verlichting beloven van alles, van artritis tot kanker in een laat stadium.

D e nevenschikking lijkt volkomen onlogisch: hoe ontwikkelden sommige mensen een gelijktijdige afwijzing van bepaalde medicijnen en een hartgrondige hartstocht voor anderen?

Als archeoloog ben ik gefascineerd door de diversiteit aan objecten die onze voorouders in de loop van miljoenen jaren hebben uitgevonden, inclusief objecten die mensen hebben gebruikt om stoffen in hun lichaam te introduceren. Dat omvat culinaire apparatuur die verband houdt met voedselproductie en de containers en uitrustingen voor medicijnen, verbeteringen, placebo's en recreatieve drugs. Deze objecten hebben een nauw verband met de menselijke perceptie van gezondheid en ziekte - een essentieel onderdeel van onze identiteit en dagelijkse routine, omringd door de alomtegenwoordige vraag: "Hoe gaat het?"

Mijn werk heeft me ertoe gebracht na te denken over de menselijke relatie met verschillende mechanismen van medische toediening, met name de pil en de injectie. Ze verschillen op zoveel belangrijke manieren: ons niveau van onafhankelijkheid bij het nemen ervan, ons niveau van comfort en, belangrijker nog, het beoogde doel van het medicijn voor genezing in het dringende heden of bescherming tegen een verre toekomst.

D e menselijke gretigheid om pillen te slikken, maar een onwil van sommigen om zich te laten vaccineren, heeft zeker veel te maken met moderne politiek en sociale factoren. Maar het heeft ook wortels diep in ons voorouderlijk verleden.

Op dit moment in de geschiedenis, terwijl de planeet een grootschalig vaccinatieprogramma onderneemt, lijkt het steeds belangrijker om deze verschillen te begrijpen en lessen uit het verleden te benutten naarmate we verder gaan naar de toekomst.

(HER)DENK MENSELIJK

Ontvang onze nieuwste verhalen elke vrijdag in je inbox.

H et gebruik van medicijnen kent een zeer lange geschiedenis. Archeologisch weten we dat het gebruik van geneeskrachtige planten lang voorafging aan de ontwikkeling van gedomesticeerde planten. De kennis van compounding gaat terug tot het allereerste gebruik van schrijven, toen recepten voor zowel ingenomen als actuele medicijnen enkele van de eerste dingen waren die schriftgeleerden op klei, bamboe en andere oppervlakken vastlegden.

Op een 3.600 jaar oude Egyptische papyrus staat bijvoorbeeld „Een recept om een ​​oude man in een jongere te veranderen”. De formule is vrij ingewikkeld en omvat grote hoeveelheden van iets dat wordt genoemd hemayet fruit dat wordt gekneusd, gedroogd, gezeefd, gemengd met water, gekookt, verdampt en opnieuw gedroogd, vervolgens opnieuw gehydrateerd in rivierwater, uitgespreid om in de zon te drogen en tot poeder vermalen.

Ö tzi, de reiziger uit het Kopertijdperk, wiens bevroren lichaam in 1991 in de Italiaanse Alpen werd gevonden, had in zijn tas twee stukken van Piptoporus betulinus, een beugelschimmel die een spoelende werking heeft tegen darmparasieten. (Uit zijn autopsie bleek dat hij last had van darmproblemen - zoals de meeste mensen destijds waarschijnlijk deden.)

Sommige medische praktijken van genezing gaan duizenden jaren terug. DEA-afbeeldingenbibliotheek/De Agostini/Getty Images

Terwijl de praktijk van het eten van geneeskrachtige stoffen waarschijnlijk al miljoenen jaren bestaat (zelfs niet-menselijke primaten zelfmedicatie), zijn injecties relatief nieuw. Projectielen zoals speren en kogels hebben een lange geschiedenis van het doorboren van de huid, maar voor doeleinden van schade.

Zelfs nadat mensen invasieve technieken ontwikkelden om te helpen in plaats van pijn te doen, waaronder acupunctuur, amputatie en trepanatie, was er nog steeds weinig ervaring met het gebruik van geweld om een ​​verbinding in het lichaam van een persoon in te brengen met het contra-intuïtieve doel om hun gezondheid te verbeteren. Tatoeëren is een voorbeeld: er zijn aanwijzingen dat millennia-oude inheemse tattoo-praktijken gedeeltelijk werden gebruikt om therapeutische verbindingen te introduceren. Het idee om iemand te inenten met sporen van een ziekte om hen te beschermen, lijkt terug te gaan tot vóór de 16e eeuw in het Ottomaanse rijk. In Europa werd in 1796 het eerste vaccin tegen pokken ontwikkeld. De eerste injectiespuit dateert pas uit de jaren 1850.

Angst voor naalden kan zo oud zijn als naalden zelf en blijft een probleem, zelfs voor diegenen die regelmatig zelf-toegediende injecties nodig hebben voor hun gezondheid, zoals bij mensen met diabetes.

Evenzo was onze lange medicinale geschiedenis voornamelijk gericht op de kwalen van het hier en nu. Hoewel er een relatief lange geschiedenis is van preventieve geneeskunde die duizenden jaren teruggaat (bijvoorbeeld in China, India en het oude Griekenland), waren onze voorouders zeker meer bezig met actuele ziekten en verwondingen dan met toekomstig welzijn. Mensen tot ver in de 19e eeuw werden geconfronteerd met eeuwige dood en gevaar als zeer reële wolven aan de deur. Er was al veel pijn en ongemak. De gedachte om in het heden nog meer pijn toe te voegen aan een gezond persoon om een ​​mogelijke toekomstige catastrofe te voorkomen, zou zeker weinig zin hebben gehad.

Een vaccin wordt, contra-intuïtief, ingenomen als je gezond bent. U aanvaardt een fysieke pijn (een knijp in de arm gevolgd door bijwerkingen die kunnen variëren van mild tot ernstig) tegen een onbekende toekomstige winst (een grote statistische kans op bescherming tegen een dodelijke ziekte). Deze afweging betekent dat vaccins zich voegen bij andere dingen die goed voor ons zijn en waar we niet van genieten en vaak niet doen, zoals flossen of sparen voor pensioen.

Een vaccin wordt, contra-intuïtief, ingenomen als je gezond bent.

Inderdaad, de uitdagingen van het bedenken van toekomstige voordelen kunnen een cruciaal onderdeel zijn van het menselijke verhaal. Menselijke cognitieve twijfels over betaal-nu/play-later-activiteiten vormen de kern van veel van onze hedendaagse raadsels over gezondheid, economie, onderwijs en klimaatverandering.

Een laatste belangrijk onderscheid tussen medische toepassingen is het begrip autonomie. Of het nu gaat om het doorslikken van een tablet, het drinken van een drankje of het smeren van een pleister op uw arm, de doe-het-zelf-aanpak lijkt populair te zijn: ziekenhuisonderzoeken tonen aan dat patiënten liever zelf de leiding hebben over hun medicatie.

Daarentegen worden injecties meestal aan u gegeven door een professionele "ander" die speciale apparatuur en training heeft. Het zijn invasieve procedures, uitgevoerd in commerciële of institutionele omgevingen die eerder klinisch en koud dan geruststellend kunnen aanvoelen. Het is opmerkelijk dat als het gaat om hormonale anticonceptie voor vrouwen, pillen populairder zijn dan injecties, ook al gaan de laatste langer mee en kunnen mensen voorkomen dat ze een dagelijkse pil moeten onthouden.

Pillen zijn misschien wel de ultieme moderne manifestatie van de praktijk van zelfbehandeling. Terwijl u een pil inneemt, kunt u de effecten van het slikken voelen en kunt u de impact vaak binnen enkele uren of minder meten. Zelfs als de effecten langdurig of onmerkbaar zijn, is de psychologische impact van het nemen van een pil (zelfs als het een placebo is) aanzienlijk. Geneesmiddelenfabrikanten hebben geleerd alles over pillen te gebruiken, inclusief hun vorm, grootte en kleur, om het maximale gewenste effect te produceren. Adverteerders weten wat ze doen: ze geven mensen het gevoel dat ze door het nemen van specifieke medicijnen net zo zullen zijn als de levendige mensen die ze op tv zagen.

D e komst van wat de 'moderne' geneeskunde wordt genoemd, is waarschijnlijk pas in de laatste zes menselijke generaties ervaren. Het is niet verwonderlijk dat onze soort nog steeds in het reine komt met verhalen over gezondheid die betrekking hebben op preventieve technologieën die via invasieve middelen worden geleverd.

Maar wat als vaccins en andere injecties opnieuw werden bedacht om het proces meer op het nemen van pillen te laten lijken?

Smaak, visuals en geherformuleerde toedieningsmechanismen kunnen belangrijke elementen zijn om te onderzoeken om medicamenteuze behandeling acceptabeler te maken voor de diepgewortelde menselijke psychologie. Kleine dingen kunnen het verschil maken. De visuele aanmoediging van vaccins is bijvoorbeeld subtiel gecodeerd in Apple's onlangs aangekondigde herontwerp van de injectiespuit-emoji om de potentieel intimiderende bloeddruppels die deel uitmaakten van de afbeelding te verwijderen.

Sommige vaccins zijn geëvolueerd van injecties naar pillen, zoals dit middel tegen tyfus. K/Wikimedia Commons

Anderen werken eraan om geïnjecteerde medicijnen, waar mogelijk, over te hevelen naar andere toedieningssystemen, gedeeltelijk om ze acceptabeler te maken. Het tyfusvaccin is nu algemeen verkrijgbaar in pilvorm, het seizoensgriepvaccin kan als neusspray worden toegediend. Onderzoekers hebben zelfvaccinatiepleisters ontwikkeld met micronaalden die te klein zijn om te voelen dat een onderzoek suggereerde dat het aantal mensen dat bereid was om een ​​seizoensgriepvaccin te krijgen, met deze technologie steeg van 46 procent naar 65 procent. Onderzoekers, waaronder de bio-ingenieur Emrullah Korkmaz van de Universiteit van Pittsburgh, onderzoeken deze mogelijkheid ook al voor COVID-19-vaccins.

Ongetwijfeld zullen toekomstige medische behandelingen ons verlangen naar autonomie in preventieve en curatieve geneeskunde blijven beantwoorden, net zoals we zelfbeschikking koesteren bij andere fysieke activiteiten zoals lichaamsbeweging, voeding en seks. Met een beetje extra antropologisch nadenken, zien we misschien een tijd waarin injecties deel uitmaken van de archeologie van de geneeskunde, met naalden die naar de vuilnisbak van de geschiedenis worden verwezen.


Modellen om leverregeneratie te bestuderen

Michele T. Pritchard, Udayan Apte, in leverregeneratie, 2015

2.2.2.1.1 d -Galactosamine: hepatische regeneratieve respons

Niet-dodelijke GalN-doses moeten worden gebruikt om leverregeneratie te bestuderen. Terwijl één onderzoek de afwezigheid van letaliteit tot 1 g/kg GalN bij ratten aantoonde, gebruiken aanvullende onderzoeken veel minder GalN in het bereik van 200-400 mg/kg als enkelvoudige doses of meervoudige doses tot 1 g/kg of meer om leverregeneratieve antwoord. Bij deze doses neemt de leverbeschadiging, beoordeeld door histologie en biochemische metingen, toe 24 uur na blootstelling aan GalN. Necrotische cellen zijn verspreid over het parenchym, maar komen vaker voor in het pericentrale gebied [20]. Indicaties van levercelproliferatie beginnen na 48 uur, maar verlengen 72-96 uur na GalN. Hepatocytproliferatie draagt ​​bij aan leverregeneratie na GalN, maar de bijdrage van HPC (d.w.z. ovale cellen) kan niet worden genegeerd, vooral wanneer hogere doses of meerdere doses [24] van GalN worden gebruikt. LacZ-onderzoeken naar het labelen van hepatocyten lieten zien dat proliferatie van hepatocyten al 24 uur na blootstelling aan GalN plaatsvindt. In hooggedoseerde GalN-onderzoeken nemen HPC-aantallen echter 48-96 uur toe na 750 mg/kg GalN en lijken ze een overheersende rol te spelen bij leverregeneratie [24].

Het is interessant op te merken dat actief prolifererende hepatocyten, zoals die gevonden worden bij neonatale ratten (5 dagen oud), ongevoelig zijn voor GalN-gemedieerde hepatocytdood, terwijl volwassen ratten (5 maanden oud) dat niet zijn [25]. Na intraperitoneale injectie van 400 mg/kg GalN vertoonden volwassen ratten uitputting van uracil-nucleotiden en glycogeen. Piekplasma-alanine en aspartaataminotransferase (ALT en AST) worden 24 uur na blootstelling aan GalN waargenomen en na 48 uur piekt de leverregeneratieve respons (gemeten door 3H-thymidine-opname) 48 uur na GalN en wordt daarna verminderd. Daarentegen worden neonatale ratten beschermd tegen de metabole en hepatotoxische verstoringen van blootstelling aan GalN [25]. Dus hoewel deze studie zeker aantoont dat hepatocyt-gemedieerde leverregeneratie mogelijk is bij volwassen ratten, is een gunstig effect van aanhoudende proliferatie van hepatocyten duidelijk een voordeel voor de uitkomst van blootstelling aan hepatotoxine. Vergelijkbare bevindingen met betrekking tot het hepatoprotectieve effect van hepatocytproliferatie tot daaropvolgende blootstelling aan toxine worden waargenomen in aanvullende modellen van toxische leverbeschadiging [26-29].


Botulinetoxine Werkingsmechanisme

Het werkingsmechanisme van botulismetoxine zou vroeger alleen de motorische zenuwen aantasten. Toch worden Botox-injecties ook met succes gebruikt om neuropathische pijn te behandelen. Verder onderzoek toont aan dat dit toxine ook de afgifte van neurotransmitters in sensorische zenuwen remt.

Een andere ontdekking die onlangs aan het licht is gekomen, is dat Botox de bloed-hersenbarrière kan passeren, zij het in kleine hoeveelheden. Een kleine studie bij vrouwen die ongereguleerde doses Botox kregen van niet-geregistreerde cosmetische klinieken, toonde aan dat dit toxine toegang kan krijgen tot het limbische systeem van de hersenen.

Om het werkingsmechanisme van BoNT te begrijpen, moeten we eerst kijken naar de neurotransmitter acetylcholine en de zenuwsynaps.

Acetylcholine

Acetylcholine (ACh) is de belangrijkste neurotransmitter van het (autonome) parasympathische zenuwstelsel en van (somatische) motorische zenuwen die aansluiten op de skeletspier. Het wordt ook aangetroffen in sommige sympathische zenuwen, waardoor we zweet produceren en adrenaline afscheiden, en in sommige interneuronen van het centrale zenuwstelsel, inclusief het limbische systeem.

Eerst moet acetylcholine worden geproduceerd. Het wordt gesynthetiseerd uit choline en acetyl-CoA en vereist calciumionen en een enzym genaamd choline-acetyltransferase (CAT) om deze twee ingrediënten om te zetten in ACh. Het grootste deel van het eindproduct wordt opgeslagen in blaasjes aan het zenuwuiteinde.

Zenuw synaps

Om van de ene zenuw naar de andere te gaan, of van een zenuw naar een andere cel (zoals een spiervezel of zweetkliercel), moet ACh een opening oversteken - de synaps. Wanneer acetylcholine de werkende boodschapper is, wordt deze synaps een cholinerge synaps genoemd.

Blaasjes die ACh bevatten, moeten naar het buitenmembraan van het zenuwuiteinde gaan. Eenmaal daar versmelten ze met het membraan en legen ze hun inhoud in de opening (de cholinerge synaps). Acetylcholine beweegt door deze opening en komt aan de andere kant waar het een reactie van de volgende cel kan stimuleren.

Om ACh af te geven, heeft een zenuwcel calciumionen nodig en een speciale keten van transporteiwitten, een SNARE-complex genaamd. Het SNARE-complex helpt het blaasje te versmelten met het membraan. Het is op dit punt dat alle soorten botulinumtoxinen interfereren.

Aan de andere kant van de synaps ligt het doelcelmembraan. Om beïnvloed te worden door het vrijgekomen acetylcholine, hebben deze doelcelmembranen ACh-receptoren nodig.

Er zijn twee soorten receptoren: nicotine en muscarine. De meeste spiercellen (behalve hart- en sommige gladde spiercellen) hebben nicotinereceptoren.

Als acetylcholine bindt met een muscarinereceptor, prikkelt het de doelcel. Spieren trekken samen en zweetklieren worden gestimuleerd - dit effect is snel en kortwerkend.

Echter, de binding van ACh aan nicotine receptoren produceert relatief lange termijn remmende of prikkelende effecten.

Zodra de acetylcholine de boodschap heeft doorgegeven, wordt deze afgebroken door een enzym dat acetylcholinesterase wordt genoemd. Als u een meer gedetailleerd beeld wilt hebben van het werkingsmechanisme van acetylcholine, neem dan een kijkje op deze pagina.

BoNT's en SNARE's

Als iemand een botulinumtoxine-injectie krijgt, binden de giftige eiwitten zich aan gevonden moleculen enkel en alleen op cholinerge zenuwuiteinden en gaan de cel binnen.

Eenmaal daar binden ze stevig aan een of meer van de eiwitten van het SNARE-complex. Dit voorkomt (remt) dat acetylcholine de cholinerge synaps passeert en de doelcel bereikt.

In de onderstaande afbeelding kunt u zien hoe synaptobrevine verbinding maakt met het ronde blaasje en het naar het terminale membraan leidt. Syntaxin- en SNAP-25-eiwitten helpen de membranen te fuseren en zo de inhoud uit het neuron te laten ontsnappen.

Synaptobrevin is een met blaasjes geassocieerd SNARE-eiwit (v-SNARE). Doelcel-geassocieerde SNARE-eiwitten zijn syntaxine en SNAP-25 dit zijn t-SNARE's. Alle drie leveren ze de nodige energie om membraanfusie aan te drijven.

Botulinumtoxine type A en type E (BoNT/A en BoNT/E) blokkeren SNAP-25-actie. Deze toxines beïnvloeden verschillende delen van de SNAP-25-structuur.

Botulinumtoxine typen B, D, F en G beïnvloeden de werking van synaptobrevine op verschillende punten.

BoNT/C werkt op zowel SNAP-25 als syntaxine.

Een ander verschil in botulinumtoxinetypes is hun vorm. De meeste zijn samengesteld uit twee enkele aminozuurketens (di-ketens). Alleen BoNT/E is een enkelketenig toxine, het is toevallig het meest dodelijke - ongeveer honderd keer giftiger dan tweeketenige structuren.

Botox blijft tot drie maanden werken.

Botox versus Black Widow Spider-vergiftiging

Terwijl botulinumtoxine voorkomt dat acetylcholine de synaps passeert, heeft spingif van zwarte weduwe het tegenovergestelde effect: deze toxines produceren tegenovergestelde effecten. Meer serieuze zwarte weduwespin (sp. Latrodectus) beten veroorzaken een reeks symptomen die worden gegroepeerd onder de term latrodectisme.

Het spintoxine laat meer calciumionen toe in het neuronuiteinde en dit zorgt ervoor dat allerlei soorten neurotransmitters door de synaps stromen. Symptomen van latrodectisme zijn onder meer hevig zweten (excitatie van de zweetklieren), snelle pols (excitatie van de bijnieren), spierstijfheid en pijn (excitatie/samentrekking van de spieren).

Botulinumtoxine-effecten zijn het tegenovergestelde. Het stoppen van ACh-overdracht naar de doelcel betekent de afwezigheid van zweten (remming van de zweetklieren), langzame pols (remming van de bijnieren) en zachtere spiertonus (remming/ontspanning van de spieren).


RESULTATEN

Effect van pU2-plasmide op uPA- en uPAR-mRNA-niveaus in totale celextracten

Totaal RNA werd geïsoleerd uit controlecellen en cellen die waren getransfecteerd met lege vector (EV), gecodeerde vector (SV), puPAR, puPA en pU2. RNA werd ook geïsoleerd uit cellen die waren getransfecteerd met antisense-expressievectoren voor uPAR en uPA, en uit cellen die waren getransfecteerd met plasmidevector die siRNA-targeting GFP tot expressie bracht. RT-PCR werd uitgevoerd volgens het standaardprotocol voor uPAR en uPA. Om te bepalen of deze siRNA tot expressie brengende plasmiden een interferonrespons induceren, werd RT-PCR voor OAS1 uitgevoerd. Als positieve controle werden cellen behandeld met interferon α (0,5 ng/ml) om OAS1-mRNA-expressie zichtbaar te maken. Figuur 2A toont RT-PCR-analyse van totaal RNA geïsoleerd uit cellen die zijn behandeld met interferon α, controle, antisense uPAR (asuPAR), antisense uPA (asuPA) en siRNA tot expressie brengende vectoren voor uPAR (puPAR), uPA (puPA) en beide upAR en uPA (pU2). Als RNAi-controles werd siRNA gericht op GFP gebruikt in niet-GFP-cellen, lege vector (pEV) en gecodeerde vector (pSV). RT-PCR voor GAPDH diende als interne controle. Met interferon behandelde cellen vertoonden geen verandering in de expressieniveaus van uPA of uPAR, OAS1-inductie werd waargenomen en diende als controle voor OAS1 RT-PCR. Controle-, pGFP-, pEV- en pSV-behandelde cellen vertoonden geen veranderingen in uPAR- of uPA-expressie en er werden geen detecteerbare niveaus van OAS1 waargenomen. Antisense voor uPAR en uPA vertoonde geen verandering in de mRNA-niveaus van uPAR of uPA, terwijl de eiwitniveaus een afname van 20�% lieten zien (niet getoond). Cellen die met puPAR waren behandeld, vertoonden een afname van 20% in uPA-expressie en een afname van 50% in uPAR-expressie. Cellen behandeld met puPA vertoonden geen merkbare verandering in uPAR-expressieniveaus, terwijl uPA-niveaus een afname van 30�% vertoonden. Met pU2 behandelde cellen vertoonden een afname van 75% in uPAR-mRNA-niveaus en 60% afname in uPA-mRNA-niveaus. GAPDH-niveaus veranderden niet en dienden als controles.

Totaal RNA werd geïsoleerd uit controlecellen en cellen die waren getransfecteerd met lege vector (EV), gecodeerde vector (SV), puPAR, puPA of pU2. RNA werd ook geïsoleerd uit cellen die waren getransfecteerd met antisense-expressievectoren voor uPAR en uPA, en uit cellen die waren getransfecteerd met een plasmidevector die siRNA voor GFP tot expressie bracht. RT-PCR werd uitgevoerd volgens standaardprotocol voor uPAR en uPA. Om te bepalen of deze siRNA tot expressie brengende plasmiden een interferonrespons induceren, werd RT-PCR voor OAS1 uitgevoerd. Als positieve controle werden cellen ook behandeld met interferon-alfa (0,5 ng/ml) om OAS1-mRNA-expressie zichtbaar te maken (Fig. 2A). SNB19-cellen werden getransfecteerd met mock, EV/SV, puPA, puPAR of pU2. Na 48 uur werden cellen verzameld en werden totale cellysaten bereid in extractiebuffer die Tris [0,1 M (pH 7,5)], Triton-X114 (1,0%), EDTA (10 mΜ), aprotinine en fenylmethylsulfonylfluoride bevat, zoals beschreven eerder. Vervolgens werd 20 ug eiwit uit deze monsters onder niet-reducerende omstandigheden gescheiden door 12% SDS-PAGE en overgebracht naar nitrocellulosemembranen (Schleicher & Schuell, Keene, NH). De membranen werden gedurende 2 uur onderzocht met antilichamen tegen uPAR (Fig. 2B). De membranen werden vervolgens driemaal gewassen met PBS om overmaat primair antilichaam te verwijderen, indien nodig geïncubeerd met een secundair antilichaam en vervolgens ontwikkeld volgens standaardprotocol. Voor controle van de lading werden de membranen gestript en onderzocht met monoklonale antilichamen voor GAPDH. De enzymatische activiteit en het molecuulgewicht van elektroforetisch gescheiden vormen van uPA werden bepaald uit de geconditioneerde media van SNB19-cellen die waren getransfecteerd met mock, EV/SV, puPA, puPAR of pU2 door SDS-PAGE zoals eerder beschreven (Fig. 2B). Western-blot-analyse werd ook uitgevoerd met gebruikmaking van cellysaten van 4910 EGFR tot overexpressie brengende 4910-xenotransplantaatcellen die waren getransfecteerd met mock, EV/SV, puPA, puPAR of pU2. Western-blots werden immunologisch onderzocht op EGFR en VEGF volgens standaardprotocollen (Fig. 2C).

Effect van pU2 op uPA- en uPAR-enzymatische activiteit in SNB19-cellen en EGFR- en VEGF-eiwitniveaus in 4910 xenotransplantaatcellen

RNAi gericht tegen proteolytische afbraak kan een belangrijke interventie zijn om invasie van kankercellen te voorkomen. Van uPA en uPAR is aangetoond dat ze een belangrijke rol spelen bij ECM-degradatie. Zoals aangetoond door western blotting, remde transfectie van SNB19-cellen met een vector die siRNA tot expressie brengt voor uPAR en uPA (pU2) sterk de eiwitexpressie van uPAR-niveaus in vergelijking met schijn- en lege vector (EV)/gecodeerde vector (SV)-getransfecteerde cellen ( Afb. 2B). Fibrine-zymografie onthulde dat uPA-enzymatische activiteit significant afnam in SNB19-cellen die waren getransfecteerd met puPAR, puPA en pU2 in vergelijking met schijntransfectie en EV/SV-transfectie (Fig. 2B). GAPDH-eiwitniveaus dienden als een laadcontrole (Fig. 2B). Kwantitatieve analyse van uPAR- en uPA-banden door densitometrie onthulde een significante (Pπ.001) afname in uPAR-eiwit (13- tot 16-voudig) en uPA-enzymatische activiteit (10- tot 12-voudig) in pU2-getransfecteerde cellen in vergelijking om te bespotten en EV/SV-getransfecteerde cellen. Cellen getransfecteerd met puPAR en puPA remden uPAR- en uPA-niveaus op bijna dezelfde manier als pU2, maar de neerwaartse regulatie van de doelmoleculen was veel meer uitgesproken met het bicistronische construct in vergelijking met elk van de enkelvoudige constructen. 4910 xenotransplantaatcellen vertoonden vergelijkbare neerwaartse regulatie van uPA en uPAR als SNB19-cellen (gegevens niet getoond). Omdat EGFR-niveaus tot overexpressie worden gebracht in 4910 cellen, hebben we het effect van pU2-transfectie bepaald. Gelijktijdige neerwaartse regulatie van uPAR en uPA verlaagde de EGFR-niveaus in 4910 cellen met een factor 15, terwijl de VEGF-niveaus 5 keer afnamen (Figuur 2C). GAPDH-niveaus veranderden niet en dienden als laadcontrole. ter plaatse niveaus van VEGF en EGFR werden ook bepaald en die resultaten correleerden met Western-blot-analyse (Figuur 3A).

Om VEGF- en EGFR-expressie te visualiseren in 4910-cellen die EGFR tot overexpressie brengen, werden 1휐 4-cellen gezaaid op met vitronectine beklede glaasjes met 8 putjes, 24 uur geïncubeerd en getransfecteerd met nep, lege vector (EV) en een vector die siRNA tot expressie brengt voor uPAR (puPAR), uPA (puPA) of beide (pU2). Na 72 uur werden de cellen gefixeerd met 3,7% formaldehyde en gedurende 1 uur bij kamertemperatuur geïncubeerd met 1% runderserumalbumine in PBS om te blokkeren. Nadat de glaasjes waren gewassen met PBS, werd ofwel IgG anti-VEGF (muis) of IgG anti-EGFR (muis) toegevoegd in een concentratie van 1:200. De objectglaasjes werden 1 uur bij kamertemperatuur geïncubeerd en driemaal gewassen met PBS om overmaat primair antilichaam te verwijderen. Cellen werden vervolgens gedurende 1 uur bij kamertemperatuur geïncubeerd met anti-muis FITC geconjugeerd IgG (1:500 verdunning). De objectglaasjes werden drie keer gewassen, bedekt met glazen dekglaasjes met DAPI-bevattende montagemedia en fluorescerende microfoto's werden verkregen. Figuur 3A toont expressie van EGFR en VEGF in controle- en EV/SV-, puPAR-, puPA- en pU2-getransfecteerde 4910-cellen. Om vast te stellen in vitro angiogenese, 4910- of SNB19-cellen (2x104/putje) werden gezaaid in objectglaasjes met 8 putjes en getransfecteerd met nep, lege vector (EV) en een vector die siRNA tot expressie brengt voor uPAR (puPAR), uPA (puPA), of beide (pU2 ). Na een incubatieperiode van 24 uur werd het geconditioneerde medium verwijderd en toegevoegd aan 4x104 menselijke dermale endotheelcelmonolaag in kamerglaasjes met 8 putjes. Men liet de menselijke dermale endotheelcellen 72 uur groeien. Cellen werden vervolgens gefixeerd in 3,7% formaldehyde, geblokkeerd met 2% runderserumalbumine en geïncubeerd met primair antilichaam van factor VIII (DAKO Corp., Carpinteria, CA). De cellen werden vervolgens gewassen met PBS en 1 uur geïncubeerd met een FITC-geconjugeerd secundair antilichaam. De objectglaasjes werden gewassen en de vorming van capillairachtige structuren werd waargenomen met behulp van fluorescentiemicroscopie (Fig. 3B). Endotheelcellen werden ook gekweekt in geconditioneerde media van 4910- of SNB19-cellen die waren getransfecteerd met nep, lege vector (EV) en een vector die siRNA tot expressie brengt voor uPAR (puPAR), uPA (puPA), of beide (pU2). Endotheelcellen mochten 72 uur groeien en Hɮ werd gekleurd voor visualisatie van netwerkvorming (Fig. 3B). zoals bepaald door in vitro angiogenese-kwantificering werden vergelijkbare resultaten verkregen voor SNB19- en 4910-cellen. De mate van angiogene inductie werd gekwantificeerd voor zowel SNB19- als 4910-cellen op basis van de numerieke waarde voor het product van het aantal vertakkingen en het aantal vertakkingspunten (*P waarde = 0,005) (Fig. 3C). Figuur 3D toont in vivo angiogene test met behulp van het dorsale huidplooimodel zoals beschreven in Methoden. In het kort werden de dieren geïmplanteerd met diffusiekamers die controle- of pU2-getransfecteerde 4910-cellen in een dorsale holte bevatten. Tien dagen na implantatie werden de dieren opgeofferd en het vaatstelsel gespoeld met FITC-oplossing. De huidplooi die de diffusiekamer bedekte werd geobserveerd op FITC-fluorescentie en in zichtbaar licht op de aanwezigheid van tumor-geïnduceerde neovasculatuur (TN) en reeds bestaande vasculatuur (PV).

Remming van tumorcel-geïnduceerde capillaire netwerkvorming door pU2

Opkomende tumoren zijn afhankelijk van de vorming van nieuwe bloedvaten om de tumorgroei te voeden. Omdat is gerapporteerd dat uPA en uPAR angiogenese reguleren, hebben we vervolgens het effect van pU2 op door tumorcellen geïnduceerde angiogenese beoordeeld. We voerden immunohistochemische analyse uit met behulp van factor VIII-antigeen om tumor-geïnduceerde vaatvorming in een in vitro co-cultuursysteem en Hɮ-kleuring van endotheelcellen gekweekt in geconditioneerde media van SNB19- en 4910-xenotransplantaatcellen na transfectie met mock, EV/SV, puPA, puPAR of pU2. De resultaten toonden aan dat endotheelcellen binnen 48 uur capillaire structuren vormden in de aanwezigheid van nep- en EV/SV-getransfecteerde cellen. Daarentegen remde de pU2-vector significant tumorcel-geïnduceerde capillair-achtige netwerkvorming. SNB19- en 4910-xenotransplantaatcellen vertoonden vergelijkbaar gedrag, hoewel 4910-xenotransplantaatcellen iets agressiever waren in termen van angiogenese in vergelijking met SNB19-cellen (Figuur 3B). De kwantificering van de vertakkingspunten en het aantal vertakkingen was extreem laag in met pU2 getransfecteerde co-culturen in vergelijking met nep- en EV/SV-getransfecteerde cellen. In het geval van co-culturen van xenotransplantaten werden rudimentaire netwerkachtige structuren gezien in de pU2-behandelingsgroep (Figuur 3B). Het effect was minder dan 50% tot 60% in respectievelijk puPA- en puPAR-getransfecteerde co-culturen, in vergelijking met schijn- en EV/SV-getransfecteerde co-culturen in relatie tot capillaire-achtige structuurvorming (Figuur 3C). Om de . te bevestigen in vitro co-cultuurexperimenten, we onderzochten of pU2 tumorangiogenese kon remmen in vivo zoals beoordeeld door het dorsale raammodel. Implantatie van een kamer met nep- en lege vector-getransfecteerde 4910 xenograft-cellen resulteerde in de ontwikkeling van microvaten met dunne, gebogen structuren en talrijke kleine bloedvlekken [zoals aangegeven door pijlen (TN = tumor-geïnduceerde neovasculatuur PV = reeds bestaande vasculatuur)]. Daarentegen resulteerde implantatie van 4910 xenotransplantaatcellen getransfecteerd met pU2 niet in de ontwikkeling van enige aanvullende microvaten (Fig. 3D). Vergelijkbare resultaten werden verkregen met SNB19-cellen (gegevens niet getoond).

SiRNA tegen uPA en uPAR remt migratie en invasie van glioom

Om te bepalen of uPAR- en uPA-siRNA-expressie de migratie van tumorcellen kan beïnvloeden, hebben we SNB19- en 4910-xenotransplantaatsferoïden getransfecteerd met de puPAR, puPA en pU2. Zoals weergegeven in figuur 4A, was er een veel hogere celmigratie in de controle- en EV/SV-getransfecteerde sferoïden dan in de pU2-getransfecteerde sferoïden. Zoals aangetoond door de kwantificering van de afstand van migratie uit de sferoïden, was de celmigratie van de controle en EV/SV-getransfecteerde sferoïden significant hoger (Pπ.05) in vergelijking met pU2-getransfecteerde sferoïden. Matige celmigratie van tumorsferoïden getransfecteerd met puPAR en puPA werd waargenomen. Verder leken 4910 xenograft-cellen meer migrerend te zijn dan SNB19-cellen. Het effect van pU2 was vergelijkbaar in zowel SNB19- als 4910-xenotransplantaatcellen (Figuur 4A).

Migratie werd getest zoals eerder beschreven. Sferoïden van SNB19- of 4910-cellen werden bereid door een suspensie van 2x106 cellen te zaaien in Dulbecco's gemodificeerd Eagle-medium op weefselkweekplaten met ultralage hechting van 100 mm en gekweekt tot sferoïde-aggregaten gevormd. Sferoïden meten

150 μm in diameter (ongeveer 4x104 cellen/sferoïde) werden geselecteerd en getransfecteerd met nep, lege vector (EV) en een vector die siRNA tot expressie brengt voor uPAR (puPAR), uPA (puPA) of beide (pU2). Three days after infection, single glioma spheroids were placed in the center of each well in vitronectin-coated (50 μg/ml) 96-well microplates and 200 μl of serum-free medium was added to each well. Spheroids were incubated at 37ଌ for 24 h, after which the spheroids were fixed and stained with Hema-3 and photographed. Cell migration from spheroids to monolayers was quantified using a microscope calibrated with a stage and ocular micrometer and represented graphically (Fig. 4A). In vitro invasion of SNB19 and 4910 cells was determined by measuring the cells that invaded through matrigel-coated (Collaborative Research, Inc., Boston, MA) transwell inserts (Costar, Cambridge, MA). Briefly, transwell inserts with 8 μm pores were coated with a final concentration of 1 mg/ml of matrigel, SNB19 cells transfected with mock, EV/SV, puPAR, puPA or pU2 were trypsinized, and 200 μl aliquots of cell suspension (1x10 6 cells/ml) were added to the wells in triplicate. After a 24 h incubation period, cells that passed through the filter into the lower wells were quantified as described earlier and expressed as a percentage of cells in the lower wells. Cells on the lower side of the membrane were fixed, stained with Hema-3 and quantified as percent invasion (Fig. 4B). SNB19 and 4910 spheroids were cultured in 6-well ultra low attachment plates. Briefly, 3x10 6 cells were suspended in 10 ml of medium, seeded onto the plates and cultured until spheroids formed. Spheroids, 100� μm in diameter, were selected and transfected with mock, EV/SV, puPAR, puPA or pU2. Three days after infection, tumor spheroids were stained with the fluorescent dye DiI and confronted with fetal rat brain aggregates stained with DiO. The progressive destruction of fetal rat brain aggregates and invasion of SNB19 cells were observed by confocal laser scanning microscopy and photographed as described previously (32, 33). The remaining volume of the rat brain aggregates at 24, 48 and 72 h were quantified using image analysis software as described previously and graphically represented (Fig 4C). X= 4910 xeno

To evaluate the effect of siRNA-mediated inhibition of uPAR and uPA on glioma invasiveness, we utilized a two-model system: the standard matrigel invasion assay and the spheroid invasion assay. SNB19 or 4910 xenograft cells transfected with mock and EV/SV extensively invaded the matrigel-coated transwell insert. In contrast, the pU2-transfected cultures had markedly much less invasiveness through the matrigel as compared to control and EV/SV-transfected cells. Quantitative determination of invasion confirmed that pU2 transfection demonstrated only 6% invasion in SNB19 cells and 8% invasion in 4910 xenograft cells as compared to mock and EV/SV-transfected cells ( Fig. 4B ). Further, quantitative analysis results of invasion of SNB19 and 4910 xenograft cells transfected with puPAR and puPA was 22% (SNB19), 30% (4910) and 35% (SNB19), 40% (4910), respectively ( Fig 4B ).

We further examined the extent of the pU2 effect in a spheroid invasion assay. The EV/SV-transfected spheroids progressively invaded fetal rat brain aggregates and quantitation revealed that the glioma spheroids invaded the fetal rat brain aggregates by 25% within 24 h, 㹰% within 48 h, and 㺐% at 72 h. In contrast, the tumor spheroids transfected with the pU2 vector invaded the fetal rat brain aggregates by only 2% (SNB19) and 2.8% (4910 xeno) after 72 h. Invasion of fetal rat brain aggregates by the single constructs were: 20% (SNB19) and 23% (4910 xeno) with puPAR, and 40% (SNB19) and 60% (4910 xeno) with puPA ( Fig. 4C ). Taken together, these findings provide strong evidence that RNAi-mediated silencing of uPAR and uPA greatly inhibits glioma cell invasion in both in vitro models in comparison to the single siRNA constructs for uPAR and uPA.

UPA and uPAR siRNA suppresses intracranial tumor growth

We used an intracranial tumor model with 4910 xenograft cells to assess the effects of RNAi-mediated inhibition on pre-established tumor growth in vivo. Paraffin brain sections of the untreated (mock) and EV/SV-treated control groups were characterized by large-spread tumor growth after a 5-week follow-up period as visualized by Hɮ staining of similar sections ( Fig. 5A ). However, we could not detect tumors in mice treated with the pU2 vector ( Fig. 5A ). Further quantification of Hɮ-stained brain sections by a neuropathologist (Dr. Gujrati) blinded to treatment condition revealed no difference in tumor size between the control and EV/SV treatment groups. However, total regression of pre-established tumors was revealed in the pU2-treated group ( Fig. 5A & 5B ). Pre-established intracranial tumor growth was inhibited by 70% in puPAR-treated mice and 55% in puPA-treated mice. These results demonstrated that RNAi-mediated suppression of uPAR and uPA inhibited pre-established intracranial tumor growth. Paraffin sections were probed for uPA and uPAR protein as previously described (see Materials and Methods). pU2-treated mice did not exhibit uPAR or uPA protein expression above expected background levels (not shown) whereas the control and EV/SV-treated mice showed increased levels of uPAR and uPA expression localized at the tumor region ( Fig 5C ). To determine whether this downregulation of protein expression was caused by pU2 treatment, paraffin brain sections of 4910 cells implanted in untreated mice (mock) and mice treated with SV/EV, puPAR, puPA and pU2 were probed with an alkaline phosphatase labeled oligo for the CMV promoter region of the pcDNA3 plasmid vector. In the mock sections, no alkaline phosphatase activity was detected. In contrast, we observed alkaline phosphatase activity in the EV/SV-, puPAR-, puPA- and pU2-treated mice, indicating the presence of a pcDNA3 vector in the tissue ( Fig 5D ). As a positive control, mice were injected intracranially with interferon α to determine OAS1 expression. Total RNA from fresh or paraffin-embedded brain sections was used for RT-PCR to determine in vivo induction of interferon response plasmids inducing RNAi (see Materials and Methods). From the RT-PCR analysis, it is clear that no OAS1 induction was observed in the mock, EV/SV-, puPAR-, puPA- or pU2-treated mice. RT-PCR for GAPDH served as an internal control ( Fig 5E ). The presence of a pcDNA3 vector was confirmed by regular PCR analysis ( Fig 5E ). To determine the survival rate of mice implanted with 4910 xenograft intracranial tumors, we performed a long-term survival study, Thirty days after implantation, all of the control mice died and paraffin sections of these brains revealed the presence of large intracranial tumors ( Fig 5A ). In contrast, pU2-treated mice survived much longer. One mouse from the pU2-treated group died after 43 days, but paraffin sections revealed the presence of a hemorrhage and very few xenograft cells indicating that the death of this animal was not due to an intracranial tumor (not shown). The remaining 5 animals in the pU2-treated group were sacrificed after 112 days. Paraffin sections of these mice revealed no intracranial tumors, normal brain morphology, and no visible 4910-xenograft tumor cells. The survival rate is represented as percent survival in Figure 5F .

For the intracerebral tumor model, 2x10 6 4910 xenograft tumor cells were intracerebrally injected into nude mice. Ten days after tumor implantation, the mice were treated with intraperitoneal injections of pU2 (150μg/injection/mouse) every other day three times. Control mice were either injected with PBS alone or with an empty plasmid vector (150μg/injection/mouse). Five weeks after tumor inoculation, six mice from each group were sacrificed via cardiac perfusion with 3.5% formaldehyde in PBS, their brains removed, and paraffin sections prepared. Sections were stained with hematoxylin and eosin to visualize tumor cells and to examine tumor volume as described in Methods (arrows point to approximate site of intracranial implantation site) (Fig. 5A & 5B). To visualize the expression levels of uPAR and uPA in intracranial tumors, mouse brains were fixed in formaldehyde and embedded in paraffin per standard protocols. Sections were deparaffinized, blocked in 1% BSA in PBS for 1 h, and subsequently transferred to primary antibody (uPAR and uPA) diluted in 1% BSA in PBS (1:500). Sections were allowed to incubate in the primary antibody solution for 2 h at 4஬ in a humidified chamber, followed by a wash in 1% BSA in PBS and placed in a solution with the appropriate (anti-mouse and anti-rabbit FITC) secondary antibody. The sections were allowed to incubate with the secondary antibody for 1 h and visualized using a confocal microscope. Images were obtained for FITC. Transmitted light images were also obtained after Hɮ staining to visualize the morphology of the sections. A control study was performed using a normal rabbit immunoglobulin fraction as the primary antibody (control Ab) instead of uPAR or uPA (Fig. 5C). ter plaatse hybridization was performed to determine the presence of transfected plasmid intracranially after intraperitoneal injections. Briefly, ten days after tumor implantation the mice were treated with intraperitoneal injections of control, EV/SV, puPAR, puPA or pU2 (150μg/injection/mouse) every other day three times. Control mice were injected with PBS alone. Five weeks after tumor inoculation, six mice from each group were sacrificed and brains processed as described in Methods. Sections were deparaffinized and probed for pcDNA3-CMV promoter using specific alkaline phosphatase-labeled DNA oligo (CTGGTGTCGACCTGCTTCCGCGATGTACGGGC) per standard protocols. The presence of CMV promoter was determined by the development of a blue precipitate of NBT alkaline phosphatase substrate. Arrows point to region of localization (Fig. 5D). The presence of plasmids intracranially was also determined by PCR amplification of CMV to BGH construct region of the plasmid using deparaffinized intracranial sections of control, EV/SV-, puPAR-, puPA- or pU2-intraperitoneally injected mice. To determine if interferon induction was present intracranially, total RNA was isolated from fresh or paraffin-embedded brain tissue from mice injected with control, EV/SV, puPAR, puPA, pU2, or interferon (0.5ng) intracranially and RT-PCR was performed using primers specific for OAS1 (Fig. 5E). Nude mice were implanted with intracranial xenograft tumors and their survival ability was determined. Two sets of animals were used (6 mice/group). Both sets of mice were implanted with intracranial xenograft tumors as described previously. Ten days after tumor implantation, the mice were treated with intraperitoneal injections of pU2 plasmid (150μg/injection/mouse) three times every other day. Control mice were either injected with PBS alone or with empty plasmid vector (150μg/injection/mouse). The mice were maintained in clean room conditions and monitored every day for 112 days after which the experiment was artificially terminated. Brains were harvested, paraffin embedded, sectioned, and Hɮ stained as per standard protocols. Survival curve was plotted per standard methods and graphically represented (Fig 5F).


Conclusie

The use of botulinum toxins has revolutionised the treatment of various ophthalmic spastic disorders, facial dystonias and periocular wrinkles. A precise knowledge and understanding of the functional anatomy of the mimetic muscles is absolutely necessary to correctly use botulinum toxins in clinical practice. Adverse effects are usually mild and transient. The most common substantive complication is excessive or unwanted weakness, and this resolves as the action of the toxin is lost. Brow ptosis, eyelid ptosis, neck weakness, dysphagia, and diplopia may occur. Knowledge of the functional anatomy and experience with the procedure help injectors avoid complications. In future, the development of new potent toxins with increasing effectiveness and duration of effect will further aid this expanding and interesting field of chemodenervation.


Zebrafish at the Interface of Development and Disease Research

Victoria E. Prince , . Gokhan Dalgin , in Current Topics in Developmental Biology , 2017

4.1.2 Chemical Destruction of Beta Cells

Streptozotocin (STZ) is a common reagent used to injure the pancreas in rodents. STZ is also effective at beta cell ablation in adult fish, but relatively high concentrations are needed both in zebrafish ( Moss et al., 2009 Olsen, Sarras, & Intine, 2010 Sarras, Leontovich, Olsen, & Intine, 2013 ) and in another teleost fish model, Tilapia ( Wright, Abraham, Dickson, Yang, & Morrison, 1999 ). Use of STZ in zebrafish embryos or larvae has not been reported, nor was this approach effective in our hands (RMA, unpublished). Interestingly, human beta cells are very resistant to STZ ( Yang & Wright, 2002 ), suggesting that fish beta cells may be more similar to human beta cells than to those of mice in this regard.


Jie Z, Xia H, Zhong SL, Feng Q, Li S, Liang S, Zhong H, Liu Z, Gao Y, Zhao H, et al. The gut microbiome in atherosclerotic cardiovascular disease. Nat Comm. 20178:845.

Zhao L, Zhang F, Ding X, Wu G, Lam YY, Wang X, Fu H, Xue X, Lu C, Ma J, et al. Gut bacteria selectively promoted by dietary fibers alleviate type 2 diabetes. Wetenschap. 2018359:1151–6.

Cho I, Blaser MJ. The human microbiome: at the interface of health and disease. Nat Rev Genet. 201213:260–70.

McKenney PT, Pamer EG. From hype to hope: the gut microbiota in enteric infectious disease. Cel. 2015163:1326–32.

Brown RL, Sequeira RP, Clarke TB. The microbiota protects against respiratory infection via GM-CSF signaling. Nat Comm. 20178:1512.

Boktor SW, Hafner JW. Influenza. In: StatPearls. Treasure Island (FL): StatPearls Publishing 2020.

Davidson S. Treating influenza infection, from now and into the future. Front Immunol. 20189:1946.

Shi J, Deng G, Ma S, Zeng X, Yin X, Li M, Zhang B, Cui P, Chen Y, Yang H, et al. Rapid evolution of H7N9 highly pathogenic viruses that emerged in China in 2017. Cell Host Microbe. 201824(4):558–568.e7.

Ichinohe T, Pang IK, Kumamoto Y, Peaper DR, Ho JH, Murray TS, Iwasaki A. Microbiota regulates immune defense against respiratory tract influenza A virus infection. Proc Natl Acad Sci U S A. 2011108:5354–9.

Steed AL, Christophi GP, Kaiko GE, Sun L, Goodwin VM, Jain U, Esaulova E, Artyomov MN, Morales DJ, Holtzman MJ, et al. The microbial metabolite desaminotyrosine protects from influenza through type I interferon. Wetenschap. 2017357:498–502.

Rosshart SP, Vassallo BG, Angeletti D, Hutchinson DS, Morgan AP, Takeda K, Hickman HD, McCulloch JA, Badger JH, Ajami NJ, et al. Wild mouse gut microbiota promotes host fitness and improves disease resistance. Cel. 2017171:1015–28 e1013.

Masetti G, Moshkelgosha S, Kohling HL, Covelli D, Banga JP, Berchner-Pfannschmidt U, Horstmann M, Diaz-Cano S, Goertz GE, Plummer S, et al. Gut microbiota in experimental murine model of Graves’ orbitopathy established in different environments may modulate clinical presentation of disease. Microbiome. 20186:97.

Flemer B, Warren RD, Barrett MP, Cisek K, Das A, Jeffery IB, Hurley E, O’Riordain M, Shanahan F, O’Toole PW. The oral microbiota in colorectal cancer is distinctive and predictive. Darm. 201867:1454–63.

Brown RL, Clarke TB. The regulation of host defences to infection by the microbiota. Immunology. 2017150:1–6.

Sanchez KK, Chen GY, Schieber AMP, Redford SE, Shokhirev MN, Leblanc M, Lee YM, Ayres JS. Cooperative metabolic adaptations in the host can favor asymptomatic infection and select for attenuated virulence in an enteric pathogen. Cel. 2018175:146–58 e115.

Le Barz M, Daniel N, Varin TV, Naimi S, Demers-Mathieu V, Pilon G, Audy J, Laurin E, Roy D, Urdaci MC, et al. In vivo screening of multiple bacterial strains identifies Lactobacillus rhamnosus Lb102 and Bifidobacterium animalis ssp. lactis Bf141 as probiotics that improve metabolic disorders in a mouse model of obesity. FASEB J. 201933(4):4921–4935.

Fang HR, Zhang GQ, Cheng JY, Li ZY. Efficacy of Lactobacillus-supplemented triple therapy for Helicobacter pylori infection in children: a meta-analysis of randomized controlled trials. Eur J Pediatr. 2019178:7–16.

Routy B, Le Chatelier E, Derosa L, Duong CPM, Alou MT, Daillere R, Fluckiger A, Messaoudene M, Rauber C, Roberti MP, et al. Gut microbiome influences efficacy of PD-1-based immunotherapy against epithelial tumors. Wetenschap. 2018359:91–7.

Yildiz S, Mazel-Sanchez B, Kandasamy M, Manicassamy B, Schmolke M. Influenza A virus infection impacts systemic microbiota dynamics and causes quantitative enteric dysbiosis. Microbiome. 20186:9.

Kawahara T, Takahashi T, Oishi K, Tanaka H, Masuda M, Takahashi S, Takano M, Kawakami T, Fukushima K, Kanazawa H, Suzuki T. Consecutive oral administration of Bifidobacterium longum MM-2 improves the defense system against influenza virus infection by enhancing natural killer cell activity in a murine model. Microbiol Immunol. 201559:1–12.

Hori T, Kiyoshima J, Shida K, Yasui H. Augmentation of cellular immunity and reduction of influenza virus titer in aged mice fed Lactobacillus casei strain Shirota. Clin Diagn Lab Immunol. 20029:105–8.

Villena J, Chiba E, Tomosada Y, Salva S, Marranzino G, Kitazawa H, Alvarez S. Orally administered Lactobacillus rhamnosus modulates the respiratory immune response triggered by the viral pathogen-associated molecular pattern poly(I:C). BMC Immunol. 201213:53.

Kiso M, Takano R, Sakabe S, Katsura H, Shinya K, Uraki R, Watanabe S, Saito H, Toba M, Kohda N, Kawaoka Y. Protective efficacy of orally administered, heat-killed Lactobacillus pentosus b240 against influenza a virus. Sci Rep. 20133:1563.

Cook JC, Wu H, Aleo MD, Adkins K. Principles of precision medicine and its application in toxicology. J Toxicol Sci. 201843:565–77.

Giovannoni G. Personalized medicine in multiple sclerosis. Neurodegener Dis Manag. 20177:13–7.

Valenzuela-Sanchez F, Valenzuela-Mendez B, Rodriguez-Gutierrez JF, Rello J. Personalized medicine in severe influenza. Eur J Clin Microbiol Infect Dis. 201635:893–7.

Ruiz L, Delgado S, Ruas-Madiedo P, Margolles A, Sanchez B. Proteinaceous molecules mediating Bifidobacterium-host interactions. Microbiol vooraan. 20167:1193.

Azzam MM, Dong XY, Dai L, Zou XT. Effect of excess dietary L-valine on laying hen performance, egg quality, serum free amino acids, immune function and antioxidant enzyme activity. Br Poult Sci. 201556:72–8.

Luo JB, Feng L, Jiang WD, Liu Y, Wu P, Jiang J, Kuang SY, Tang L, Zhang YA, Zhou XQ. The impaired intestinal mucosal immune system by valine deficiency for young grass carp (Ctenopharyngodon idella) is associated with decreasing immune status and regulating tight junction proteins transcript abundance in the intestine. Fish Shellfish Immunol. 201440:197–207.

Shurubor YI, D’Aurelio M, Clark-Matott J, Isakova EP, Deryabina YI, Beal MF, Cooper AJL, Krasnikov BF. Determination of coenzyme a and acetyl-coenzyme A in biological samples using HPLC with UV detection. Molecules. 201722(9):1388.

Zhang Z, Lv J, Pan L, Zhang Y. Roles and applications of probiotic Lactobacillus strains. Appl Microbiol Biotechnol. 2018102:8135–43.

Derrien M, Van Baarlen P, Hooiveld G, Norin E, Muller M, de Vos WM. Modulation of mucosal immune response, tolerance, and proliferation in mice colonized by the Mucin-degrader Akkermansia muciniphila. Microbiol vooraan. 20112:166.

Cani PD, de Vos WM. Next-generation beneficial microbes: the case of Akkermansia muciniphila. Microbiol vooraan. 20178:1765.

Nishiyama K, Yamamoto Y, Sugiyama M, Takaki T, Urashima T, Fukiya S, Yokota A, Okada N, Mukai T. Bifidobacterium bifidum extracellular sialidase enhances adhesion to the mucosal surface and supports carbohydrate assimilation. mBio. 20178(5):e00928–17.

Zhao Z, Yi C, Zhao L, Wang S, Zhou L, Hu Y, Zou W, Chen H, Jin M. PB2-588I enhances 2009 H1N1 pandemic influenza virus virulence by increasing viral replication and exacerbating PB2 inhibition of beta interferon expression. J Virol. 201488:2260–7.

Staley C, Kaiser T, Beura LK, Hamilton MJ, Weingarden AR, Bobr A, Kang J, Masopust D, Sadowsky MJ, Khoruts A. Stable engraftment of human microbiota into mice with a single oral gavage following antibiotic conditioning. Microbiome. 20175:87.

Hu J, Ma L, Nie Y, Chen J, Zheng W, Wang X, Xie C, Zheng Z, Wang Z, Yang T, et al. A microbiota-derived bacteriocin targets the host to confer diarrhea resistance in early-weaned piglets. Cell Host Microbe. 201824:817–32 e818.

Jacquet N, Navarre C, Desmecht D, Boutry M. Hydrophobin fusion of an influenza virus hemagglutinin allows high transient expression in Nicotiana benthamiana, easy purification and immune response with neutralizing activity. PLoS Een. 20149:e115944.

Reed ML, Bridges OA, Seiler P, Kim JK, Yen HL, Salomon R, Govorkova EA, Webster RG, Russell CJ. The pH of activation of the hemagglutinin protein regulates H5N1 influenza virus pathogenicity and transmissibility in ducks. J Virol. 201084:1527–35.

Sonnenburg ED, Smits SA, Tikhonov M, Higginbottom SK, Wingreen NS, Sonnenburg JL. Diet-induced extinctions in the gut microbiota compound over generations. Natuur. 2016529:212–5.

Magoc T, Salzberg SL. FLASH: fast length adjustment of short reads to improve genome assemblies. Bio-informatica. 201127:2957–63.

Caporaso JG, Kuczynski J, Stombaugh J, Bittinger K, Bushman FD, Costello EK, Fierer N, Pena AG, Goodrich JK, Gordon JI, et al. QIIME allows analysis of high-throughput community sequencing data. Nat methoden. 20107:335–6.

Edgar RC. UPARSE: highly accurate OTU sequences from microbial amplicon reads. Nat methoden. 201310:996–8.

Quast C, Pruesse E, Yilmaz P, Gerken J, Schweer T, Yarza P, Peplies J, Glockner FO. The SILVA ribosomal RNA gene database project: improved data processing and web-based tools. Nucleïnezuren Res. 201341:D590–6.

Langmead B, Salzberg SL. Fast gapped-read alignment with Bowtie 2. Nat Methods. 20129:357–9.

Li R, Yu C, Li Y, Lam TW, Yiu SM, Kristiansen K, Wang J. SOAP2: an improved ultrafast tool for short read alignment. Bio-informatica. 200925:1966–7.

Zhu W, Lomsadze A, Borodovsky M. Ab initio gene identification in metagenomic sequences. Nucleïnezuren Res. 201038:e132.

Li W, Godzik A. Cd-hit: a fast program for clustering and comparing large sets of protein or nucleotide sequences. Bio-informatica. 200622:1658–9.

Qin J, Li R, Raes J, Arumugam M, Burgdorf KS, Manichanh C, Nielsen T, Pons N, Levenez F, Yamada T, et al. A human gut microbial gene catalogue established by metagenomic sequencing. Natuur. 2010464:59–65.

Villar E, Farrant GK, Follows M, Garczarek L, Speich S, Audic S, Bittner L, Blanke B, Brum JR, Brunet C, et al. Ocean plankton. Environmental characteristics of Agulhas rings affect interocean plankton transport. Wetenschap. 2015348:1261447.

Buchfink B, Xie C, Huson DH. Fast and sensitive protein alignment using DIAMOND. Nat methoden. 201512:59–60.

Huson DH, Auch AF, Qi J, Schuster SC. MEGAN analysis of metagenomic data. Genoom onderzoek. 200717:377–86.

Backhed F, Roswall J, Peng Y, Feng Q, Jia H, Kovatcheva-Datchary P, Li Y, Xia Y, Xie H, Zhong H, et al. Dynamics and stabilization of the human gut microbiome during the first year of life. Cell Host Microbe. 201517:852.

Greenblum S, Turnbaugh PJ, Borenstein E. Metagenomic systems biology of the human gut microbiome reveals topological shifts associated with obesity and inflammatory bowel disease. Proc Natl Acad Sci U S A. 2012109:594–9.

Nielsen HB, Almeida M, Juncker AS, Rasmussen S, Li J, Sunagawa S, Plichta DR, Gautier L, Pedersen AG, Le Chatelier E, et al. Identification and assembly of genomes and genetic elements in complex metagenomic samples without using reference genomes. Nat Biotechnologie. 201432:822–8.

Qin J, Li Y, Cai Z, Li S, Zhu J, Zhang F, Liang S, Zhang W, Guan Y, Shen D, et al. A metagenome-wide association study of gut microbiota in type 2 diabetes. Natuur. 2012490:55–60.

Seishima J, Iida N, Kitamura K, Yutani M, Wang Z, Seki A, Yamashita T, Sakai Y, Honda M, Yamashita T, et al. Gut-derived Enterococcus faecium from ulcerative colitis patients promotes colitis in a genetically susceptible mouse host. Genoom Biol. 201920:252.

Junick J, Blaut M. Quantification of human fecal Bifidobacterium species by use of quantitative real-time PCR analysis targeting the groEL gene. Appl Environ Microbiol. 201278:2613–22.

Segata N, Izard J, Waldron L, Gevers D, Miropolsky L, Garrett WS, Huttenhower C. Metagenomic biomarker discovery and explanation. Genoom Biol. 201112:R60.

White JR, Nagarajan N, Pop M. Statistical methods for detecting differentially abundant features in clinical metagenomic samples. PLoS Comput Biol. 20095:e1000352.

Zhang Q, Hu J, Feng J-W, Hu X-T, Wang T, Gong W-X, Huang K, Guo Y-X, Zou Z, et al: Study on the diversity of gut microorganisms in mice infected with different toxic H7N9 viruses. EBI European Nucleotide Archive. Project PRJEB31298. https://www.ebi.ac.uk/ena/data/view/PRJEB31298. Accessed 31 May 2019.


Intraperitoneal oil application causes local inflammation with depletion of resident peritoneal macrophages

Oils, used as solvents for many drugs and compounds, may cause inflammation if injected intraperitoneally.

Achtergrond:
Mice are treated with drugs and compounds for various purposes such as conditional alteration of a gene, depletion of cells, or recapitulating human diseases and finding their cure (Günschmann et al., 2014 Hua, Shi, Shultz, & Ren, 2018 Rosenthal & Brown, 2007). These compounds are dissolved in the respective solvents depending on their hydrophilicity and are administered via different routes such as oral gavage, intraperitoneal injection (I.P.), intravenous injection and subcutaneous injection, to maximize the effects of the treatments (Turner, Brabb, Pekow, & Vasbinder, 2011). Usually, mice treated with oil are used as controls along with the wild type mice to rule out any effects of the oil or the route of administration. This makes it essential to ensure that the mice treated with oil and the untreated wild type mice are comparable so that any significant change following treatment is attributed only to the experimental compound. It also helps in reducing the chances of side-effects, thereby improving the specificity and authenticity of the experimental system.
Alsina-Sanchis et al. study the potential of vegetal and mineral oils to induce inflammation in the peritoneum and suggest that oral gavage instead of intraperitoneal injection might be a safer way to deliver lipophilic compounds to avoid inflammation.

Key findings:
1.) Significant increase in inflammation in the omentum and the mesentery upon intraperitoneal injection of peanut and mineral oils
The authors show that the omentum of the mice treated with oil by I.P. is swollen and dark with larger blood vessels. The vessel density also increases as shown by the quantification of CD31 staining, (a marker for endothelial cells). While all the oils show inflammatory response by increased recruitment of CD11b+ cells or by the presence of foamy macrophages, the effects are most pronounced for peanut and mineral oils. Furthermore, Sirius red staining shows an increased deposition of collagen that indicates fibrosis. They observe similar changes in the mesentery too, implicating chances of peritoneal inflammation by oil injected in the peritoneum. Mice treated by oral gavage are comparable with the untreated mice with no inflammatory burden.

2.) Oils deplete tissue-resident macrophage population by causing their death
The total population of macrophages (CD45+CD11+F4/80+) does not change between untreated or oil-injected mice. But staining for Tim4, a marker for long term resident macrophages, shows a significant reduction in their number, thereby, suggesting an increased recruitment of monocyte-derived macrophages associated with depletion of the resident population.
Macrophages take up oils and perish by different mechanisms such as apoptosis, necrosis, efferocytosis and pyroptosis. The mode of death determines whether the inflammation would be resolved. The authors study the mechanisms of death in macrophages by flow cytometric analysis on the peritoneal macrophages and by staining of cell lines treated with oils. They show that taking up olive oil by macrophages leads to their death by apoptosis which aids in resolving inflammation. However, peanut oil causes pyroptosis in macrophages impeding the reduction in inflammation.

3.) Thioglycolate-induced peritonitis model and mice intraperitoneally injected with oil have comparable inflammatory burden
When bacterial peritonitis is induced in mice by treating them with thioglycolate, the authors observe that the mice receiving peanut oil by oral gavage register a 50% increase in the myeloid cell population. But when treated with peanut oil by I.P., mice do not show a significant change in the number of myeloid cells as they already exhibit a basal level of inflammation.
Taken together, the authors suggest that oral gavage is a better and safer way to administer lipophilic compounds than I.P.

What intrigued me to choose this preprint?
The authors have tried to shed light on the choice of solvents and their correct route of administration to avoid inflammation. This work may serve as a guide for those who want to treat mice for experimental purposes.

Open questions:
1.) In this work, I.P. is given for 5 consecutive days whereas oral gavage is done once. Does this treatment regime itself introduce the differential inflammation burden?
2.) Not all I.P. treatments need to be done for 5 consecutive days. I.P. can also be given once to achieve desirable effects in a context-dependent manner. In that case, how will the inflammation status be affected?
3.) I.P. results in global effects. In that case should one expect a global change in systemic inflammation?
4.) While the mechanisms underlying the death of macrophages are shown to be independent of inflammation what properties of these oils might have led to the differential effects?

Referenties:
Günschmann, C., Chiticariu, E., Garg, B., Hiz, M. M., Mostmans, Y., Wehner, M., & Scharfenberger, L. (2014). Transgenic mouse technology in skin biology: Inducible gene knockout in mice. Journal of Investigative Dermatology. https://doi.org/10.1038/jid.2014.213
Hua, L., Shi, J., Shultz, L. D., & Ren, G. (2018). Genetic models of macrophage depletion. In
Methods in Molecular Biology. https://doi.org/10.1007/978-1-4939-7837-3_22
Rosenthal, N., & Brown, S. (2007). The mouse ascending: Perspectives for human-disease models. Nature Cell Biology. https://doi.org/10.1038/ncb437
Turner, P. V., Brabb, T., Pekow, C., & Vasbinder, M. A. (2011). Administration of substances to laboratory animals: Routes of administration and factors to consider. Journal of the American Association for Laboratory Animal Science.

Posted on: 12th September 2020 , updated on: 21st September 2020

Deel dit:

Read preprint (No Ratings Yet)

Discussie

In the present study, we provide evidence to suggest that the direct i.p. injections of plasmids expressing siRNA targeting uPAR and uPA inhibit intracranial tumor growth in nude mice. Extracellular matrix destruction is dependent on the expression of proteases, which are overexpressed in gliomas (34–37). Using an adenovirus-mediated antisense construct for uPAR and uPA, we have already shown that the simultaneous down-regulation of uPAR and uPA has a synergistic effect rather than an additive one (38). However, using an adenovirus to deliver therapeutic genes presents significant problems, including accurate targeting and toxicity (39). In recent years, several groups have experimented with various modifications, but thus far, none of these altered methods have been successful in eliminating the aforementioned problems (40). Here, we show that a simple CMV plasmid vector driving the production of hairpin-like RNA molecules can be used therapeutically. As indicated by the RT-PCR results, the use of an mRNA-like molecule possessing a polyadenylic acid tail and having 21-bp inverted repeats, which target uPAR and uPA, did not induce an IFN-like response. Other groups have used lentiviral vectors to successfully target specific proteases, such as plasminogen activator inhibitor-1, but still induced OAS1 (41). Here, we did not observe the induction of OAS1. This might have been due to the presence of a polyadenylic acid tail mimicking cellular mRNA and appearing as “self” to the cell. As expected, the down-regulation of the target mRNA molecule was observed with siRNA, whereas no down-regulation was observed with the use of an antisense sequence. With an antisense approach, equimolar quantities of the antisense molecule are required to silence the target gene. This is not required with RNAi where the RISC behaves like a catalyst and is reused (42). In essence, a small amount of RNAi-inducing molecules, such as siRNA or hpRNA, is sufficient to induce silencing of target genes. Our results show that future therapeutic use of RNAi to treat gliomas is very probable. Urokinase plasminogen activator and its receptor play important roles in invasion and migration of metastatic gliomas (35–37). Using these proteases as targets is very attractive for the treatment of gliomas.

In terms of angiogenesis, the use of antiangiogenic drugs has been met with mixed success (43). The targeting of uPAR and uPA, which are also indirectly involved in angiogenic pathways (44, 45), has revealed the importance of their targeting in cancer therapy. Our results show that the simultaneous down-regulation of uPAR and uPA causes the down-regulation of EGFR and VEGF in EGFR-overexpressing glioma xenograft cells (4910). ter plaatse studies confirm Western blot analysis results in also demonstrating the down-regulation of EGFR and VEGF. ter plaatse angiogenic assays have shown that endothelial cells cocultured with EGFR-overexpressing 4910 cells induce the endothelial cells to form a network-like pattern mimicking tumor angiogenesis. Progressive reduction in the network formation was seen in puPAR- and puPA-transfected cells. In cells transfected with pU2, we observed complete regression of network formation, indicating that the simultaneous down-regulation of uPAR and uPA causes the tumor cells to retard or stop secreting factors necessary for the induction of angiogenesis. The dorsal skin fold assay, an in vivo angiogenic assay, revealed complete inhibition of angiogenesis by pU2-transfected 4910 cells. Although our previous work using an adenovirus-mediated strategy had similar results (38), the major difference is that 100 multiplicity of infection of virus particles were required to achieve the same effect as 6 μg of plasmid. We also observed similar results with the other assays. For example, spheroid migration was significantly inhibited in pU2-treated SNB19 and 4910 xenograft cells. Our invasion studies showed that after transfection with pU2, both SNB19 and 4910 cells exhibited a significant reduction in their invasive ability—only 5% to 8% invasion when compared with the controls. From these spheroid invasion assay results, it is clear that the simultaneous down-regulation of uPAR and uPA retards the invasion of fetal rat brain aggregates.

uPAR is associated with integrins and is known to mediate cellular motility via extracellular matrix components such as vitronectin (46). In addition, association of uPAR with integrins mediates ras signaling pathways (47, 48). uPAR and uPA have also been observed at the leading edge of invading tumors (48). Hence, uPAR is a logical target to inhibit tumor invasion and migration. Our animal studies show that the simultaneous down-regulation of uPAR and uPA causes the regression of intracranial tumors. Nude mice implanted with 4910 xenograft cells intracranially usually die in 4 weeks due to tumor invasion. In contrast, mice injected with pU2 i.p. do not exhibit tumor establishment and survived for over 112 days after implantation. It would be of academic interest to see if similar results can be obtained using antisense vector constructs. Nevertheless, as the ter plaatse hybridization studies indicated, there was translocation of the i.p. injected plasmid to the brain. The plasmids may pass through the blood-brain barrier probably due to the already compromised blood-brain barrier at the tumor site. The presence of the plasmid intracranially in control was seen primarily surrounding vessels (not shown). As such, the potential for using siRNA vectors for future therapy is promising. Agrawal and Iyer (49) have reviewed the advantages and disadvantages of using an antisense strategy for therapeutic purposes. Our results show that, in spite of being injected i.p., siRNA-expressing plasmids localize intracranially and effectively down-regulate uPAR and uPA. RT-PCR of the brain tissue showed that although plasmid localization was observed in the brain, no OAS1 induction was detected. This indicates that the presence of a polyadenylic acid tail probably prevented the induction of an IFN-like response. In conclusion, the RNAi-mediated down-regulation of uPAR and uPA has clear clinical implications for the treatment of gliomas as well as other cancers.